Early Introductions of Candida auris Detected by Wastewater Surveillance, Utah, USA, 2022-2023.

Candida auris is considered a nosocomial pathogen of high concern and is currently spreading across the United States. Infection control measures for C. auris focus mainly on healthcare facilities, yet transmission levels may already be significant in the community before outbreaks are detected in healthcare settings. Wastewater-based epidemiology (culture, quantitative PCR, and whole-genome sequencing) can potentially gauge pathogen transmission in the general population and lead to early detection of C. auris before it is detected in clinical cases. To learn more about the sensitivity and limitations of wastewater-based surveillance, we used wastewater-based methods to detect C. auris in a southern Utah jurisdiction with no known clinical cases before and after the documented transfer of colonized patients from bordering Nevada. Our study illustrates the potential of wastewater-based surveillance for being sufficiently sensitive to detect C. auris transmission during the early stages of introduction into a community.

Genomic Diversity and Zoonotic Potential of Brucella neotomae.

After reports in 2017 of Brucella neotomae infections among humans in Costa Rica, we sequenced 12 strains isolated from rodents during 1955-1964 from Utah, USA. We observed an exact strain match between the human isolates and 1 Utah isolate. Independent confirmation is required to clarify B. neotomae zoonotic potential.

Screening for Chlamydia and Gonorrhea in Youth Correctional Facilities, Utah, USA.

We reviewed data obtained in October 2021-May 2023 from youth who reported a history of sexual activity upon admission to 1 of 12 juvenile justice facilities in Utah, USA, that offered screening for Chlamydia trachomatis and Neisseria gonorrhoeae. Urinalysis revealed C. trachomatis positivity of 10.77%, N. gonorrhoeae positivity of 1.08%, and coinfection C. trachomatis N. gonorrhoeae) of 0.90%. Prevalence of infection was similar for youths in rural and urban facilities. A total of 12.01% of those identifying as male and 14.01% of those identifying as female tested positive for C. trachomatis, N. gonorrhoeae, or coinfection. Of young adults who tested positive, 74.65% received their results while incarcerated, all of whom accepted treatment. Our research underscores the feasibility of providing prompt C. trachomatis/N. gonorrhoeae screening and treatment in juvenile correctional facilities. The pervasiveness of infection emphasizes the urgent need for early identification and treatment for C. trachomatis and N. gonorrhoeae in incarcerated youth nationwide.

Insect exoskeletons react to hypergravity.

A typical feature of biological materials is their ability to adapt to mechanical load. However, it is not known whether the cuticle exoskeleton, one of the most common biological structures, also shares this trait. Here, we show direct experimental evidence that prolonged exposure to hypergravity conditions affects the morphology and biomechanics of an insect exoskeleton. Locusts were raised for several weeks in a custom-designed centrifuge at various levels of hypergravity. Biomechanical measurements and X-ray microtomography show that up to 3 g load Young's modulus of the tibiae increased by about 67%. Higher gravitational loads however decreased the survival rate, body mass and endocuticle thickness. These results directly show that cuticle exoskeletons can react to hypergravity. This ability has so far only been known for bone endoskeletons and plants. Our findings thus add important context to the discussion on general ultimate factors in the evolution of adaptive biological materials and skeletal systems.

A population-wide analysis of the familial risk of suicide in Utah, USA.

BACKGROUND: The degree to which suicide risk aggregates in US families is unknown. The authors aimed to determine the familial risk of suicide in Utah, and tested whether familial risk varies based on the characteristics of the suicides and their relatives. METHODS: A population-based sample of 12 160 suicides from 1904 to 2014 were identified from the Utah Population Database and matched 1:5 to controls based on sex and age using at-risk sampling. All first through third- and fifth-degree relatives of suicide probands and controls were identified (N = 13 480 122). The familial risk of suicide was estimated based on hazard ratios (HR) from an unsupervised Cox regression model in a unified framework. Moderation by sex of the proband or relative and age of the proband at time of suicide (<25 v. ⩾25 years) was examined. RESULTS: Significantly elevated HRs were observed in first- (HR 3.45; 95% CI 3.12-3.82) through fifth-degree relatives (HR 1.07; 95% CI 1.02-1.12) of suicide probands. Among first-degree relatives of female suicide probands, the HR of suicide was 6.99 (95% CI 3.99-12.25) in mothers, 6.39 in sisters (95% CI 3.78-10.82), and 5.65 (95% CI 3.38-9.44) in daughters. The HR in first-degree relatives of suicide probands under 25 years at death was 4.29 (95% CI 3.49-5.26). CONCLUSIONS: Elevated familial suicide risk in relatives of female and younger suicide probands suggests that there are unique risk groups to which prevention efforts should be directed - namely suicidal young adults and women with a strong family history of suicide.

An in-depth investigation of cryptic taxonomic diversity in the rare endemic mustard Draba maguirei.

PREMISE: Previously published evidence suggests that Draba maguirei, a mustard endemic to a few localities in the Bear River, Wellsville, and Wasatch Mountains of northern Utah, may represent a cryptic species complex rather than a single species. Conservation concerns prompted an in-depth systematic study of this taxon and its putative relatives. METHODS: Sampling most known populations of D. maguirei s.l. (D. maguirei var. maguirei and D. maguirei var. burkei), we integrate data from geography, ecology, morphology, cytogenetics and pollen, enzyme electrophoresis, and the phylogenetic analysis of nuclear internal transcribed spacer sequences to explore potential taxonomic diversity in the species complex. RESULTS: Draba maguirei var. burkei is shown here to be a distinct species (D. burkei) most closely related to D. globosa, rather than to D. maguirei. Within D. maguirei s.s., the northern (high elevation) and southern (low elevation) population clusters are genetically isolated and morphologically distinguishable, leading to the recognition here of the southern taxon as D. maguirei subsp. stonei. CONCLUSIONS: Our study reveals that plants traditionally assigned to D. maguirei comprise three genetically divergent lineages (D. burkei and two newly recognized subspecies of D. maguirei), each exhibiting a different chromosome number and occupying a discrete portion of the geographic range. Although previously overlooked and underappreciated taxonomically, the three taxa are morphologically recognizable based on the distribution and types of trichomes present on the leaves, stems, and fruit. Our clarification of the diversity and distribution of these taxa provides an improved framework for conservation efforts.

Trimester-specific ambient PM2.5 exposures and risk of intellectual disability in Utah.

Prenatal fine particulate matter (PM2.5) exposure is an understudied risk factor for neurodevelopmental outcomes, including intellectual disability (ID). Associations among prenatal exposures and neurodevelopmental outcomes may vary depending on the timing of exposure. Limited numbers of studies examining PM2.5 and neurodevelopmental outcomes have considered exposures occurring during the preconception period. To address these gaps, we conducted a case-control study of children born in Utah between 2002 and 2008 (n = 1032). Cases were identified using methods developed by the Centers for Disease Control and Prevention's Autism and Developmental Disabilities Monitoring Network and matched with controls on birth year, sex, and birth county. We estimated the daily average PM2.5 concentration during a period spanning 12 weeks before the estimated conception date, as well as during each of the three trimesters at the maternal residential address listed on the child's birth certificate. In a multivariable model, the third (OR: 2.119, CI: 1.123-3.998, p = .021) and fourth (OR: 2.631, CI: 1.750-3.956, p < .001) quartiles for preconception average PM2.5 demonstrated significantly increased risk of ID relative to the first quartile. Second quartile preconception exposure was also associated with increased risk, though it did not reach significance (OR: 1.385, CI: 0.979-1.959, p = .07). The fourth quartile of first trimester average PM2.5 was positive and significant (OR: 2.278, CI: 1.522-3.411, p < .001); the third quartile was positive, but not significant (OR: 1.159, CI: 0.870-1.544, p = .312). Quartiles of second and third trimester were not associated with higher risk of ID. These findings from Utah, which were robust to a variety of sensitivity analyses, provide initial evidence that preconception and prenatal PM2.5 exposure may be associated with ID. Future studies are needed across other geographic locations and populations.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Cluster of Norovirus Genogroup IX Outbreaks in Long-Term Care Facilities, Utah, USA, 2021.

We report 5 clustered acute gastroenteritis outbreaks in long-term care facilities in Utah, USA, that were linked to healthcare employees working at multiple facilities. Four outbreaks were caused by norovirus genotype GIX. We recommend continued norovirus surveillance and genotyping to determine contributions of this genotype to norovirus outbreaks.

Analysis of high-risk pedigrees identifies 11 candidate variants for Alzheimer's disease.

INTRODUCTION: Analysis of sequence data in high-risk pedigrees is a powerful approach to detect rare predisposition variants. METHODS: Rare, shared candidate predisposition variants were identified from exome sequencing 19 Alzheimer's disease (AD)-affected cousin pairs selected from high-risk pedigrees. Variants were further prioritized by risk association in various external datasets. Candidate variants emerging from these analyses were tested for co-segregation to additional affected relatives of the original sequenced pedigree members. RESULTS: AD-affected high-risk cousin pairs contained 564 shared rare variants. Eleven variants spanning 10 genes were prioritized in external datasets: rs201665195 (ABCA7), and rs28933981 (TTR) were previously implicated in AD pathology; rs141402160 (NOTCH3) and rs140914494 (NOTCH3) were previously reported; rs200290640 (PIDD1) and rs199752248 (PIDD1) were present in more than one cousin pair; rs61729902 (SNAP91), rs140129800 (COX6A2, AC026471), and rs191804178 (MUC16) were not present in a longevity cohort; and rs148294193 (PELI3) and rs147599881 (FCHO1) approached significance from analysis of AD-related phenotypes. Three variants were validated via evidence of co-segregation to additional relatives (PELI3, ABCA7, and SNAP91). DISCUSSION: These analyses support ABCA7 and TTR as AD risk genes, expand on previously reported NOTCH3 variant identification, and prioritize seven additional candidate variants.

Visual responses in the dorsolateral frontal cortex of marmoset monkeys.

The marmoset monkey (Callithrix jacchus) has gained attention in neurophysiology research as a new primate model for visual processing and behavior. In particular, marmosets have a lissencephalic cortex, making multielectrode, optogenetic, and calcium-imaging techniques more accessible than other primate models. However, the degree of homology of brain circuits for visual behavior with those identified in macaques and humans is still being ascertained. For example, whereas the location of the frontal eye fields (FEF) within the dorsolateral frontal cortex has been proposed, it remains unclear whether neurons in the corresponding areas show visual responses-an important characteristic of FEF neurons in other species. Here, we provide the first description of receptive field properties and neural response latencies in the marmoset dorsolateral frontal cortex, based on recordings using Utah arrays in anesthetized animals. We find brisk visual responses in specific regions of the dorsolateral prefrontal cortex, particularly in areas 8aV, 8C, and 6DR. As in macaque FEF, the receptive fields were typically large (10°-30° in diameter) and the median responses latency was brisk (60 ms). These results constrain the possible interpretations about the location of the marmoset FEF and suggest that the marmoset model's significant advantages for the use of physiological techniques may be leveraged in the study of visuomotor cognition.NEW & NOTEWORTHY Behavior and cognition in humans and other primates rely on networks of brain areas guided by the frontal cortex. The marmoset offers exciting new opportunities to study links between brain physiology and behavior, but the functions of frontal cortex areas are still being identified in this species. Here, we provide the first evidence of visual receptive fields in the marmoset dorsolateral frontal cortex, an important step toward future studies of visual cognitive behavior.

Epidemiology, Clinical Features, and Outcomes of Coccidioidomycosis, Utah, 2006-2015.

On the basis of a 1957 geographic Coccidioides seropositivity survey, 3 counties in southwestern Utah, USA, were considered coccidioidomycosis-endemic, but there has been a paucity of information on the disease burden in Utah since. We report findings from a recent clinical and epidemiologic study of coccidioidomycosis in Utah. To describe clinical characteristics, we identified all coccidioidomycosis cases in an integrated health system in the state during 2006-2015. For epidemiologic analysis, we used cases reported to the Utah Department of Health during 2009-2015. Mean state incidence was 1.83 cases/100,000 population/year. Washington County, in southwestern Utah, had the highest incidence, 17.2 cases/100,000 population/year. In a generalized linear model with time as a fixed effect, mean annual temperature, population, and new construction were associated with regional variations in incidence. Using these variables in a spatiotemporal model, we estimated the adjusted regional variation by county to predict areas where Coccidioides infections might increase.

Coordinated Strategy for a Model-Based Decision Support Tool for Coronavirus Disease, Utah, USA.

The coronavirus disease pandemic has highlighted the key role epidemiologic models play in supporting public health decision-making. In particular, these models provide estimates of outbreak potential when data are scarce and decision-making is critical and urgent. We document the integrated modeling response used in the US state of Utah early in the coronavirus disease pandemic, which brought together a diverse set of technical experts and public health and healthcare officials and led to an evidence-based response to the pandemic. We describe how we adapted a standard epidemiologic model; harmonized the outputs across modeling groups; and maintained a constant dialogue with policymakers at multiple levels of government to produce timely, evidence-based, and coordinated public health recommendations and interventions during the first wave of the pandemic. This framework continues to support the state's response to ongoing outbreaks and can be applied in other settings to address unique public health challenges.

Probability-Based Estimates of Severe Acute Respiratory Syndrome Coronavirus 2 Seroprevalence and Detection Fraction, Utah, USA.

We aimed to generate an unbiased estimate of the incidence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection in 4 urban counties in Utah, USA. We used a multistage sampling design to randomly select community-representative participants >12 years of age. During May 4-June 30, 2020, we collected serum samples and survey responses from 8,108 persons belonging to 5,125 households. We used a qualitative chemiluminescent microparticle immunoassay to detect SARS-CoV-2 IgG in serum samples. We estimated the overall seroprevalence to be 0.8%. The estimated seroprevalence-to-case count ratio was 2.5, corresponding to a detection fraction of 40%. Only 0.2% of participants from whom we collected nasopharyngeal swab samples had SARS-CoV-2-positive reverse transcription PCR results. SARS-CoV-2 antibody prevalence during the study was low, and prevalence of PCR-positive cases was even lower. The comparatively high SARS-CoV-2 detection rate (40%) demonstrates the effectiveness of Utah's testing strategy and public health response.

Discriminability of multiple cutaneous and proprioceptive hand percepts evoked by intraneural stimulation with Utah slanted electrode arrays in human amputees.

BACKGROUND: Electrical stimulation of residual afferent nerve fibers can evoke sensations from a missing limb after amputation, and bionic arms endowed with artificial sensory feedback have been shown to confer functional and psychological benefits. Here we explore the extent to which artificial sensations can be discriminated based on location, quality, and intensity. METHODS: We implanted Utah Slanted Electrode Arrays (USEAs) in the arm nerves of three transradial amputees and delivered electrical stimulation via different electrodes and frequencies to produce sensations on the missing hand with various locations, qualities, and intensities. Participants performed blind discrimination trials to discriminate among these artificial sensations. RESULTS: Participants successfully discriminated cutaneous and proprioceptive sensations ranging in location, quality and intensity. Performance was significantly greater than chance for all discrimination tasks, including discrimination among up to ten different cutaneous location-intensity combinations (15/30 successes, p < 0.0001) and seven different proprioceptive location-intensity combinations (21/40 successes, p < 0.0001). Variations in the site of stimulation within the nerve, via electrode selection, enabled discrimination among up to five locations and qualities (35/35 successes, p < 0.0001). Variations in the stimulation frequency enabled discrimination among four different intensities at the same location (13/20 successes, p < 0.0005). One participant also discriminated among individual stimulation of two different USEA electrodes, simultaneous stimulation on both electrodes, and interleaved stimulation on both electrodes (20/24 successes, p < 0.0001). CONCLUSION: Electrode location, stimulation frequency, and stimulation pattern can be modulated to evoke functionally discriminable sensations with a range of locations, qualities, and intensities. This rich source of artificial sensory feedback may enhance functional performance and embodiment of bionic arms endowed with a sense of touch.

Essential Oil Profile and Yield of Corolla, Calyx, Leaf, and Whole Flowering Top of Cultivated Lavandula angustifolia Mill. (Lamiaceae) from Utah.

Lavandula angustifolia Mill. (lavender) is an essential-oil-bearing plant in the Lamiaceae family. Volatile oil produced through the steam distillation of lavender was examined to establish the essential oil yield and aromatic profile from each portion of the plant-namely, the corolla, calyx, leaf, and whole flowering top. The resulting essential oils were analyzed by GC-FID and GC-MS. The different plant parts generally shared similar compounds but in varying relative percentages. Aromatic profiles of the whole flowering top and calyx were similar, with prominent compounds being linalool acetate (34.3%, 32.0%), linalool (26.5%, 32.9%), lavandulyl acetate (5.6%, 4.9%), terpinen-4-ol (5.3%, 7.0%), and (Z)-ß-ocimene (4.5%, 5.4%), respectively. Aromatic profiles for the corolla and leaf were unique. Prominent aromatic compounds of the corolla included linalool acetate (18.4%), linalool (10.8%), epi-α-cadinol (10.0%), borneol (7.3%), and lavandulyl acetate (6.3%). Prominent aromatic compounds of the leaf included epi-α-cadinol (19.8%), γ-cadinene (11.0%), borneol (6.0%), caryophyllene oxide (4.9%), and bornyl acetate (4.8%). Complete profiles and essential oil yields of corolla, calyx, leaf, and whole flowering top were established. This study establishes the influence the corolla, calyx, and leaf exert on the aromatic profile of the whole flowering top and provides insight into authentication of lavender essential oil.

Single-unit activity in marmoset posterior parietal cortex in a gap saccade task.

Abnormal saccadic eye movements can serve as biomarkers for patients with several neuropsychiatric disorders. The common marmoset (Callithrix jacchus) is becoming increasingly popular as a nonhuman primate model to investigate the cortical mechanisms of saccadic control. Recently, our group demonstrated that microstimulation in the posterior parietal cortex (PPC) of marmosets elicits contralateral saccades. Here we recorded single-unit activity in the PPC of the same two marmosets using chronic microelectrode arrays while the monkeys performed a saccadic task with gap trials (target onset lagged fixation point offset by 200 ms) interleaved with step trials (fixation point disappeared when the peripheral target appeared). Both marmosets showed a gap effect, shorter saccadic reaction times (SRTs) in gap vs. step trials. On average, stronger gap-period responses across the entire neuronal population preceded shorter SRTs on trials with contralateral targets although this correlation was stronger among the 15% "gap neurons," which responded significantly during the gap. We also found 39% "target neurons" with significant saccadic target-related responses, which were stronger in gap trials and correlated with the SRTs better than the remaining neurons. Compared with saccades with relatively long SRTs, short-SRT saccades were preceded by both stronger gap-related and target-related responses in all PPC neurons, regardless of whether such response reached significance. Our findings suggest that the PPC in the marmoset contains an area that is involved in the modulation of saccadic preparation.NEW & NOTEWORTHY As a primate model in systems neuroscience, the marmoset is a great complement to the macaque monkey because of its unique advantages. To identify oculomotor networks in the marmoset, we recorded from the marmoset posterior parietal cortex during a saccadic task and found single-unit activities consistent with a role in saccadic modulation. This finding supports the marmoset as a valuable model for studying oculomotor control.

Identification and genomic analysis of pedigrees with exceptional longevity identifies candidate rare variants.

BACKGROUND: Longevity as a phenotype entails living longer than average and typically includes living without chronic age-related diseases. Recently, several common genetic components to longevity have been identified. This study aims to identify additional genetic variants associated with longevity using unique and powerful analyses of pedigrees with a statistical excess of healthy elderly individuals identified in the Utah Population Database (UPDB). METHODS: From an existing biorepository of Utah pedigrees, six independent cousin pairs were selected from four extended pedigrees that exhibited an excess of healthy elderly individuals; whole exome sequencing (WES) was performed on two elderly individuals from each pedigree who were either first cousins or first cousins once removed. Rare (<.01 population frequency) variants shared by at least one elderly cousin pair in a region likely to be identical by descent were identified as candidates. Ingenuity Variant Analysis was used to prioritize putative causal variants based on quality control, frequency, and gain or loss of function. The variant frequency was compared in healthy cohorts and in an Alzheimer's disease cohort. Remaining variants were filtered based on their presence in genes reported to have an effect on the aging process, aging of cells, or the longevity process. Validation of these candidate variants included tests of segregation on other elderly relatives. RESULTS: Fifteen rare candidate genetic variants spanning 17 genes shared within cousins were identified as having passed prioritization criteria. Of those variants, six were present in genes that are known or predicted to affect the aging process: rs78408340 (PAM), rs112892337 (ZFAT), rs61737629 (ESPL1), rs141903485 (CEBPE), rs144369314 (UTP4), and rs61753103 (NUP88 and RABEP1). ESPL1 rs61737629 and CEBPE rs141903485 show additional evidence of segregation with longevity in expanded pedigree analyses (p-values = .001 and .0001, respectively). DISCUSSION: This unique pedigree analysis efficiently identified several novel rare candidate variants that may affect the aging process and added support to seven genes that likely contribute to longevity. Further analyses showed evidence for segregation for two rare variants, ESPL1 rs61737629 and CEBPE rs141903485, in the original longevity pedigrees in which they were initially observed. These candidate genes and variants warrant further investigation.

Adverse respiratory outcomes among head and neck cancer survivors in the Utah Cancer Survivors Study.

BACKGROUND: The number of head and neck cancer (HNC) survivors has been increasing because of improving survival in the United States. The aim of this study was to evaluate the incidence of respiratory disease diagnoses in HNC survivors in comparison with cancer-free individuals. A second aim was to investigate risk factors for respiratory disease among HNC survivors. METHODS: Patients with HNC diagnosed from 1996 to 2012 were identified in the Utah Cancer Registry (n = 1901). Up to 5 cancer-free individuals from the general population (n = 7796) were matched to each HNC survivor by birth year, sex, birth state, and follow-up time. Electronic medical records and statewide health care facility data were used to identify a disease diagnosis after the cancer diagnosis. Cox proportional hazards models were used to estimate the risks of respiratory diseases. RESULTS: The median follow-up times were 4.5 years for HNC survivors and 7.8 years for the general population cohort. The risks of respiratory infection (hazard ratio [HR], 1.63; 95% confidence interval [CI], 1.40-1.90), chronic obstructive pulmonary diseases and bronchiectasis (HR, 2.65; 95% CI, 2.13-3.29), and aspiration pneumonitis (HR, 6.21; 95% CI, 3.98-9.68) were higher among HNC survivors than the general population cohort more than 5 years after the cancer diagnosis. Age at diagnosis, baseline body mass index, sex, baseline smoking status, treatment modality, primary site, and stage were associated with the risk of adverse respiratory outcomes among HNC survivors. CONCLUSIONS: The risk of adverse respiratory outcomes was much higher among HNC survivors than the general population cohort. Multidisciplinary care is needed to prevent the occurrence of adverse respiratory outcomes among HNC survivors.

Risk of pelvic organ prolapse treatment based on extended family history.

BACKGROUND: Family history of pelvic organ prolapse among first-degree relatives is an established risk factor for pelvic organ prolapse; however, consideration of the constellation of family history that extends to distant relationships allows for more accurate determination of risk and may improve pelvic organ prolapse risk prediction estimates. OBJECTIVE: The purpose of this study was to assess risk for pelvic organ prolapse treatment based on varying family histories of pelvic organ prolapse and included number and types of affected relatives, ages of relatives at pelvic organ prolapse treatment, and whether the family history is of maternal or paternal origin. STUDY DESIGN: This was a retrospective, population-based study that involved the Utah Population Database, which is a population resource that includes extensive genealogy information linked to medical records. The study population included 453,522 total women: 4628 women with a diagnosis of treated (surgical or pessary) pelvic organ prolapse and their 15,530 first-degree relatives; 33,782 second-degree relatives, and 66,469 third-degree relatives. We estimated relative risk of treated pelvic organ prolapse based on specific family history constellations. RESULTS: Relative risk estimates increased with a family history of increasing numbers of treated first-degree relatives with pelvic organ prolapse (first-degree relatives, ≥1 [relative risk, 2.36; 95% confidence interval, 2.15-2.58], first-degree relatives, ≥2 [relative risk, 3.79; 95% confidence interval, 2.65-5.24], and first-degree relatives, ≥3 [relative risk, 6.26; 95% confidence interval, 1.29-18.30]). Having a family history of ≥3 affected third-degree relatives (eg, first cousins) and no affected first- or second-degree relatives was similar in risk to having 1 affected first-degree relative. Relative risk estimates decreased with increasing age of treatment for first-degree family members. Risks in individuals with a positive maternal family history for pelvic organ prolapse were consistently higher than risks in individuals with equivalent paternal family history, but paternal inheritance still played a role. Approximately 4% of the total studied female population was found to have a >2-fold risk of being treated for pelvic organ prolapse and is considered high-risk based on their family history. CONCLUSION: We provide estimates for treated pelvic organ prolapse based on an extensive family history of pelvic organ prolapse using a large population-based sample. Risk for treated pelvic organ prolapse increased with increasing numbers of affected close and distant female relatives, earlier age of pelvic organ prolapse treatment in relatives, and maternal inheritance. These risk estimates may be useful for genetic studies and investigation of risk reduction strategies in those at highest risk for pelvic organ prolapse.