First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Integration of Two-Dimensional Liquid Chromatography-Mass Spectrometry and Molecular Docking to Characterize and Predict Polar Active Compounds in Curcuma kwangsiensis.

Curcuma kwangsiensis, one species of Curcumae zedoaria Ros. c, is a commonly used traditional Chinese medicine (TCM) for treating cardiovascular disease, cancer, asthma and inflammation. Polar compounds are abundant in water decoction, which would be responsible for critical pharmacological effects. However, current research on polar compounds in Curcumae zedoaria Ros. c remains scarce. In this study, the polar fraction from Curcuma kwangsiensis was firstly profiled on G protein-coupled receptor 109A (GPR109A), ß2-adrenergic receptor (ß2-AR), neurotensin receptor (NTSR), muscarinic-3 acetylcholine receptor (M3) and G protein-coupled receptor 35 (GPR35), which were involved in its clinical indications and exhibited excellent ß2-AR and GPR109A receptor activities. Then, an offline two-dimensional reversed-phase liquid chromatography (RPLC) coupled with the hydrophilic interaction chromatography (HILIC) method was developed to separate polar compounds. By the combination of a polar-copolymerized XAqua C18 column and an amide-bonded XAmide column, an orthogonality of 47.6% was achieved. As a result of coupling with the mass spectrometry (MS), a four-dimensional data plot was presented in which 373 mass peaks were detected and 22 polar compounds tentatively identified, including the GPR109A agonist niacin. Finally, molecular docking of these 22 identified compounds to ß2-AR, M3, GPR35 and GPR109A receptors was performed to predict potential active ingredients, and compound 9 was predicted to have a similar interaction to the ß2-AR partial agonist salmeterol. These results were supplementary to the material basis of Curcuma kwangsiensis and facilitated the bioactivity research of polar compounds. The integration of RPLC×HILIC-MS and molecular docking can be a powerful tool for characterizing and predicting polar active components in TCM.

[Research progress of Curcuma kwangsiensis root tubers and analysis of liver protection and anti-tumor mechanisms based on Q-markers].

Curcuma kwangsiensis root tuber is a widely used genuine medicinal material in Guangxi, with the main active components of terpenoids and curcumins. It has the effects of promoting blood circulation to relieve pain, moving Qi to relieve depression, clearing heart and cooling blood, promoting gallbladder function and anti-icterus. Modern research has proved its functions in liver protection, anti-tumor, anti-oxidation, blood lipid reduction and immunosuppression. Considering the research progress of C. kwangsiensis root tubers and the core concept of quality marker(Q-marker), we predicted the Q-markers of C. kwangsiensis root tubers from plant phylogeny, chemical component specificity, traditional pharmacodynamic properties, new pharmacodynamic uses, chemical component measurability, processing methods, compatibility, and components migrating to blood. Curcumin, curcumol, curcumadiol, curcumenol, curdione, germacrone, and ß-elemene may be the possible Q-markers. Based on the predicted Q-markers, the mechanisms of the liver-protecting and anti-tumor activities of C. kwangsiensis root tubers were analyzed. AKT1, IL6, EGFR, and STAT3 were identified as the key targets, and neuroactive ligand-receptor interaction signaling pathway, nitrogen metabolism pathway, cancer pathway, and hepatitis B pathway were the major involved pathways. This review provides a basis for the quality evaluation and product development of C. kwangsiensis root tubers and gives insights into the research on Chinese medicinal materials.

[Identification of curcumin content in raw and vinegar-processed rhizomes of Curcuma kwangsiensis based on electronic nose combined with back propagation neural network].

This study aimed to establish a rapid and accurate method for identification of raw and vinegar-processed rhizomes of Curcuma kwangsiensis, in order to predict the content of curcumin compounds for scientific evaluation. A complete set of bionics recognition mode was adopted. The digital odor signal of raw and vinegar-processed rhizomes of Curcuma kwangsiensis were obtained by e-nose, and analyzed by back propagation(BP) neural network algorithm, with the accuracy, the sensitivity and specificity in discriminant model, correlation coefficient as well as the mean square error in regression model as the evaluation indexes. The experimental results showed that the three indexes of the e-nose signal discrimination model established by the neural network algorithm were 100% in training set, correction set and prediction set, which were obviously better than the traditional decision tree, naive bayes, support vector machine, K nearest neighbor and boost classification, and could accurately differentiate the raw and vinegar products. Correlation coefficient and mean square error of the regression model in prediction set were 0.974 8 and 0.117 5 respectively, and could well predict curcumin compounds content in Curcuma kwangsiensis, and demonstrate the superiority of the simulation biometrics model in the analysis of traditional Chinese medicine. By BP neural network algorithm, e-nose odor fingerprint could quickly, conveniently and accurately realize the discrimination and regression, which suggested that more bionics information acquisition and identification patterns could be combined in the field of traditional Chinese medicine, so as to provide ideas and methods for the rapid evaluation and stan-dardization of the quality of traditional Chinese medicine.

Sesquiterpenoid Compounds from Curcuma kwangsiensis.

Two previously undescribed guaiane-type sesquiterpenes (1 and 2), a pair of new salvialane-type sesquiterpenes (3a and 3b), together with 11 known compounds were isolated and purified from the rhizomes of Curcuma kwangsiensis. Their structures were elucidated by the extensive spectroscopic data (1D- and 2D-NMR) analysis. All the isolated compounds were assessed for their anti-neuroinflammatory activity by inhibiting the nitric oxide (NO) production in lipopolysaccharide (LPS)-activated murine BV-2 microglial cells in vitro assay, and the isolates 3 and 11 showed anti-neuroinflammatory activity with IC50 values of 1.85 and 20.05 µm, respectively.

Variation in Essential Oil and Bioactive Compounds of Curcuma kwangsiensis Collected from Natural Habitats.

The chemical compositions of essential oils (EOs) extracted from Curcuma kwangsiensis rhizomes collected from six natural habitats in P. R. China were evaluated using gas chromatography/mass spectrometry (GC/MS). Fifty-seven components were identified from the six EOs, and their main constituents were 8,9-dehydro-9-formyl-cycloisolongifolene (2.37 - 42.59%), germacrone (6.53 - 22.20%), and l-camphor (0.19 - 6.12%). The six EOs exhibited different DPPH radical-scavenging activities (IC50 , 2.24 - 31.03 µg/ml), with the activity of most of EOs being much higher than that of Trolox C (IC50 , 10.49 µg/ml) and BHT (IC50 , 54.13 µg/ml). Most EOs had potent antimicrobial effects against the tested bacteria and fungus. They also exhibited cytotoxicity against B16 (IC50 , 4.44 - 147.4 µg/ml) and LNCaP cells (IC50 , 73.94 - 429.25 µg/ml). The EOs showed excellent anti-inflammatory action by significantly downregulating expression of pro-inflammatory cytokines, cyclooxygenase-2, and tumor necrosis factor-α. This study provides insight into the interrelation among growth location, phytoconstituents, and bioactivities, and the results indicate the potential of C. kwangsiensis as natural nutrients, medicines, and others additives.

Terpenoids from the rhizomes of Curcuma kwangsiensis S.G. Lee et C.F. Ling and their anti-inflammatory activities.

Three new sesquiterpenes, 4S-1-(3-hydroxybutyl)-7-(11-hydroxypropyl)-10-methyl- cyclohepta-7,5,10-trien-8-one (1), 8R-hydroxy-7-(4S-4,10-dimethyl-5-oxooct-1-en-7-yl)-11- methylfuran-12-one (2), (1S,5R,7S,10R)-1-hydroxy-7-(11-hydroxypropyl)-10-methyl-4- methyleneoctahydronaphthalen-8-one (3), along with 30 known terpenoids (4-33) were obtained from the rhizomes of Curcuma kwangsiensis S.G. Lee et C.F. Ling. Through comprehensive analysis of chemical evidence and spectral data including UV, ECD, IR, 1D and 2D NMR and HR-ESI-MS, as well as quantum chemical calculation, the structures of these novel compounds were successfully determined. Additionally, the inhibitory effects of compounds 1-2, 4-33 on NO production were evaluated in lipopolysaccharide (LPS)-induced RAW264.7 cells. Notably, compound 33 exhibited the most significant inhibitory effect with an IC50 value of 3.55 ± 0.55 µM.

Comparative transcriptome analysis on drought stress-induced floral formation of Curcuma kwangsiensis.

The rhizomes and tubers of Curcuma kwangsiensis have extensive medicinal value in China. However, the inflorescences of C. kwangsiensis are rarely known in horticulture, because of its low field flowering rate. In order to improve the flowering rate of C. kwangsiensis, we conducted drought stress treatment on the rhizome of C. kwangsiensis. The flowering rate of rhizome was the highest after 4d of drought stress treatment, and the buds on the rhizome could be obviously swell on the 4th day of rehydration culture. In order to identify the genes regulating the flowering time of Curcuma kwangsiensis, comparative transcriptome analysis was performed on the buds on rhizomes before drought stress treatment, 4 d after drought stress treatment and 4 d after rehydration culture. During this process, a total of 20 DEGs controlling flowering time and 23 DEGs involved in ABA synthesis and signal transduction were identified, which might regulate the flowering of C. kwangsiensis under drought stress. Some floral integration factors, such as SOC1 and FTIP, were up-regulated under drought stress for 4 d, indicating that C. kwangsiensis had flowering trend under drought stress. The results of the present study will provide theoretical support for the application of Curcuma kwangsiensis in gardening.

A polysaccharide from native Curcuma kwangsiensis and its mechanism of reversing MDSC-induced suppressive function.

A purified polysaccharide nCKAP-2 was prepared from Curcuma kwangsiensis and characterized. Structural analyses revealed that nCKAP-2 contains a high-branched arabinan composed of mono-substituted (O-5, 17.07 %) and di-substituted (O-2,5, 16.67 %) (1 â†’ 3)-α-Araf residues. Bioactive test showed that nCKAP-2 significantly reversed the suppression function of myeloid-derived suppressor cells (MDSCs) on T cells. Further study revealed that treatment of MDSCs with nCKAP-2 could induce apoptotic cell death at the G0/G1 phase via the intrinsic pathway as suggested from the up-regulation of cleaved caspase 3 and 9, cleaved PARP, and Bax and the down-regulation of Bcl-xl. This apoptotic process was mainly mediated by the TLR4-NF-κB signaling pathway. Additionally, the down-regulation of ROS level of MDSCs after nCKAP-2 treatment involved in this process. Summarily, we explain how nCKAP-2 reverses the MDSC-induced suppressive function on T cells, and provide a scientific basis for the clinical application and development of C. kwangsiensis.

Antioxidant effects of diarylheptanoids from two Curcuma species.

Five linear diarylheptanoids (1-5), including a new one (1), were isolated from the rhizomes of Curcuma kwangsiensis S. G. Lee et C. F. Liang, while four linear diarylheptanoids (6-9) and four cyclic diarylheptanoids (10-13) were isolated from the roots of Curcuma aromatica Salisb. Using the model of H2O2-induced PC12 cells, the antioxidant effects of these thirteen diarylheptanoids from these two traditional Chinese medicines from Curcuma genus of Zingiberaceae family were investigated. As result, they produced different efficiency on damaged cell viability, ROS, LDH, SOD, CAT, and GSH-Px, which were the six indexes related to oxidative stress. Further, the correlation between these six bio-indexes and 53 selected molecular descriptors of diarylheptanoids was determined by PLS regression analysis.

Anti-inflammatory and antinociceptive effects of Curcuma kwangsiensis and its bioactive terpenoids in vivo and in vitro.

ETHNOPHARMACOLOGICAL RELEVANCE: "Curcumae Radix", the dried rhizomes of Curcuma kwangsiensis documented in Chinese pharmacopoeia, has been traditionally used for the treatment of inflammatory and pain diseases, such as jaundice and red urine, cleaning the heart-fire and depression, arthralgia, and dysmenorrhea. However, according to literature surveys, anti-inflammatory and antinociceptive studies of C. kwangsiensis have been seldom reported so far. AIM OF THE STUDY: The current study focuses on the anti-inflammatory and antinociceptive effects of C. kwangsiensis and discovering the bioactive compounds for its traditional usages both in vivo and in vitro, which could provide scientific justification about its traditional use. MATERIAL AND METHODS: The anti-inflammatory and antinociceptive assays of various layers (ME, EA, AQS) from C. kwangsiensis were achieved by carrageenan-induced paw edema and acetic acid-induced writhing animal models, respectively. The most bioactive part, EA layer was further phytochemically investigated by multiple step chromatography techniques. The structures of these isolates were unambiguously elucidated by means of extensive spectroscopic and chemical methods, and comparison with corresponding data of the reported literature. Four major sesquiterpenoids (4, 6, 14, and 15) were achieved for their anti-inflammatory and antinociceptive assays by the two aforementioned animal models in vivo. All the isolated compounds were evaluated for their anti-inflammatory effects via detecting inflammatory mediator releases (COX-2, IL-1ß, and TNF-α) in RAW 264.7 macrophage cells induced by LPS. RESULTS: The ME and EA layers significantly alleviated the paw edema caused by carrageenan and decreased the number of writhes induced by acetic acid at the dose of 200 and/or 100 mg/kg in comparison to the control group (p < 0.01/0.05), and the EA layer exhibited better activity than that of ME layer. Subsequent phytochemical investigation on EA layer of C. kwangsiensis exhibited that three new terpenoid compounds (1-3), identified as (12Z,14R)-7ß-hydroxylabda-8(17),12-diene-14,15,16-triol (1), (12Z,14S)- 7ß-hydroxlabda-8(17),12-diene-14,15,16-triol (2), and (4S)-hydroxy-(8)-methoxy-(5S)-(H)-guaia1(10),7(11)-dien-12,8-olide (3), together with twenty-two known analogs were isolated. Furthermore, four major sesquiterpenoids (4, 6, 14, and 15) significantly relieved the paw edema and number of writhes at 100 and/or 50 mg/kg (p < 0.05/0.01). Likewise, the majority of sesqui- and diterpenoids isolated could remarkably inhibited the secretion of inflammatory mediators (COX-2, IL-1ß, and TNF-α) in LPS-stimulated RAW 264.7 macrophages cells at the concentration of 20 µg/mL, comparable to DXM used as the positive control. All the results suggested that EA layer from C. kwangsiensis possessed the anti-inflammatory and antinociceptive activities, and these sesqui- and diterpenoids could be the effective constituents responsible for relieving inflammation. CONCLUSION: The present studies undoubtedly determined the anti-inflammatory and antinociceptive material basis of C. kwangsiensis, including the EA layer and its precise components, which presented equivalent or better anti-inflammatory effects than that of positive control (ASP/DXM) in vivo and in vitro. These results not only would account for scientific knowledge for traditional use of C. kwangsiensis, but also provide credible theoretical foundation for the further development of anti-inflammatory and antinociceptive agents.

Structural characterization of a pectin-type polysaccharide from Curcuma kwangsiensis and its effects on reversing MDSC-mediated T cell suppression.

Myeloid-derived suppressor cells (MDSCs) accumulate in tumor-bearing hosts and play a major role in tumor-induced immunosuppression. The potent modulatory effects of polysaccharides on the innate and adaptive immune system stimulate antitumor responses. In this study, a polysaccharide with an apparent molecular weight of 14.0 kD was isolated from Curcuma kwangsiensis and designated as CKAP-2. The polysaccharide was characterized through high-performance gel permeation chromatography, chemical derivative analyses, GC-MS, FT-IR, and NMR. Results revealed that CKAP-2 is a highly methyl-esterified pectin-type polysaccharide. It is predominantly composed of a homogalacturonan region and small amounts of type-I rhamonogalacturonan regions. Its degree of methyl-esterification is approximately 62.4%. The effect of CKAP-2 on MDSC-medicated immunosuppression was primarily tested. CKAP-2 recovered the MSC2-supressed proliferation of CD4+ and CD8+ T-cells. This finding suggested that CKAP-2 can reverse MDSC-mediated T-cell suppression and that CKAP-2 can be potentially applied in antitumor therapy.

Diarylheptanoid from rhizomes of Curcuma kwangsiensis (DCK) inhibited imiquimod-induced dendritic cells activation and Th1/Th17 differentiation.

BACKGROUND AND OBJECT: Dendritic cells (DCs) are critical for initiating the activation and differentiation of T cells in inflammatory diseases including psoriasis. Curcuma kwangsiensis S.G. Lee & C.F. Liang is a herb for treating psoriasis and we previously found Diarylheptanoid from rhizomes of Curcuma kwangsiensis (DCK) inhibited keratinocytes proliferation. However, it is unknown whether DCK influences DC functions. Thus we aimed to explore whether DCK affect the major immunological functions of DCs. MATERIALS AND METHODS: Primary DCs derived from mouse bone marrow cells and spleen were used for examining their general immunological functions, and OVA-specific T cells from OT-II mice were used for examining the DC-mediated T-helper (Th) 1 and Th17 cells differentiation and effect. RESULTS: We demonstrated DCK suppressed DC uptake of FITC-labeled ovalbumin (OVA) and DC maturation characterized by decreased MHCII, CD80 and CD86 following imiquimod (IMQ) stimulation. DCK also reduced DC expression of the lymphoid-homing chemokine receptor CCR7, and DC migration towards CCL21, the ligand for CCR7. Importantly, DCK significantly reduced the production of proinflammatory cytokines including IL-12, IL-6 and IL-1ß by IMQ-stimulated DCs. Moreover, in the coculture of OVA323-339 peptide-pulsed DCs and OVA-specific T cells from OT-II mice, DCK significantly inhibited T cell proliferation and the differentiation of Th1 and Th17 cells. Furthermore, DCK treatment greatly reduced phosphorylation of p65-associated cell signaling pathway in IMQ-stimulated DCs. CONCLUSION: These data together demonstrate a potential role of DCK in suppressing the biological function of DCs, and provide a possible mechanism for understanding the effects of herb Curcuma kwangsiensis in treating psoriasis.

On-line comprehensive two-dimensional liquid chromatography tandem mass spectrometry for the analysis of Curcuma kwangsiensis.

A novel online comprehensive two-dimensional liquid chromatography (2DLC) coupled with quadrupole time-of-flight (Q-TOF) mass spectrometry (MS) method is developed for the analysis of Curcuma kwangsiensis (C. kwangsiensis) extract. In this system, a newly developed phenyl/tetrazole sulfoether (PTAS) bonded stationary phase was introduced to construct RPLC×RPLC combined with C18. The unique structure endowed PTAS with very different selectivity from C18, reaching a high orthogonality of 93.2%. Moreover, such a combination settled compatibility issues because of the weaker hydrophobic retaining property of PTAS, thus allowing direct interfacing in online configuration. As a result of coupling with the mass spectrometry, a four-dimensional (4D) data plot was presented, in which 439 peaks (containing positive mode and negative mode) were counted, and 105 compounds were grouped and tentatively identified in C. kwangsiensis extract, including 73 unreported ones. Some novel types of compounds with masses exceeding 500 were discovered for the first time. Besides, compared to one-dimensional liquid chromatography (1DLC), the great resolution power of this system allowed separation of more isomers. These results provide supplementary to the material basis of C. Kwangsiensis and in-depth research should be conducted. The configuration of RPLC×RPLC-Q-TOF MS can be a powerful and efficient tool for separation and characterization of chemical substances in complicated herbal extracts.

Structural characterization and immunostimulating activity of a levan-type fructan from Curcuma kwangsiensis.

A fructan designated as CKNP with apparent molecular weight of 5.3kD was isolated from the hot water extract of Curcuma kwangsiensis through a combination of ion-exchange chromatography on DEAE 650M and gel filtration on Superdex G-200. CKNP was characterized by chemical derivatization as well as HPLC, GC, and GC-MS technologies. Structural studies revealed that CKNP is composed predominately of fructose (96.8%) and a small amount of glucose (3.2%) with a degree of polymerization (DP) of 30-31. It was deduced to be a levan-type fructan containing a backbone composed of (2→6)-linked ß-d-Fruf residues and single ß-d-Fruf residues as side chains branched at the O-1 position along the backbone. Preliminary in vitro bioactive tests on RAW 264.7 murine macrophage cells revealed that the levan-type fructan from C. kwangsiensis shows significant immunostimulating activity based on its ability to stimulate macrophage proliferation and enhance phagocytosis.

Five new diarylheptanoids from the rhizomes of Curcuma kwangsiensis and their antiproliferative activity.

Five new diarylheptanoids (1-5), along with nine known ones (6-14), were isolated from the rhizomes of Curcuma kwangsiensis. Their structures were established on the basis of spectroscopic analyses. Compounds 1-3 were cyclic diarylheptanoids rarely discovered from C. kwangsiensis. Of all the isolated compounds, compound 4 showed moderate antiproliferative activity on HH and HaCaT cells.

Phytochemical profiling of Curcuma kwangsiensis rhizome extract, and identification of labdane diterpenoids as positive GABAA receptor modulators.

An ethyl acetate extract of Curcuma kwangsiensis S.G. Lee & C.F. Liang (Zingiberaceae) rhizomes (100 µg/ml) enhanced the GABA-induced chloride current (IGABA) through GABAA receptors of the α1ß2γ2S subtype by 79.0±7.0%. Potentiation of IGABA was measured using the two-microelectrode voltage-clamp technique and Xenopus laevis oocytes. HPLC-based activity profiling of the crude extract led to the identification of 11 structurally related labdane diterpenoids, including four new compounds. Structure elucidation was achieved by comprehensive analysis of on-line (LC-PDA-ESI-TOF-MS) and off-line (microprobe 1D and 2D NMR) spectroscopic data. The absolute configuration of the compounds was established by comparison of experimental and calculated ECD spectra. Labdane diterpenes represent a new class of plant secondary metabolites eliciting positive GABAA receptor modulation. The highest efficiency was observed for zerumin A (maximum potentiation of IGABA by 309.4±35.6%, and EC50 of 24.9±8.8 µM).