RESUMEN
Rational construction of broadband and strong visible-light-absorbing (BSVLA) earth-abundant complexes is of great importance for efficient and sustainable solar energy utilization. Herein, we explore a universal Cu(I) center to couple with multiple strong visible-light-absorbing antennas to break the energy level limitations of the current noble-metal complexes, resulting in the BSVLA nonprecious complex (Cu-3). Systematic investigations demonstrate that double "ping-pong" energy-transfer processes in Cu-3 involving resonance energy transfer and Dexter mechanism enable a BSVLA between 430 and 620 nm and an antenna-localized long-lived triplet state for efficient intermolecular electron/energy transfer. Impressively, Cu-3 exhibited an outstanding performance for both energy- and electron-transfer reactions. Pseudo-first-order rate constant of photooxidation of 1,5-dihydroxynaphthalene with Cu-3 can achieve a record value of 190.8 × 10-3 min-1 among the molecular catalytic systems, over 30 times higher than that with a noble-metal photosensitizer (PS) [Ru(bpy)3]2+. These findings pave the way to develop BSVLA earth-abundant PSs for boosting photosynthesis.
Asunto(s)
Complejos de Coordinación , Luz , Fotosíntesis , Fármacos Fotosensibilizantes , Transferencia de EnergíaRESUMEN
ConspectusSolar-driven CO2 reduction into value-added chemicals, such as CO, HCOOH, CH4, and C2+ products, has been regarded as a potential way to alleviate environmental pollution and the energy crisis. In the past decades, numerous pioneered homogeneous catalytic systems composed of soluble photosensitizers (PSs) and catalytic active sites (CASs) have been explored for CO2 photoreduction. Nevertheless, inefficient electron migration based on random collision between CASs and PSs in homogeneous catalytic systems usually causes mediocre performance. Moreover, the relatively poor separation/recycling capability of the homogeneous systems has inevitably reduced their reusability and practicality. The rational combination of PSs and CASs have been proven to play critical roles in the development of highly efficient heterogeneous catalysts to improve their performance, such as anchoring them onto the solid matrixes or connecting them through bridging ligands. However, developing effective assembly strategies to achieve the ordered orientation and uniform heterogenization of PSs and CASs remains a great challenge, mainly due to the lack of crystallinity heterogeneous transformation and structural tailoring ability of traditional solid catalysts. Moreover, due to the lack of assembly and synthesis strategies, many efficient homogeneous photocatalytic systems are still unable to achieve high crystallinity heterogeneous transformation.Metal-organic frameworks (MOFs) and covalent-organic frameworks (COFs) have recently attracted broad interest toward CO2 photocatalysis because of their diverse precursors, well-defined and tailorable structures, abundant exposed CASs and high surface areas, etc. Especially, the highly ordered orientation and uniform combination of PSs and CASs in MOFs and COFs are beneficial for improved light harvesting and charge separation, greatly helping to address the aforementioned challenges. Moreover, the well-defined crystalline structures of MOFs and COFs facilitate the establishment of the structure-activity relationship. Therefore, it is increasingly important to summarize the integration of PSs and catalysts to provide deep insight into MOF/COF-based photocatalysts.In this Account, we summarize the ordered integration of PSs and CASs in MOFs and COFs for CO2 photoconversion and describe the structure-activity relationships to guide the design of effective catalysts. Given the unique structural features of MOFs and COFs, we have emphasized the integration of PSs and CASs to optimize their photocatalytic performance, including the confinement of catalytic active nanoparticles (NPs) into photosensitizing frameworks, co-coordination of PSs and CASs, and ligand-to-metal charge-transfer and anchoring CASs on the secondary building units of the photosensitizing frameworks. The catalytic activity, selectivity, sacrificial agent, and stability of these systems were then discussed. More importantly, MOFs and COFs provide powerful platforms to understand the key steps for boosting CO2 photoreduction and exploring the catalytic mechanism, involving light harvesting, electron-hole separation/migration, and surface redox reactions. Finally, the perspective and challenge of CO2 photoreduction in MOF/COF platforms are further proposed and discussed. It is expected that this Account would provide deep insight into the integration of PSs and catalysts in COFs and MOFs with well-defined structures and afford significant inspiration toward enhanced performance in heterogeneous catalysis.
RESUMEN
BACKGROUND: The clinical efficacy and safety of intravenous immunoglobulin (IVIg) treatment for COVID-19 remain controversial. This study aimed to map the current status and gaps of available evidence, and conduct a meta-analysis to further investigate the benefit of IVIg in COVID-19 patients. METHODS: Electronic databases were searched for systematic reviews/meta-analyses (SR/MAs), primary studies with control groups, reporting on the use of IVIg in patients with COVID-19. A random-effects meta-analysis with subgroup analyses regarding study design and patient disease severity was performed. Our outcomes of interest determined by the evidence mapping, were mortality, length of hospitalization (days), length of intensive care unit (ICU) stay (days), number of patients requiring mechanical ventilation, and adverse events. RESULTS: We included 34 studies (12 SR/MAs, 8 prospective and 14 retrospective studies). A total of 5571 hospitalized patients were involved in 22 primary studies. Random-effects meta-analyses of very low to moderate evidence showed that there was little or no difference between IVIg and standard care or placebo in reducing mortality (relative risk [RR] 0.91; 95% CI 0.78-1.06; risk difference [RD] 3.3% fewer), length of hospital (mean difference [MD] 0.37; 95% CI - 2.56, 3.31) and ICU (MD 0.36; 95% CI - 0.81, 1.53) stays, mechanical ventilation use (RR 0.92; 95% CI 0.68-1.24; RD 2.8% fewer), and adverse events (RR 0.98; 95% CI 0.84-1.14; RD 0.5% fewer) of patients with COVID-19. Sensitivity analysis using a fixed-effects model indicated that IVIg may reduce mortality (RR 0.76; 95% CI 0.60-0.97), and increase length of hospital stay (MD 0.68; 95% CI 0.09-1.28). CONCLUSION: Very low to moderate certainty of evidence indicated IVIg may not improve the clinical outcomes of hospitalized patients with COVID-19. Given the discrepancy between the random- and fixed-effects model results, further large-scale and well-designed RCTs are warranted.
Asunto(s)
COVID-19 , Inmunoglobulinas Intravenosas , Humanos , Inmunoglobulinas Intravenosas/efectos adversos , Estudios Prospectivos , Estudios Retrospectivos , Revisiones Sistemáticas como AsuntoRESUMEN
Solar-driven CO2 reduction and water oxidation to liquid fuels represents a promising solution to alleviate energy crisis and climate issue, but it remains a great challenge for generating CH3OH and CH3CH2OH dominated by multi-electron transfer. Single-cluster catalysts with super electron acceptance, accurate molecular structure, customizable electronic structure and multiple adsorption sites, have led to greater potential in catalyzing various challenging reactions. However, accurately controlling the number and arrangement of clusters on functional supports still faces great challenge. Herein, we develop a facile electrosynthesis method to uniformly disperse Wells-Dawson- and Keggin-type polyoxometalates on TiO2 nanotube arrays, resulting in a series of single-cluster functionalized catalysts P2M18O62@TiO2 and PM12O40@TiO2 (M=Mo or W). The single polyoxometalate cluster can be distinctly identified and serves as electronic sponge to accept electrons from excited TiO2 for enhancing surface-hole concentration and promote water oxidation. Among these samples, P2Mo18O62@TiO2-1 exhibits the highest electron consumption rate of 1260â µmol g-1 for CO2-to-CH3OH conversion with H2O as the electron source, which is 11â times higher than that of isolated TiO2 nanotube arrays. This work supplied a simple synthesis method to realize the single-dispersion of molecular cluster to enrich surface-reaching holes on TiO2, thereby facilitating water oxidation and CO2 reduction.
RESUMEN
The sensitizing ability of a catalytic system is closely related to the visible-light absorption ability, excited-state lifetime, redox potential, and electron-transfer rate of photosensitizers (PSs), however it remains a great challenge to concurrently mediate these factors to boost CO2 photoreduction. Herein, a series of Ir(III)-based PSs (Ir-1-Ir-6) were prepared as molecular platforms to understand the interplay of these factors and identify the primary factors for efficient CO2 photoreduction. Among them, less efficient visible-light absorption capacity results in lower CO yields of Ir-1, Ir-2 or Ir-4. Ir-3 shows the most efficient photocatalytic activity among these mononuclear PSs due to some comprehensive parameters. Although the Kobs of Ir-3 is ≈10â times higher than that of Ir-5, the CO yield of Ir-3 is slightly higher than that of Ir-5 due to the compensation of Ir-5's strong visible-light-absorbing ability. Ir-6 exhibits excellent photocatalytic performance due to the strong visible-light absorption ability, comparable thermodynamic driving force, and electron transfer rate among these PSs. Remarkably, the CO2 photoreduction to CO with Ir-6 can achieve 91.5â µmol, over 54â times higher than Ir-1, and the optimized TONC-1 can reach up to 28160. Various photophysical properties of the PSs were concurrently adjusted by fine ligand modification to promote CO2 photoreduction.
RESUMEN
Single-atom catalysts with precise structure and extremely high catalytic efficiency remain a fervent focus in the fields of materials chemistry and catalytic science. Herein, a nickel-substituted polyoxometalate (POM) {NiSb6O4(H2O)3[ß-Ni(hmta)SbW8O31]3}15- (NiPOM) with one extremely exposed nickel site [NiO3(H2O)3] was synthesized using the conventional aqueous method. The uniform dispersion of single nickel center with well-defined structure was facilely achieved by anchoring nanosized NiPOM on graphene oxide (GO). The resulting NiPOM/GO can couple with CdS photoabsorber for the construction of low-cost and ultra-efficient hydrogen evolution system. The H2 yield can reach to 2753.27 mmol gPOM-1 h-1, which represents a record value among all the POM-based photocatalytic systems. Remarkablely, an extremely high hydrogen yield of 3647.28 mmol gPOM-1 h-1 was achieved with simultaneous photooxidation of commercial waste plastic, representing the first POM-based photocatalytic system for H2 evolution and waste plastic conversion. This work highlights a straightforward strategy for constructing extremely exposed single-metal site with precise microenvironment by facilely manipulating nanosized molecular cluster to control individual atom.
RESUMEN
The construction of secondary building units (SBUs) in versatile metal-organic frameworks (MOFs) represents a promising method for developing multi-functional materials, especially for improving their sensitizing ability. Herein, we developed a dual small molecules auxiliary strategy to construct a high-nuclear transition-metal-based UiO-architecture Co16-MOF-BDC with visible-light-absorbing capacity. Remarkably, the N3 - molecule in hexadecameric cobalt azide SBU offers novel modification sites to precise bonding of strong visible-light-absorbing chromophores via click reaction. The resulting Bodipy@Co16-MOF-BDC exhibits extremely high performance for oxidative coupling benzylamine (~100 % yield) via both energy and electron transfer processes, which is much superior to that of Co16-MOF-BDC (31.5 %) and Carboxyl @Co16-MOF-BDC (37.5 %). Systematic investigations reveal that the advantages of Bodipy@Co16-MOF-BDC in dual light-absorbing channels, robust bonding between Bodipy/Co16 clusters and efficient electron-hole separation can greatly boost photosynthesis. This work provides an ideal molecular platform for synergy between photosensitizing MOFs and chromophores by constructing high-nuclear transition-metal-based SBUs with surface-modifiable small molecules.
RESUMEN
Host-guest chemistry of chiral metal-organic frameworks (MOFs) has endowed them with circularly polarized luminescence (CPL), it is still limited for MOFs to systematically tune full-color CPL emissions and sizes. This work directionally assembles the chiral ligands, metal sites and organic dyes to prepare a series of crystalline enantiomeric D/L-Cd/Zn-n MOFs (n = 1 ~ 5, representing the adding amount of dyes), where D/L-Cd/Zn with the formula of Cd2(D/L-Cam)2(TPyPE) and Zn2(D/L-Cam)2(TPyPE) (D/L-Cam = D/L-camphoric acid, TPyPE = 4,4',4'',4'''-(1,2-henediidenetetra-4,1-phenylene)tetrakis[pyridine]) were used as the chiral platforms. The framework-dye-enabled emission and through-space chirality transfer facilitate D/L-Cd/Zn-n bright full-color CPL activity. The ideal yellow CPL of D-Cd-5 and D-Zn-4, with |glum| as 4.9 × 10-3 and 1.3 × 10-3 and relatively high photoluminescence quantum yield of 40.79% and 45.40%, are further assembled into a white CPL light-emitting diode. The crystal sizes of D/L-Cd/Zn-n were found to be strongly correlated to the types and additional amounts of organic dyes, that the positive organic dyes allow for the preparation of > 7 mm bulks and negative dyes account for sub-20 µm particles. This work opens a new avenue to fabricate full-color emissive CPL composites and provides a potentially universal method for controlling the size of optical platforms.
RESUMEN
Metal-organic framework (MOF) materials have broad application prospects in catalysis because of their ordered structure and molecular adjustability. However, the large volume of bulky MOF usually leads to insufficient exposure of the active sites and the obstruction of charge/mass transfer, which greatly limits their catalytic performance. Herein, we developed a simple graphene oxide (GO) template method to fabricate ultrathin Co-metal-organic layer (2.0 nm) on reduced GO (Co-MOL@r-GO). The as-synthesized hybrid material Co-MOL@r-GO-2 exhibits highly efficient photocatalytic performance for CO2 reduction, and the CO yield can reach as high as 25,442 µmol/gCo-MOL, which is over 20 times higher than that of the bulky Co-MOF. Systematic investigations demonstrate that GO can act as a template for the synthesis of the ultrathin Co-MOL with more active sites and can be used as the electron transport medium between the photosensitizer and the Co-MOL to enhance the catalytic activity for CO2 photoreduction.
RESUMEN
Carbon dioxide cycloaddition into fine chemicals is prospective technology to solve energy crisis and environmental issues. However, high temperature and pressure are usually required in the conventional cycloaddition reactions of CO2 with epoxides. Moreover, metal active sites play a vital role in the CO2 cycloaddition, but it is still unclear. Herein, we select the isostructural MOF-919-Cu-Fe and MOF-919-Cu-Al as models to promote the performance and clarify the effects of metal type on the CO2 cycloaddition. The MOF-919-Cu-Fe with exposed Fe and Cu Lewis acid sites reaches the CO2 cycloaddition with over 99.9% conversion and over 99.9% selectivity at room temperature and a 1 bar CO2 atmosphere, 3.0- and 52.6-fold higher than those of the MOF-919-Cu-Al with Al and Cu sites (33.8%) and the 1H-pyrazole-4-carboxylic acid, Fe, and Cu mixed system (1.9%), respectively. The proposed mechanism demonstrated that the exposed Fe3+ sites facilitate the ring opening of epoxide and CO2 activation to boost the CO2 cycloaddition reaction. This work provides a new insight to tune the catalytic sites of MOFs to achieve high performance for CO2 fixation.
RESUMEN
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Asunto(s)
Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismoRESUMEN
We explored a co-dissolved strategy to embed mono-dispersed Pt center into V2 O5 support via dissolving [PtV9 O28 ]7- into [V10 O28 ]6- aqueous solution. The uniform dispersion of [PtV9 O28 ]7- in [V10 O28 ]6- solution allows [PtV9 O28 ]7- to be surrounded by [V10 O28 ]6- clusters via a freeze-drying process. The V centers in both [PtV9 O28 ]7- and [V10 O28 ]6- were converted into V2 O5 via a calcination process to stabilize Pt center. These double separations can effectively prevent the Pt center agglomeration during the high-temperature conversion process, and achieve 100 % utilization of Pt in [PtV9 O28 ]7- . The resulting Pt-V2 O5 single-atom-site catalysts exhibit a CH4 yield of 247.6â µmol g-1 h-1 , 25â times higher than that of Pt nanoparticle on the V2 O5 support, which was accompanied by the lactic acid photooxidation to form pyruvic acid. Systematical investigations on this unambiguous structure demonstrate an important role of Pt-O atomic pair synergy for highly efficient CO2 photoreduction.
RESUMEN
Spin manipulation of transition-metal catalysts has great potential in mimicking enzyme electronic structures to improve activity and/or selectivity. However, it remains a great challenge to manipulate room-temperature spin state of catalytic centers. Herein, we report a mechanical exfoliation strategy to in situ induce partial spin crossover from high-spin (s=5/2) to low-spin (s=1/2) of the ferric center. Due to spin transition of catalytic center, mixed-spin catalyst exhibits a high CO yield of 19.7â mmol g-1 with selectivity of 91.6 %, much superior to that of high-spin bulk counterpart (50 % selectivity). Density functional theory calculations reveal that low-spin 3d-orbital electronic configuration performs a key function in promoting CO2 adsorption and reducing activation barrier. Hence, the spin manipulation highlights a new insight into designing highly efficient biomimetic catalysts via optimizing spin state.
RESUMEN
Electrochemical conversion of propene is a promising technique for manufacturing commodity chemicals by using renewable electricity. To achieve this goal, we still need to develop high-performance electrocatalysts for propene electrooxidation, which highly relies on understanding the reaction mechanism at the molecular level. Although the propene oxidation mechanism has been well investigated at the solid/gas interface under thermocatalytic conditions, it still remains elusive at the solid/liquid interface under an electrochemical environment. Here, we report the mechanistic studies of propene electrooxidation on PdO/C and Pd/C catalysts, considering that the Pd-based catalyst is one of the most promising electrocatalytic systems. By electrochemical in situ attenuated total reflection Fourier transform infrared spectroscopy, a distinct reaction pathway was observed compared with conventional thermocatalysis, emphasizing that propene can be dehydrogenated at a potential higher than 0.80 V, and strongly adsorb via µ-CâCHCH3 and µ3-η2-CâCHCH3 configuration on PdO and Pd, respectively. The µ-CâCHCH3 is via bridge bonds on adjacent Pd and O atoms on PdO, and it can be further oxidized by directly taking surface oxygen from PdO, verified by the H218O isotope-edited experiment. A high surface oxygen content on PdO/C results in a 3 times higher turnover frequency than that on Pd/C for converting propene into propene glycol. This finding highlights the different reaction pathways under an electrochemical environment, which sheds light on designing next-generation electrocatalysts for propene electrooxidation.
RESUMEN
BACKGROUND: Lenvatinib is regarded as the first-line therapy for patients with unresectable hepatocellular carcinoma (HCC). This study assessed the efficacy and safety of lenvatinib with or without immune checkpoint inhibitors (ICIs) in patients with unresectable HCC. METHODS: In this multicentric retrospective study, patients with unresectable HCC who treated with lenvatinib with or without ICIs would be enrolled. Overall survival, progression-free survival, objective response rate, and disease control rate were calculated to assess the antitumor response. RESULTS: Between January 2019 and August 2020, 65 patients received lenvatinib plus ICIs while other 45 patients received lenvatinib. The baseline characteristics were comparable between the two groups. Lenvatinib plus ICIs provided significantly higher overall survival (hazard ratio = 0.47, 95% CI 0.26-0.85; p = 0.013) and progression-free survival (hazard ratio = 0.35, 95% CI 0.20-0.63; p < 0.001) than lenvatinib monotherapy. Moreover, patients with lenvatinib plus ICIs had significantly higher objective response rate (41.5% vs 20.0%, p = 0.023) and disease control rate (72.3% vs 46.7%, p = 0.009) per RECIST v1.1 than those with lenvatinib. No treatment-related deaths were observed. Grade 3 or greater adverse events occurring in 10% or more of patients in either treatment group were hypertension [13 (20.0%) of 65 patients treated with lenvatinib plus ICIs vs 8 (17.8%) of 45 patients treated with lenvatinib], and palmar-plantar erythrodysesthesia [seven (10.8%) vs two (4.4%)]. CONCLUSIONS: In this real-world study, lenvatinib combined with ICIs showed significantly promising efficacy and manageable safety than lenvatinib alone in patients with unresectable HCC.
Asunto(s)
Carcinoma Hepatocelular , Neoplasias Hepáticas , Carcinoma Hepatocelular/patología , Humanos , Inhibidores de Puntos de Control Inmunológico/uso terapéutico , Neoplasias Hepáticas/patología , Compuestos de Fenilurea/uso terapéutico , Quinolinas , Estudios RetrospectivosRESUMEN
Microglia activation and its mediated neuroinflammation play an important role in the pathological process of various central nervous system injuries and diseases. Previous studies have reported abnormal expression of lncRNAs participated in neuroinflammation. However, the expression pattern and involvements of MIAT in neuroinflammatory diseases are not fully investigated. We first screened abnormal expressed lncRNAs in BV2 cells treated with LPS. The expression of MIAT in LPS-induced BV2 cells was detected by qRT-PCR. MTT assay, cell migration, flow cytometry analysis, ELISA, qRT-PCR, and Western blotting analysis were applied to evaluating the effect of si-MIAT on LPS-induced H9C2 cells. The bioinformatics analysis and the rescue experiment were devoted to the underlying mechanism of lncRNA-miRNA-mRNA network. The results showed LncRNA MIAT expression was significantly increased in LPS-induced BV2 microglial cells. Besides, MIAT knockdown alleviated LPS-induced repression of cell viability and induction of apoptosis and inflammatory response in BV2 cells. Furthermore, LncRNA MIAT regulated NFAT5 expression via sponging miR-613 in LPS-induced BV2 cells. Altogether, these results suggest that lncRNA MIAT functioned as a ceRNA for miR-613 to modulate NFAT5 expression in LPS-induced BV2 cells, which may contribute to a better understanding of the mechanism of neuroinflammatory diseases.
Asunto(s)
MicroARNs , ARN Largo no Codificante , Apoptosis/genética , Lipopolisacáridos , MicroARNs/genética , MicroARNs/metabolismo , Microglía/metabolismo , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismoRESUMEN
It is a great challenging task for selectivity control of both CO2 photoreduction and water splitting to produce syngas via precise microenvironment regulation. Herein, a series of UiO-type Eu-MOFs (Eu-bpdc, Eu-bpydc, Rux-Eu-bpdc, and Rux-Eu-bpydc) with different surrounding confined spaces were designed and synthesized. These photosensitizing Rux-Eu-MOFs were used as the molecular platform to encapsulate the [CoII4(dpy{OH}O)4(OAc)2(H2O)2]2+ (Co4) cubane cluster for constructing Co4@Rux-Eu-MOF (x = 0.1, 0.2, and 0.4) heterogeneous photocatalysts for efficient CO2 photoreduction and water splitting. The H2 and CO yields can reach 446.6 and 459.8 µmol·g-1, respectively, in 10 h with Co4@Ru0.1-Eu-bpdc as the catalyst, and their total yield can be dramatically improved to 2500 µmol·g-1 with the ratio of CO/H2 ranging from 1:1 to 1:2 via changing the photosensitizer content in the confined space. By increasing the N content around the cubane, the photocatalytic performance drops sharply in Co4@Ru0.1-Eu-bpydc, but with an enhanced proportion of CO in the final products. In the homogeneous system, the Co4 cubane was surrounding with Ru photosensitizers via week interactions, which can drive water splitting into H2 with >99% selectivity. Comprehensive structure-function analysis highlights the important role of microenvironment regulation in the selectivity control via constructing homogeneous and heterogeneous photocatalytic systems. This work provides a new insight for engineering a catalytic microenvironment of the cubane cluster for selectivity control of CO2 photoreduction and water splitting.
Asunto(s)
Dióxido de Carbono , Fotosíntesis , Catálisis , Fármacos Fotosensibilizantes , AguaRESUMEN
Photosensitization associated with electron/energy transfer represents the central science of natural photosynthesis. Herein, we proposed a protocol to dramatically improve the sensitizing ability of metal-organic frameworks (MOFs) by switching their excited state distribution from 3 MLCT (metal-to-ligand charge transfer) to 3 IL (intraligand). The hierarchical organization of 3 IL MOFs and Co/Cu catalysts facilitates electron transfer for efficient photocatalytic H2 evolution with a yield of 26 844.6â µmol g-1 and CO2 photoreduction with a record HCOOH yield of 4807.6â µmol g-1 among all the MOF photocatalysts. Systematic investigations demonstrate that strong visible-light-absorption, long-lived excited state and ingenious multi-component synergy in the 3 IL MOFs can facilitate both interface and intra-framework electron transfer to boost photocatalysis. This work opens up an avenue to boost solar-energy conversion by engineering sensitizing centers at a molecular level.
RESUMEN
Solar-driven carbonylation with CO2 replacing toxic CO as a C1 source is of considerable interest; however it remains a great challenge due to the inert CO2 molecule. Herein, we integrate cobalt single-site and ultrafine CuPd nanocluster catalysts into a porphyrin-based metal-organic framework to construct composite photocatalysts (Cu1Pd2)z@PCN-222(Co) (z = 1.3, 2.0, and 3.0 nm). Upon visible light irradiation, excited porphyrin can concurrently transfer electrons to Co single sites and CuPd nanoclusters, providing the possibility for coupling CO2 photoreduction and Suzuki/Sonogashira reactions. This multicomponent synergy in (Cu1Pd2)1.3@PCN-222(Co) can not only replace dangerous CO gas but also dramatically promote the photosynthesis of benzophenone in CO2 with over 90% yield and 97% selectivity under mild condition. Systematic investigations clearly decipher the function and collaboration among different components in these composite catalysts, highlighting a new insight into developing a sustainable protocol for carbonylation reactions by employing greenhouse gas CO2 as a C1 source.
RESUMEN
It is highly desirable to achieve solar-driven conversion of CO2 to valuable fuels with controlled selectivity. The existing catalysts are mainly explored for CO production but rarely for formate generation. Herein, highly selective photoreduction of CO2 to formate (99.7%) was achieved with a high yield of 3040 µmol g-1 in 10 h by hierarchical integration of photosensitizers and monometallic [bpy-Cu/ClX] (X = Cl or adenine) catalysts into a stable Eu-bpy metal-organic framework. However, replacing X with pyridine in [bpy-CuCl/X] significantly reduced formate production while increasing the CO yield to 960 µmol g-1. Systematic investigations revealed that the catalytic process is mediated by the H-bond synergy between Cu-bound X and CO2-derived species, and the selectivity of HCOO- can be controlled by simply replacing the coordination ligands. This work provides a molecularly precise structural model to provide mechanistic insights for selectivity control of CO2 photoreduction.