Analysis of the chloroplast genome and phylogenetic evolution of Bidens pilosa.

Chloroplast genomes for 3 Bidens plants endemic to China (Bidens bipinnata Linn., Bidens pilosa Linn., and Bidens alba var. radiata) have been sequenced, assembled and annotated in this study to distinguish their molecular characterization and phylogenetic relationships. The chloroplast genomes are in typical quadripartite structure with two inverted repeat regions separating a large single copy region and a small single copy region, and ranged from 151,599 to 154,478 bp in length. Similar number of SSRs and long repeats were found in Bidens, wherein mononucleotide repeats (A/T), forward and palindromic repeats were the most in abundance. Gene loss of clpP and psbD, IR expansion and contraction were detected in these Bidens plants. It seems that ndhE, ndhF, ndhG, and rpl32 from the Bidens plants were under positive selection while the majority of chloroplast genes were under purifying selection. Phylogenetic analysis revealed that 3 Bidens plants clustered together and further formed molophyletic clade with other Bidens species, indicating Bidens plants might be under radiation adaptive selection to the changing environment world-widely. Moreover, mutation hotspot analysis and in silico PCR analysis indicated that inter-genic regions of ndhD-ccsA, ndhI-ndhG, ndhF-rpl32, trnL_UAG-rpl32, ndhE-psaC, matK-rps16, rps2-atpI, cemA-petA, petN-psbM were candidate markers of molecular identification for Bidens plants. This study may provide useful information for genetic diversity analysis and molecular identification for Bidens species.

(E)-7-phenyl-2-heptene-4,6-diyn-1-ol from Bidens pilosa as a repellent against isopods.

The development of repellents as alternatives to insecticides has expanded in recent years. However, their use in isopod pest control is limited. To develop an isopod repellent, a plant extract library from wild plants native to the Kochi Prefecture was screened for repellent activity against pillbugs, and 82 samples (87%) exhibited repellent activity. Among them, (E)-7-phenyl-2-heptene-4,6-diyn-1-ol was isolated and identified as a repellent from the root of Bidens pilosa. It had a half-maximal effective concentration of 0.20 µm, with a strong repellency. A study of the structure-activity relationship to (E)-7-phenyl-2-heptene-4,6-diyn-1-ol revealed that the presence of a hydroxyl group and an aromatic at both ends of the length of the seven-carbon chain is important for the expression of repellency. These results can potentially lead to a new repellent of phenylalkyl alcohol.

Comparative study on plant growth-promoting bacterial inoculation by irrigation and spraying for promoting Bidens pilosa L. phytoremediation of cadmium-contaminated soil.

A field study was conducted to compare FM-1 inoculation by irrigation and spraying for promoting Bidens pilosa L. phytoremediation of cadmium (Cd)-contaminated soil. Cascading relationships between bacterial inoculation by irrigation and spraying and soil properties, plant growth-promoting traits, plant biomass and Cd concentrations in Bidens pilosa L. were explored based on the partial least squares path model (PLS-PM). The results indicated that inoculation with FM-1 not only improved the rhizosphere soil environment of B. pilosa L. but also increased the Cd extracted from the soil. Moreover, Fe and P in leaves play vital roles in promoting plant growth when FM-1 is inoculated by irrigation, while Fe in leaves and stems plays a vital role in promoting plant growth when FM-1 is inoculated by spraying. In addition, FM-1 inoculation decreased the soil pH by affecting soil dehydrogenase and oxalic acid in cases with irrigation and Fe in roots in cases with spraying. Thus, the soil bioavailable Cd content increased and promoted Cd uptake by Bidens pilosa L. To address Cd-induced oxidative stress, Fe in leaves helped to convert GSH into PCs, which played a vital role in ROS scavenging when FM-1 was inoculated by irrigation. The soil urease content effectively increased the POD and APX activities in the leaves of Bidens pilosa L., which helped alleviate Cd-induced oxidative stress when FM-1 was inoculated by spraying. This study compares and illustrates the potential mechanism by which FM-1 inoculation can improve the phytoremediation of Cd-contaminated soil by Bidens pilosa L., suggesting that FM-1 inoculation by irrigation and spraying is useful in the phytoremediation of Cd-contaminated sites.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Anti-Inflammatory Effects of Miyako Bidens pilosa in a Mouse Model of Amyotrophic Lateral Sclerosis and Lipopolysaccharide-Stimulated BV-2 Microglia.

Neuroinflammation is a fundamental feature in the pathogenesis of amyotrophic lateral sclerosis (ALS) and arises from the activation of astrocytes and microglial cells. Previously, we reported that Miyako Bidens pilosa extract (MBP) inhibited microglial activation and prolonged the life span in a human ALS-linked mutant superoxide dismutase-1 (SOD1G93A) transgenic mouse model of ALS (G93A mice). Herein, we evaluated the effect of MBP on microglial activation in the spinal cord of G93A mice and lipopolysaccharide-stimulated BV-2 microglial cells. The administration of MBP inhibited the upregulation of the M1-microglia/macrophage marker (interferon-γ receptor (IFN-γR)) and pro-inflammatory cytokines (tumor necrosis factor (TNF)-α, interleukin (IL)-1ß, and IL-6) in G93A mice. However, MBP did not affect the increase in the M2-microglia/macrophage marker (IL-13R) and anti-inflammatory cytokines (transforming growth factor (TGF)-ß and IL-10) in G93A mice. BV-2 cell exposure to MBP resulted in a decrease in 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) reduction activity and bromodeoxyuridine incorporation, without an increase in the number of ethidium homodimer-1-stained dead cells. Moreover, MBP suppressed the production of lipopolysaccharide-induced pro-inflammatory cytokines (TNF-α, IL-1ß, and IL-6) in BV-2 cells. These results suggest that the selective suppression of M1-related pro-inflammatory cytokines is involved in the therapeutic potential of MBP in ALS model mice.

A Bidens pilosa L. Non-Polar Extract Modulates the Polarization of Human Macrophages and Dendritic Cells into an Anti-Inflammatory Phenotype.

Different communities around the world traditionally use Bidens pilosa L. for medicinal purposes, mainly for its anti-inflammatory, antinociceptive, and antioxidant properties; it is used as an ingredient in teas or herbal medicines for the treatment of pain, inflammation, and immunological disorders. Several studies have been conducted that prove the immunomodulatory properties of this plant; however, it is not known whether the immunomodulatory properties of B. pilosa are mediated by its ability to modulate antigen-presenting cells (APCs) such as macrophages (MØs) and dendritic cells (DCs) (through polarization or the maturation state, respectively). Different polar and non-polar extracts and fractions were prepared from the aerial part of B. pilosa. Their cytotoxic and immunomodulatory effects were first tested on human peripheral blood mononuclear cells (PBMCs) and phytohemagglutinin (PHA)-stimulated PBMCs, respectively, via an MTT assay. Then, the non-cytotoxic plant extracts and fractions that showed the highest immunomodulatory activity were selected to evaluate their effects on human MØ polarization and DC maturation (cell surface phenotype and cytokine secretion) through multiparametric flow cytometry. Finally, the chemical compounds of the B. pilosa extract that showed the most significant immunomodulatory effects on human APCs were identified using gas chromatography coupled with mass spectrometry. The petroleum ether extract and the ethyl acetate and hydroalcoholic fractions obtained from B. pilosa showed low cytotoxicity and modulated the PHA-stimulated proliferation of PBMCs. Furthermore, the B. pilosa petroleum ether extract induced M2 polarization or a hybrid M1/M2 phenotype in MØs and a semi-mature status in DCs, regardless of exposure to a maturation stimulus. The immunomodulatory activity of the non-polar (petroleum ether) extract of B. pilosa on human PBMC proliferation, M2 polarization of MØs, and semi-mature status in DCs might be attributed to the low-medium polarity components in the extract, such as phytosterol terpenes and fatty acid esters.

Acid deposition at higher acidity weakens the antagonistic responses during the co-decomposition of two Asteraceae invasive plants.

Co-invasion by two invasive plant species (IPS) can occur in the same habitat. Diversified acid deposition may change the co-invasion process by altering litter decomposition and plant-soil feedback signalling. This study examined the co-decomposition of two Asteraceae IPS (Solidago canadensis L. and Bidens pilosa L.) on litter decomposition rate, soil enzyme activities, and soil N-fixing bacterial communities under diversified acid deposition (mixed acid deposition at pH 5.6 and at pH 4.5, sulfuric acid at pH 4.5, and nitric acid at pH 4.5). B. pilosa litter degraded faster than S. canadensis litter. Acid deposition at higher acidity accelerated the decomposition rate of both pure S. canadensis litter and the equally mixed litters from the two Asteraceae IPS. Antagonistic responses may occur during the co-decomposition of the two Asteraceae IPS with mixed acid deposition, regardless of the pH, as well as with nitric acid deposition at pH 4.5; in contrast, there may be neutral responses for the co-decomposition process with sulfuric acid at pH 4.5. The type of acid deposited may be one of the key factors affecting the intensity of the mixing effect affecting the co-decomposition. Acid deposition at higher acidity weakened the antagonistic responses for the co-decomposition of the two Asteraceae IPS compared with the response to weak acids. Together, these results indicate that acid deposition at higher acidity could facilitate the co-invasion of the two Asteraceae IPS mainly through accelerated litter decomposition as well as weakened antagonistic responses for co-decomposition.

Bruceine D may affect the phenylpropanoid biosynthesis by acting on ADTs thus inhibiting Bidens pilosa L. seed germination.

Bruceine D is a natural quassinoid, which was successfully isolated in our research group from the residue of Brucea javanica (L.) seeds. Our previous research showed that Bruceine D prevented Bidens pilosa L. seed germination by suppressing the activity of key enzymes and the expression levels of key genes involved in the phenylpropanoid biosynthesis pathway. In this study, integrated analyses of non-targeted metabolomic and transcriptomic were performed. A total of 356 different accumulated metabolites (DAMs) were identified, and KEGG pathway analyses revealed that most of these DAMs were involved in phenylpropanoid biosynthesis. The decreased expression of ADTs and content of L-phenylalanine implicates that Bruceine D may suppress the downstream phenylpropanoid biosynthesis pathway by disrupting primary metabolism, that is, the phenylalanine biosynthesis pathway, thus inhibiting the final products, resulting in the interruption of B. pilosa seed germination. These results suggest that Bruceine D may inhibit the B. pilosa seed germination by suppressing phenylpropanoid biosynthesis through acting on ADTs.

Acarofauna present in organic strawberry fields and associated weed species in southern Brazil.

The presence of weeds in the margins of strawberry crops can enhance populations of predatory mites as a measure to support conservation biological control. The aims of this study were (i) to assess the composition of the acarofauna associated with strawberries and the accompanying herbaceous plants in an organic farming system, and (ii) to evaluate the possible relationships between phytophagous and predatory mites occurring in this system. Strawberry leaves and whole plants of weeds were sampled biweekly from August 2014 to February 2015 in Lapa (Paraná, Brazil). In total, 23 weed species belonging to 10 families were identified; 3768 mite individuals (from 15 families and 4 suborders) were recovered, 77% on strawberries and 23% on weeds. Abundance of predatory mites on weeds was greater than on strawberry cultivars. On strawberries, the most abundant family was Tetranychidae (84%) followed by Phytoseiidae (11.6%). In total, 16 predatory mite species from the Phytoseiidae family were identified, 13 of them occurring on strawberry leaflets. Typholodromalus aripo, Neoseiulus californicus and Typhlodromips mangleae were the most abundant mite species on strawberry leaves. On weeds, most individuals were predatory mites (59%), whereas phytophagous mites represented 17.2%. The most abundant family was Phytoseiidae (36.4%). On weeds, the phytoseiid mite T. aripo was the most abundant species, representing 34.7%. Besides being found on strawberry leaflets, T. aripo was associated with 15 weed species. Among the weeds, Bidens pilosa showed the highest values of the Shannon index (1.97), Margalef index (3.04), and Pielou's evenness index (0.95). This study emphasizes the importance of surrounding weeds as a shelter for beneficial mitefauna in strawberry fields, likely contributing to enhance conservation biological control.

Elucidation of enzymes involved in the biosynthetic pathway of bioactive polyacetylenes in Bidens pilosa using integrated omics approaches.

Polyacetylene compounds from Bidens pilosa are known to have several pharmacological activities. In this study, we identified major genes encoding enzymes involved in the biosynthesis of polyacetylene in B. pilosa. Seven polyacetylene metabolites present in B. pilosa leaves were induced by methyl jasmonate (MeJA) treatment and physical wounding. Transcriptome analysis via high-throughput sequencing revealed 39 202 annotated gene fragment sequences. A DNA microarray established by the 39 202 annotated genes was used to profile gene expression in B. pilosa leaf and root tissues. As no polyacetylene compounds were found in roots, the gene expression pattern in root tissue was used as a negative control. By subtracting MeJA-induced genes in roots, we obtained 1216 genes in leaves showing an approximate three-fold increase in expression post-MeJA treatment. Nine genes encoding enzymes with desaturation function were selected for confirmation of expression by qRT-PCR. Among them, two genes, BPTC030748 and BPTC012564, were predicted to encode Δ12-oleate desaturase (OD) and Δ12-fatty acid acetylenase (FAA), respectively. In B. pilosa leaves, RNAi knock-down concomitantly decreased, while virus-mediated transient overexpression of either gene elevated polyacetylene content. In summary, we demonstrate that two important enzymes, Δ12-oleate desaturase and Δ12-fatty acid acetylenase, involved in desaturation of linear fatty acid precursors play a role in polyacetylene biosynthesis in an important medicinal plant, Bidens pilosa.

Effects of probiotic and Bidens pilosa on the performance and gut health of chicken during induced Eimeria tenella infection.

AIM: In this study, we have examined the individual and combined protective mechanism of probiotic and Bidens pilosa on the performance and gut health of chickens during Eimeria tenella infection over a 29-day experimental trial. METHODS AND RESULTS: A total of one hundred and fifty 1-day-old chickens were equally distributed into five treatment groups with three biological replicates: two groups were allocated as control groups (control group untreated unchallenged, CG and control positive untreated challenged, CPG) and three groups were fed diets with probiotic (PG), B. pilosa (BPG) and probiotic + B. pilosa (PG + BPG) and challenged with E. tenella. Birds of all groups were assessed for pre and post-infection body weights, oocysts shedding, caecal lesion scores and mRNA expression levels of apoptosis related proteins (Bcl-2, Bax and caspase-3), antioxidant enzymes (CAT and SOD 1), pro-inflammatory cytokines (IL-6 and IL-8) and tight junction proteins (CLDN 1 and ZO 1). Our results revealed that during infection (day 21-29), E. tenella challenged chickens significantly decreased the body weight compared with uninfected control chickens; however, there was no significant effect on body weight of chickens fed with probiotic, B. pilosa and probiotic + B. pilosa was observed. Eimeria tenella challenged untreated birds increased (P < 0·05) oocysts shedding, destructive ratio of caeca and mortality as compared to treated challenged birds. CPG group up-regulated the mRNA expression levels of anti-apoptosis protein Bcl-2 while down-regulated the pro-apoptosis protein Bax relative to PG, BPG and PG + BPG groups. Moreover chickens fed probiotic, B. pilosa and probiotic + B. pilosa diets enhanced the activities of antioxidant enzymes, pro-inflammatory cytokines and tight junction proteins with the comparison of control positive untreated challenged chickens. CONCLUSION: These findings elaborated that feed supplementation of probiotic and B. pilosa (individually or in combination) appeared to be effective in inhibiting the occurrence of disease and decreasing the severity of Eimeria infection in chickens. SIGNIFICANCE AND IMPACT OF THE STUDY: This study explained the underlying anti-coccidial mechanism in which probiotic and B. pilosa (individually and/or in combination) improve the performance of chicken and protect against gut inflammatory responses caused by E. tenella.

Separation of chemical constituents in Bidens pilosa Linn. var. radiata Sch. Bip. by elution-extrusion counter-current chromatography using two new three-phase solvent systems.

Two new three-phase solvent systems combined with elution-extrusion counter-current chromatography mode were used to study the chemical constituents in Bidens pilosa Linn. var. radiata Sch. Bip. The first novel solvent system consisted of n-hexane, acetonitrile, chloroform, and water in a ratio of 5:5:1:5, which was selected for elution-extrusion counter-current chromatography to separate the n-hexane extraction part. A total of six constituents were obtained from this part in the up phase as the stationary phase and the middle phase as the mobile phase. The second novel solvent system, composed of n-hexane-butyl acetate-acetonitrile-water (3:1:4:3, v/v/v/v), was used for separating ethyl acetate extract of Bidens pilosa Linn. var. radiata Sch. Bip. Eight compounds were successfully isolated using elution-extrusion counter-current chromatography elution-extrusion mode. Fourteen chemical constituents were identified as 2-ß-D-glucopyranosytoxy-1-hydroxy-5(E)-tridecene-7,9,11-triyne (Y1), 3-ß-D-glucopyranosyloxy -1-hydroxy-6(E)-tetradecene-8,10,12-triyne (Y2), 1, 2-dihydroxy-5(E)-tridecene-7,9, 11-triyne (Y3), isorhamnetin (Y4), kaempferol (Y5), icthyothereolacetate (Y6), quercetin-3-O-ß-D- galactopyranosyl-7-O-ß-D-glucopyranoside (W1), quercetin 3-O-ß-L-rhamnopyranoside (W2), neosperidin dihydrochalcone (W3), quercetin (W4), quercetagetin-3,6,4' -trimethoxyl- 7-O-ß-D-glucopyranoside (W5), taxifolin (W6), luteolin (W7), and apigenin (W8) by spectra of 1 H-NMR and 13 C-NMR data. Among them, compounds Y1, Y2, Y3, and Y6 belong to polyacetylene compounds, and the rest were flavonoids. In addition, counter-current chromatography has been used to separate polyacetylene compounds for the first time. All compounds in this method were isolated from Bidens pilosa Linn. var. radiata Sch. Bip. for the first time.

Effect of crop straw biochars on the remediation of Cd-contaminated farmland soil by hyperaccumulator Bidens pilosa L.

Cadmium (Cd) due to its strong toxicity and high mobility, which poses a considerable threat to soil environment and human health, has aroused widespread concern. Biochar has been used for remediating Cd-contaminated soil recently, however this method has the risk of fixed-Cd re-release. Phytoremediation can make up for its shortcoming. In this study, a pot experiment was carried out, where Bidens pilosa L. (B.pilosa) was as the tested plant and biochars (maize straw biochar and wheat straw biochar with two particle sizes) were as amendments. The mechanism of how biochars promoted B.pilosa Cd accumulation in Cd-contaminated farmland soil was explored. Results showed that the application of 5% wheat straw fine biochar (WF), wheat straw coarse biochar (WC), maize straw fine biochar (MF) and maize straw coarse biochar (MC) increased the total Cd accumulation of B.pilosa to 251.57%, 217.41%, 321.64% and 349.66%, respectively. Biochars amendment significantly promoted B.pilosa growth and increased Cd accumulation by improving soil physical properties, nutrient levels (available nitrogen, available phosphorus (AP), available potassium (AK) and organic matter (OM)) and microbial activity, and changing the nutrients distribution in B.pilosa organs although tissues although DTPA-Cd reduced to some extent. The effect of MF on AP increase was better than MC, while the effect of WF on AK increase was better than WC. Fine-particle was superior to coarse-particle in increasing B.pilosa biomass of aboveground, OM and microbial activity in soil. The changes of N, P and K concentrations in B.pilsosa roots, stems and leaves were closely related to the changes of AN, AP and AK in soil after biochars application. The results indicated that the combination of straw biochars and hyperaccumulators had the synergistic effect. This study can provide data support and meaningful reference values for remediating actual Cd-contaminated soil.

The cadmium accumulation differences of two Bidens pilosa L. ecotypes from clean farmlands and the changes of some physiology and biochemistry indices.

Bidens pilosa L. is a widely distributed Cd-hyperaccumulator species in the world with large biomass and fast growth rate. The Cd accumulating differences between different ecotypes of B. pilosa is not clear. This experiment firstly compared the Cd concentrations and relative physio-biochemical indices using two B. pilosa ecotypes collected from clean soils. The results showed that the Cd concentrations of stems and leaves of Hanzhong ecotype of B. pilosa (HZ) and Shenyang ecotype (SY) were all higher than their root Cd concentrations in different Cd concentration gradient experiment (from 2.57 mg kg-1 to 37.17 mg kg-1 in soils). Cd concentrations of the roots, stems and leaves of HZ and SY were all higher than in the soils either. However, HZ accumulated higher Cd concentrations than SY, i.e. roots increased by 32.7-45.8%, stems increased by 32.3-46.6% and leaves increased by 33.4-68.4%, respectively. Furthermore, the biomasses of HZ were all higher than the SY either. Compared to SY, higher Cd accumulation of HZ might be relevant with its higher photosynthetic pigment content, stomatal conductance, intercellular CO2 concentration, some antioxidant enzyme activities, H+-ATPase, Ca2+-ATPase and 5'-AMPase activities, and lower malondialdehyde (MDA) content. Particularly, the changes of extractable Cd concentrations in rhizospheric soils of HZ and SY were corresponding to their Cd concentrations. Considering the two different ecotypes of HZ and SY were all collected from different clean farmlands, the new foundings that different mechanisms of HZ and SY accumulating Cd from the soil might be very important for screening and constructing ideal hyperaccumulator aimed at improving phytoremediation capacities in the future.

Protective effects of Bidens pilosa on hepatoxicity and nephrotoxicity induced by carbon tetrachloride in rats.

The aim of this study was to assess the protective effects of oral and topical treatment with Bidens pilosa (BP) against carbon tetrachloride (CCl4)- induced toxicity. Fifty-six rats were divided into seven groups: A: CCl4 only; B: CCl4+oral BP; C: CCl4 and topical BP; D: CCl4+oral and topical BP; E: oral BP only; F: negative control; and G: positive control (cyclophosphamide). The animals were treated for 10 weeks. Blood samples were collected for tests of hepatic and renal function, and fragments of the liver, spleen, pancreas, kidney, and intestine were collected for histopathological analyses. Cells from the femoral bone marrow were used for a micronucleus test and 'comet assay'. Statistically significant differences were observed in the levels of gamma-glutamyl transpeptidase (GGT), albumin, urea and creatinine, hepatic inflammation, renal tubular lesion, and inflammation of the intestinal mucosa between the BP-treated groups and untreated group. The median number of micronuclei in group A was 4.00, in group G was 9.00 and in the other groups was 0.00. Group A had the lowest number of cells with a score of 0 and the greatest number with scores of 3 and 4, similar to the results obtained from group G using the 'comet assay'. Thus, BP effectively protected against the toxic effects of CCl4 on the liver, kidney, and intestine and exerted an antimutagenic effect on rats exposed to CCl4.

Enhanced biomass and cadmium accumulation by three cadmium-tolerant plant species following cold plasma seed treatment.

Cold plasma seed treatment can promote plant growth and enhance the resistance of agricultural crops to adverse stress. However, the effects of plasma seed treatment on the growth and phytoextraction response of plants to cadmium (Cd) remain poorly documented. Here, we have investigated the feasibility of using plasma seed treatment to enhance the biomass and Cd accumulation of three Cd-tolerant species, namely Bidens pilosa L, Solanum nigrum L. and Trifolium repens L, under different plasma treatment conditions. Possible enhancement mechanisms are also proposed according to the levels of organic acids in the roots and the Cd fractions in rhizosphere soil following different plasma treatment conditions. The optimum plasma power was 100 W (B. pilosa) or 500 W (S. nigrum and T. repens). The optimum plasma exposure time for all three species was 60 s. Plasma seed treatment under the optimum treatment conditions enhanced plant dry biomass by ~17.3-45.0% and Cd accumulation by 8.8-54.4% across all three species compared to the controls. Furthermore, the phytoremediation efficiencies, bioaccumulation factors and transfer factors of the three species also increased significantly after seed plasma treatment. The promotion of plasma treatment on the biomass and Cd accumulation of three species might be due to increased exudation of organic acids from the roots into the rhizosphere soil, thus increasing the concentrations of acid-soluble Cd to form Cd-organic acid complexes that facilitated the uptake and translocation of Cd by the plants. Results of this study revealed that cold plasma seed treatment is an environmentally friendly, economical and efficient means to develop the application of phytoremediation for Cd-contaminated soils.

Feature-Based Molecular Networks Identification of Bioactive Metabolites from Three Plants of the Polynesian Cosmetopoeia Targeting the Dermal Papilla Cells of the Hair Cycle.

The term cosmetopoeia refers to the use of plants in folks' cosmetics. The aerial parts of Bidens pilosa L., the leaves of Calophyllum inophyllum L. and the fruits of Fagraea berteroana A.Gray ex Benth are traditionally used in French Polynesia for hair and skin care. During the hair cycle, dermal papilla cells and their interaction with epithelial cells are essential to promote hair follicle elongation. The aim of our investigations was the identification of metabolites from these three plants and chemical families responsible for their hair growth activity. A bioactivity-based molecular network was produced by mapping the correlation between features obtained from LC-MS/MS data and dermal papilla cell proliferation, using the Pearson correlation coefficient. The analyses pointed out glycosylated flavonols and phenolic acids from B. pilosa and C. inophyllum, along with C-flavonoids, iridoids and secoiridoids from F. berteroana, as potential bioactive molecules involved in the proliferation of hair follicle dermal papilla cells. Our results highlight the metabolites of the plant species potentially involved in the induction of hair follicle growth and support the traditional uses of these plants in hair care.

Anti-Inflammatory Activity and Mechanism of Isookanin, Isolated by Bioassay-Guided Fractionation from Bidens pilosa L.

Bidens pilosa L. (Asteraceae) has been used historically in traditional Asian medicine and is known to have a variety of biological effects. However, the specific active compounds responsible for the individual pharmacological effects of Bidens pilosa L. (B. pilosa) extract have not yet been made clear. This study aimed to investigate the anti-inflammatory phytochemicals obtained from B. pilosa. We isolated a flavonoids-type phytochemical, isookanin, from B. pilosa through bioassay-guided fractionation based on its capacity to inhibit inflammation. Some of isookanin's biological properties have been reported; however, the anti-inflammatory mechanism of isookanin has not yet been studied. In the present study, we evaluated the anti-inflammatory activities of isookanin using lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. We have shown that isookanin reduces the production of proinflammatory mediators (nitric oxide, prostaglandin E2) by inhibiting the expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) in LPS-stimulated macrophages. Isookanin also inhibited the expression of activator protein 1 (AP-1) and downregulated the LPS-induced phosphorylation of p38 mitogen-activated protein kinase (MAPK) and c-jun NH2-terminal kinase (JNK) in the MAPK signaling pathway. Additionally, isookanin inhibited proinflammatory cytokines (tumor necrosis factor-a (TNF-α), interleukin-6 (IL-6), interleukin-8 (IL-8), and interleukin-1ß (IL-1ß)) in LPS-induced THP-1 cells. These results demonstrate that isookanin could be a potential therapeutic candidate for inflammatory disease.

Chemical Characterization and Phytotoxic Effects of the Aerial Parts of Ruzigrass (Urochloa ruziziensis).

Studies of the phytotoxic effects between plants can be a crucial tool in the discovery of innovative compounds with herbicide potential. In this sense, we can highlight ruzigrass (Urochloa ruziziensis), which is traditionally used in the crop rotation system in order to reduce weed emergence. The aim of this work was to characterize the secondary metabolites of ruzigrass and to evaluate its phytotoxic effects. In total, eight compounds were isolated: friedelin, oleanolic acid, α-amyrin, 1-dehydrodiosgenone, sitosterol and stigmasterol glycosides, tricin and p-coumaric acid. Phytotoxic effects of the crude methanolic extract and fractions of ruzigrass were assessed using germination rate, initial seedling growth, and biomass of Bidens pilosa, Euphorbia heterophylla and Ipomoea grandifolia. Chemometric analysis discriminated the weed species into three groups, and B. pilosa was the most affected by fractions of ruzigrass. The phytotoxic activities of 1-dehydrodiosgenone, tricin, and p-coumaric acid are also reported, and p-coumaric acid and 1-dehydrodiosgenone were active against B. pilosa.

Different Sequevars of Ralstonia pseudosolanacearum Causing Bacterial Wilt of Bidens pilosa in China.

Bidens pilosa is an invasive weed that threatens the growth of crops and biodiversity in China. In 2017, suspected bacterial wilt of B. pilosa was discovered in Qinzhou and Beihai, Guangxi, China. A variety of weeds are considered as reservoirs harboring bacterial wilt pathogens, but most do not show obvious symptoms in the field. Identifying the classification status of the B. pilosa bacterial wilt pathogen and exploring its geographical origin might be helpful for clarifying the role of weeds in the circulation of the disease. Phylotyping, sequevar analysis, and cross inoculation of pathogens isolated from B. pilosa and nearby peanut (Arachis hypogaea), balsam gourd (Momordica charantia), and eucalyptus (Eucalyptus robusta) plants were carried out. Three isolates of B. pilosa (Bp01, Bp02, and Bp03) were identified as Ralstonia pseudosolanacearum, race 1, biovar 3, and phylotype I, and belonged to sequevars 17 and 44, and an unknown sequevar. The sequevars isolated from B. pilosa were not completely consistent with those of the nearby hosts, and the virulence of these isolates differed when cross inoculated. The Bp03 sequevar was different from peanut isolate sequevars in the same field and was not identical to any previously designated sequevars. The isolates from B. pilosa and other nearby hosts displayed low or no virulence toward their cross hosts (with wilt incidences less than 33.33%). An exception to this was the isolates from B. pilosa, which displayed high virulence toward eucalyptus (with a wilt incidence of 70.00 to 100.00%). This is the first report of different sequevars of R. pseudosolanacearum causing typical bacterial wilt symptoms in B. pilosa in the field.