Cryptic splice mutation in the fumarate hydratase gene in patients with clinical manifestations of Hereditary Leiomyomatosis and Renal Cell Cancer.

Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is an autosomal dominant condition characterized by the development of cutaneous and uterine leiomyomas and risk for development of an aggressive form of papillary renal cell cancer. HLRCC is caused by germline inactivating pathogenic variants in the fumarate hydratase (FH) gene, which encodes the enzyme that catalyzes the interconversion of fumarate and L-malate. We utilized enzyme and protein mobility assays to evaluate the FH enzyme in a cohort of patients who showed clinical manifestations of HLRCC but were negative for known pathogenic FH gene variants. FH enzyme activity and protein levels were decreased by 50% or greater in three family members, despite normal FH mRNA expression levels as measured by quantitative PCR. Direct Nanopore RNA sequencing demonstrated 57 base pairs of retained intron sequence between exons 9 and 10 of polyadenylated FH mRNA in these patients, resulting in a truncated FH protein. Genomic sequencing revealed a heterozygous intronic alteration of the FH gene (chr1: 241498239 T/C) resulting in formation of a splice acceptor site near a polypyrimidine tract, and a uterine fibroid obtained from a patient showed loss of heterozygosity at this site. The same intronic FH variant was identified in an unrelated patient who also showed a clinical phenotype of HLRCC. These data demonstrate that careful clinical assessment as well as biochemical characterization of FH enzyme activity, protein expression, direct RNA sequencing, and genomic DNA sequencing of patient-derived cells can identify pathogenic variants outside of the protein coding regions of the FH gene.

Segregation, immunohistochemical, molecular and functional analyses classify a novel missense variant in fumarate hydratase (FH) as pathogenic.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is an autosomal dominant cancer predisposition syndrome characterized by cutaneous leiomyomas, uterine leiomyomas, and aggressive renal cancer. Germline variants in the fumarate hydratase (FH) gene predispose to HLRCC. Identifying germline pathogenic FH variants enables lifetime renal cancer screening and genetic testing for family members. In this report, we present a FH missense variant (c.1039T>C (p.S347P)), initially classified as a variant of uncertain significance. Clinical assessment, histopathological findings, molecular genetic studies, and enzymatic activity studies support the re-classification of the FH c.1039T>C variant to "pathogenic" based on ACMG/AMP criteria. Further insights into pathological recognition of FH-deficient renal cancer are discussed and should be recognized. This study has shown how (a) detailed multi-disciplinary analyses of a single variant can reclassify rare missense variants in FH and (b) careful pathological review of renal cancers is obligatory when HLRCC is suspected.

Fumarate hydratase variant prevalence and manifestations among individuals receiving germline testing.

BACKGROUND: Germline variants in fumarate hydratase (FH) are associated with autosomal dominant (AD) hereditary leiomyomatosis and renal cell cancer (HLRCC) and autosomal recessive (AR) fumarase deficiency (FMRD). The prevalence and cancer penetrance across different FH variants remain unclear. METHODS: A database containing 120,061 records from individuals undergoing cancer germline testing was obtained. FH variants were classified into 3 categories: AD HLRCC variants, AR FMRD variants, and variants of unknown significance (VUSs). Individuals with variants from these categories were compared with those with negative genetic testing. RESULTS: FH variants were detected in 1.3% of individuals (AD HLRCC, 0.3%; AR FMRD, 0.4%; VUS, 0.6%). The rate of AD HLRCC variants discovered among reportedly asymptomatic individuals without a clear indication for HLRCC testing was 1 in 2668 (0.04%). In comparison with those with negative genetic testing, the renal cell carcinoma (RCC) prevalence was elevated with AD HLRCC variants (17.0% vs 4.5%; P < .01) and VUSs (6.4% vs 4.5%; P = .02) but not with AR FMRD variants. CONCLUSIONS: The prevalence of HLRCC discovered incidentally on germline testing is similar to recent population carrier estimates, and this suggests that this is a relatively common cancer syndrome. Compared with those with negative genetic testing, those with VUSs had an elevated risk of RCC, whereas those with AR FMRD variants did not.

Gene Polymorphisms of Interleukin-27 Correlate with the Susceptibility, Severity, and Clinical Outcomes of Elderly People with Guillain-Barré Syndrome.

INTRODUCTION: Guillain-Barré syndrome (GBS) is a common autoimmune disease in the peripheral nervous system. This study aimed to elucidate the role of IL-27 gene polymorphisms in elderly people with GBS. METHODS: A total of 395 healthy subjects and 422 GBS patients with an average age of 63 years old were included in this study. Peripheral blood samples were collected. The 2 single-nucleotide polymorphisms (SNPs) of IL-27, namely, rs153109 and rs785575, of GBS patients were analyzed using the PCR method and compared with those of the healthy controls. The correlations of IL-27 SNPs with disease severity, disease outcome, level of anti-GM1 antibodies, and Campylobacter jejuni infection were assessed. Serum levels of IL-27 of healthy subjects and GBS patients were analyzed using enzyme-linked immunosorbent assay. RESULTS: No significant differences in the frequencies of rs785575 SNPs between GBS and healthy subjects were observed. In analyzing rs153109 SNPs, the G allele was found to be more prevalent in the GBS patients (p = 0.012). More alleles show GG genotype in GBS patients (p = 0.023). The -964A>G allele has a higher prevalence in severely affected and anti-GM1-Ab-positive GBS patients. GBS patients with the rs153109 SNP showed a poor clinical outcome than those without rs153109 SNP (p = 0.012). GBS patients showed higher serum IL-27 levels than healthy subjects (p < 0.001). The levels of IL-27 were also higher in GBS patients with genotypes of AG and GG, and those with GG genotypes showed the highest IL-27 levels. CONCLUSION: The rs153109 SNP is more prevalent in GBS patients with the GG and G allele and is associated with severer GBS, poorer clinical outcomes, and higher IL-27 levels.

Uterine leiomyomas in hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome can be identified through distinct clinical characteristics and typical morphology.

INTRODUCTION: Hereditary leiomyomatosis and renal cell cancer (HLRCC) constitute a tumor susceptibility syndrome caused by germline mutations in the fumarate hydratase (FH) gene. The most common features are leiomyomas of the uterus and the skin. The syndrome includes a predisposition to early-onset, aggressive renal cell cancer. It is important to identify women with HLRCC among other uterine leiomyoma patients in order to direct them to genetic counseling and to identify other affected family members. MATERIAL AND METHODS: We conducted a nationwide historical study to identify typical clinical characteristics, uterine leiomyoma morphology, and immunohistochemistry for diagnosing HLRCC. The study included 20 women with a known FH germline mutation and 77 women with sporadic uterine leiomyomas. The patient records of all women were reviewed to obtain clinical details regarding their leiomyomas. Uterine leiomyoma tissue specimens from 43 HLRCC-related leiomyomas and 42 sporadic leiomyomas were collected and prepared for histology analysis. A morphologic description was performed on hematoxylin & eosin-stained tissue slides, and immunohistochemical analysis was carried out for CD34, Bcl-2, and p53 stainings. RESULTS: The women with HLRCC were diagnosed with uterine leiomyomas at a young age compared with the sporadic leiomyoma group (mean 33.8 years vs. 45.4 years, P < 0.0001), and their leiomyomas occurred as multiples compared with the sporadic leiomyoma group (more than four tumors 88.9% vs. 30.8%, P < 0.0001). Congruently, these women underwent surgical treatment at younger age compared with the sporadic leiomyoma group (mean 37.3 years vs. 48.3 years, P < 0.0001). HLRCC leiomyomas had denser microvasculature highlighted by CD34 immunostaining when compared with the sporadic leiomyoma group (112.6 mean count/high-power field, SD 20.8 vs. 37.4 mean count/high-power field, SD 21.0 P < 0.0001) and stronger anti-apoptotic protein Bcl-2 immunostaining when compared with the sporadic leiomyoma group (weak 4.7%, moderate 44.2%, strong 51.2% vs. 26.2%, 52.4%, 21.4%, respectively, P = 0.003). No differences were observed in p53 staining. CONCLUSIONS: Women with HLRCC may be identified through the distinct clinical characteristics: symptomatic and numerous leioymyomas at young age, and morphologic features of FH-mutant leiomyomas, aided by Bcl-2 and CD34 immunohistochemistry. Further, distinguishing individuals with a germline FH mutation enables proper genetic counseling and regular renal monitoring.

[FH-deficient renal cell carcinoma expands the spectrum of renal papillary tumors]. / Das FH-defiziente Nierenzellkarzinom erweitert das Spektrum der papillären Tumoren in der Niere.

Fumarate hydratase (FH)-deficient renal cell carcinoma (RCC) is a distinct entity, which shows a biallelic inactivation of the FH gene that consequently leads to FH protein expression and function loss, respectively. This alteration leads to an accumulation of the oncometabolite fumarate in the citrate cycle and various disorders of the cell balance and DNA processing. FH-deficient RCC often shows a morphologically overlapping spectrum with papillary renal cell carcinoma (type 2), whereby a typical mixture of growth patterns including tubulo-cystic, cribriform, and/or solid differentiation can be observed. A characteristic but non-specific morphological feature is prominent eosinophilic, virus-inclusion body-like nucleoli with perinucleolar halos. Tumoral immunohistochemical loss of FH expression supports the diagnosis but may be preserved in rare cases. Most FH-deficient RCCs show very aggressive biological behavior and are often metastasized at the time of diagnosis. The initial description encompassed RCC in association with the hereditary leiomyomatosis and renal cell carcinoma (HLRCC) syndrome, which also includes cutaneous and uterine leiomyomas. However, current data also show an increasing proportion of sporadic cases, so that a distinction (hereditary vs. sporadic) seems appropriate. So far, few but promising data on effective systemic therapeutic options have been reported. In summary, precise diagnosis is of great importance due to the frequent aggressive biological behavior, potential need to deviate from the therapeutic standard, and the possible indicator of a hereditary disease.

Prevalence of somatic and germline mutations of Fumarate hydratase in uterine leiomyomas from young patients.

AIMS: Hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome is caused by germline mutations in the Fumarate hydratase (FH) gene. In young women, the syndrome often presents with symptomatic uterine leiomyomas, leading to myomectomy or hysterectomy. In this study, we aimed to investigate the incidence and mutational profiles of FH-negative leiomyomas from young patients, thus allowing for early identification and triage of syndromic patients for surveillance. METHODS AND RESULTS: We evaluated 153 cases of uterine leiomyomas from women aged up to 30 years for loss of FH expression by tissue microarray (TMA)-based immunohistochemical staining. Mutational analysis of tumours with loss of FH was carried out by polymerase chain reaction (PCR) amplification of 10 exons within the FH gene and subsequent Sanger sequencing. The status of promoter methylation was assessed by bisulphite sequencing. Loss of FH protein expression was detected in seven (4.6%) of 153 tested uterine leiomyomas from young patients. All FH-negative leiomyomas displayed staghorn vasculature and fibrillary/neurophil-like cytoplasm. We found that six (86%) of seven FH-negative tumours detected by immunohistochemistry harboured FH mutations, 50% of which contained germline mutations. In particular, the germline mutational rate in FH gene was 2.0% (three of 153 cases). Bisulphite sequencing analysis failed to detect promoter methylation in any of the seven tumours. CONCLUSION: Our study showed a relatively high rate of FH germline mutation in FH-negative uterine leiomyomas from patients aged up to 30 years. While genetic mutations confer protein expression loss, epigenetic regulation of the FH gene appears to be unrelated to this phenotype.

Fumarate hydratase inactivation in hereditary leiomyomatosis and renal cell cancer is synthetic lethal with ferroptosis induction.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a hereditary cancer syndrome characterized by inactivation of the Krebs cycle enzyme fumarate hydratase (FH). HLRCC patients are at high risk of developing kidney cancer of type 2 papillary morphology that is refractory to current radiotherapy, immunotherapy and chemotherapy. Hence, an effective therapy for this deadly form of cancer is urgently needed. Here, we show that FH inactivation (FH-/- ) proves synthetic lethal with inducers of ferroptosis, an iron-dependent and nonapoptotic form of cell death. Specifically, we identified gene signatures for compound sensitivities based on drug responses for 9 different drug classes against the NCI-60 cell lines. These signatures predicted that ferroptosis inducers would be selectively toxic to FH-/- cell line UOK262. Preferential cell death against UOK262-FH-/- was confirmed with 4 different ferroptosis inducers. Mechanistically, the FH-/- sensitivity to ferroptosis is attributed to dysfunctional GPX4, the primary cellular defender against ferroptosis. We identified that C93 of GPX4 is readily post-translationally modified by fumarates that accumulate in conditions of FH-/- , and that C93 modification represses GPX4 activity. Induction of ferroptosis in FH-inactivated tumors represents an opportunity for synthetic lethality in cancer.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Hereditary leiomyomatosis and renal cell cancer without cutaneous manifestations in two Japanese siblings.

Hereditary leiomyomatosis and renal cell cancer is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis, and an aggressive type 2 papillary renal cell carcinoma. The disease is caused by a germline mutation in the fumarate hydratase gene. We report a familial hereditary leiomyomatosis and renal cell cancer in two siblings. A 34-year-old woman underwent nephrectomy for treatment of a renal cell carcinoma. The patient's sister had been diagnosed with renal cell carcinoma at 28 years-of-age and died of the disease. Neither sister had apparent skin tumors. Histopathology of the renal cell carcinomas of the siblings showed tubulocystic and papillary architectures with high nuclear grades. Immunostaining showed no fumarate hydratase expression in either tumor. Genomic DNA sequencing of the patient showed a germline mutation in the fumarate hydratase gene (c.675delT). Although there is no epidemiological information on Asian hereditary leiomyomatosis and renal cell cancer, physicians should be aware that typical cutaneous leiomyomatosis might not always be present in patients with hereditary leiomyomatosis and renal cell cancer.

Cascade Fumarate Hydratase mutation screening allows early detection of kidney tumour: a case report.

BACKGROUND: Fumarate hydratase (FH) deficiency is a rare autosomal recessive disorder which results in a major defect in cellular metabolism. It presents in infancy with progressive encephalopathy, hypotonia, seizures and failure to thrive and is often fatal in childhood. It is caused by mutations in the FH gene (1q42.1) that result in deficiency of the citric acid cycle enzyme fumarate hydratase, resulting in accumulation of fumaric acid. Heterozygous germline mutations in the FH gene predispose to an aggressive autosomal dominant inherited early-onset kidney cancer syndrome: hereditary leiomyomatosis and renal cell cancer (HLRCC). CASE PRESENTATION: Cascade FH mutation screening enabled the early diagnosis of a renal tumour in an asymptomatic parent of a child with fumarate hydratase deficiency, resulting in timely and possibly life-saving treatment. CONCLUSION: While the theoretical risk of kidney cancer in parents of children with recessive fumarate hydratase deficiency is well recognized, to our knowledge this is the first report of a kidney tumour being detected in a parent by screening performed for this indication. This underscores the importance of offering lifelong kidney surveillance to such parents and other heterozygous relatives of children born with fumarate hydratase deficiency.

Multiple cutaneous leiomyomas leading to discovery of novel splice mutation in the fumarate hydratase gene associated with HLRCC.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare autosomal dominant condition, which manifests as cutaneous leiomyomas (CL), uterine fibroids and renal cell cancer (RCC). We describe the case of a 53-year-old woman who presented with multiple CL with a novel heterozygous canonical splice site mutation in intron 9 of the fumarate hydratase (FH) gene IVS 9-1 G>C (NM_000143.3:c 1391-1 G>C) that was not detected on initial screening of a mutation hotspot but was picked up on sequencing the remaining exons and splice site junctions. This report highlights the importance of clinical suspicion in the diagnosis of HLRCC in the absence of a family or personal history of cancer and despite initial genetic testing being negative.

Radical nephrectomy and regional lymph node dissection for locally advanced type 2 papillary renal cell carcinoma in an at-risk individual from a family with hereditary leiomyomatosis and renal cell cancer: a case report.

BACKGROUND: Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is an autosomal dominant tumor susceptibility syndrome, and the disease-related gene has been identified as fumarate hydratase (fumarase, FH). HLRCC-associated kidney cancer is an aggressive tumor characterized by early metastasis to regional lymph nodes and distant organs. Since early diagnosis and provision of definitive therapy is thought to be the best way to reduce the tumor burden, it is widely accepted that germline testing and active surveillance for an at-risk individual from a family with HLRCC is very important. However, it still remains controversial how we should treat HLRCC-associated kidney cancer. We successfully treated the patient with locally advanced HLRCC-associated kidney cancer, who has received active surveillance because of at-risk individual, by radical nephrectomy and extended retroperitoneal lymph node dissection, and examined surgically resected samples from a molecular point of view. CASE PRESENTATION: We recommended that 13 at-risk individuals from a family with HLRCC should receive active surveillance for early detection of renal cancer. A 48-year-old woman with a left renal tumor and involvement of multiple regional lymph nodes with high accumulation of fluorine-18-deoxyglucose on positron emission tomography was treated with axitinib as a neoadjuvant therapy. Preoperative axitinib induced the shrinkage of the tumor with decreased fluorine-18-deoxyglucose accumulation. Resected samples showed two thirds tumor tissue necrosis as well as high expression of serine/threonine kinase Akt and low expression of nuclear factor E2-related factor 2 (Nrf2) which activates anti-oxidant response and protects against oxidative stress in viable cancer cells. Targeted next-generation sequencing revealed that FH mutation and loss of the second allele were completely identical between blood and tumor samples, suggesting that FH mutation plays a direct role in FH-deficient RCC. She has remained well after radical operation for over 33 months. CONCLUSIONS: FH mutation plays a role in tumorigenic feature, a metabolic shift to aerobic glycolysis, and increased an anti-oxidant response phenotype in HLRCC-associated kidney cancer.

Sustained NRF2 activation in hereditary leiomyomatosis and renal cell cancer (HLRCC) and in hereditary tyrosinemia type 1 (HT1).

The nuclear erythroid 2-like 2 transcription factor (NRF2), is a major regulator of cellular redox balance. Although NRF2 activation is generally regarded as beneficial to human health, recent studies have identified that sustained NRF2 activation is over-represented in many cancers. This raises the question regarding the role of NRF2 activation in the development and progression of those cancers. This review focuses on the mechanisms and the effects of NRF2 activation in two hereditary cancer predisposition syndromes: hereditary leiomyomatosis and renal cell cancer (HLRCC) and hereditary tyrosinemia type 1 (HT1). Because the cancer initiating mutations in these hereditary syndromes are well defined, they offer a unique opportunity to explore the roles of NRF2 activation in the early stages of carcinogenesis. Over the years, a variety of approaches have been utilized to study the biology of HLRCC and HT1. In HLRCC, in vitro studies have demonstrated the importance of NRF2 activation in sustaining cancer cell proliferation. In the mouse model of HT1 however, NRF2 activation seems to protect cells from malignant transformation. In both HT1 and HLRCC, NRF2 activation promotes the clearance of electrophilic metabolites, enabling cells to survive cancer-initiating mutations. Biological insights gained from the hereditary syndromes' studies may shed light on to the roles of NRF2 activation in sporadic tumours.

Multiple cutaneous and uterine leiomyomatosis or reed syndrome: a retrospective study of 13 cases.

INTRODUCTION: Multiple cutaneous and uterine leiomyomatosis (MCUL), or Reed syndrome, is characterized by the presence of cutaneous leiomyomas arising from the arrector pili muscles and, in women, by uterine leiomyomas. In some cases, MCUL is associated with renal cell carcinoma. This syndrome is an autosomal dominant disorder caused by a heterozygous germline mutation of the gene that encodes fumarate hydratase, a Krebs cycle enzyme that acts as a tumor suppressor. OBJECTIVE: To review the cases of MCUL diagnosed at 2 university hospitals over a 5-year period (2008-2013). MATERIAL AND METHODS: This was a retrospective study of 13 cases of MCUL that investigated demographic, clinical, and histologic characteristics, as well as possible associations with other diseases and treatments received. RESULTS: We identified 13 patients (10 women and 3 men) who had been diagnosed with MCUL. The mean age at diagnosis was 53 years. All the patients had multiple cutaneous leiomyomas; in 12 (92%) the distribution was clustered and 9 (69%) also had disseminated solitary lesions. In 1 patient (7.7%), the pattern of distribution was linear. Uterine fibroids requiring hysterectomy were present in 90% of the women. Nine patients were screened for renal lesions; no cases of renal cell carcinoma were detected but benign renal lesions were found in 4 patients. CONCLUSION: The clinical and histologic characteristics of the 13 cases of MCUL reviewed were similar to those reported in the literature. The most common cutaneous manifestation was a type 2 segmental pattern. It is important for dermatologists to identify cutaneous leiomyomas and be aware of the possible association with MCUL.

Something to Reed about: fibroids, cutaneous leiomyomas, and renal cell carcinoma.

A 48 year-old woman with a history of fibroids presents with asymptomatic skin lesions. Biopsy reveals cutaneous leiomyomas and subsequent genetic evaluation confirms the diagnosis of hereditary leiomyomatosis and renal cell cancer. In this report, we review the typical presentation of the syndrome as well as recommendations for surveillance.

Fumarate Hydratase-Deficient Leiomyoma of the Uterine Corpus: Comparative Morphologic Analysis of Protein-Deficient Tumors With and Without Pathogenic Germline Fumarate Hydratase Gene Mutations.

Deficiency of fumarate hydratase (FH) protein expression in uterine corpus leiomyomas may be attributable to either germline or somatic mutations of the FH gene, the former being definitional for the hereditary leiomyomatosis and renal cell cancer syndrome. The authors assess whether, using previously reported FH-associated morphologic features, FH protein-deficient uterine corpus leiomyomas associated with a pathogenic germline mutations of the FH gene (group 1) are distinguishable from FH protein-deficient uterine corpus leiomyomas without such mutations (and whose FH protein loss is presumed to be attributable to somatic/epigenetic inactivation or other unknown phenomena: group 2). Groups 1 and 2 were compared regarding a variety of clinicopathologic features, including 7 core "FH-associated" tumoral morphologic features: staghorn vasculature; alveolar-type edema; bizarre nuclei; chain-like tumor nuclei; hyaline cytoplasmic globules; prominent nucleoli, intranuclear inclusions, and perinucleolar halos; and prominent eosinophilic/fibrillary cytoplasm. Among 2418 patients diagnosed with uterine corpus leiomyoma during the study period, FH-associated morphologic features were reported in 1.5% (37 patients), and FH immunohistochemistry was performed in 29 (1.19%). Fourteen (48.27%) of the 29 patients showed FH protein deficiency by immunohistochemistry. Twelve patients underwent germline testing, of which 8 (66.7%) were classified as group 1 and 4 (33.3%) as group 2. FH protein-deficient tumors were larger (10.44 vs 4.08 cm, P = 0.01) and associated with younger patients (42.05 vs 47.97, P = 0.004) than 370 randomly selected uterine leiomyoma controls. Groups 1 and 2 showed no significant differences in patient age and tumor size. In group 1 tumors, the FH-associated morphologic features were generally present diffusely; all group 1 tumors displayed ≥5 FH-associated features, whereas all group 2 tumors displayed <5 FH-associated features (means 6.5 ± 0.53 vs 3.5 ± 1.00, P < 0.001). Notably, eosinophilic/fibrillary cytoplasm and alveolar-type edema were each significantly more prevalent in group 1 tumors than group 2 tumors (P = 0.018 for both). No single morphologic feature was found to be completely sensitive and specific in making the distinction between group 1 and 2 tumors. Our findings suggest that groups 1 and 2 are unlikely to be morphologically distinguishable by individual morphologic features. Whether there is a combination of features that can reliably make this distinction is unclear and will require additional studies with larger cohorts.

Fumarate Hydratase-Deficient Renal Cell Carcinoma with Nucleolar Pattern of GATA3 Immunoexpression: Report of 2 Cases.

Fumarate hydratase-deficient renal cell carcinoma (FH-deficient RCC) is a rare aggressive type of renal cell carcinoma. The significant morphologic overlap with other types of renal neoplasia and the limited availability of FH and 2-succinylcholine immunostains for diagnostic use outside large referral centers have created numerous diagnostic pitfalls. As FH-deficient RCC can be associated with hereditary leiomyomatosis and renal cell cancer syndrome, the importance of an accurate diagnosis goes beyond the prognosis and treatment of an individual patient. We present 2 patients with FH-deficient RCC showing a peculiar pattern of GATA3 immunoexpression restricted to tumor nucleoli. If confirmed in further larger studies, this could provide an additional diagnostic clue for considering the FH-deficient RCC diagnosis, and given the frequent papillary morphology and possible hilar location can lead to the misdiagnosis as high-grade urothelial carcinoma, and is an important diagnostic pitfall to be aware of.