An innovative, sustainable, and environmentally friendly approach for wheat drought tolerance using vermicompost and effective microorganisms: upregulating the antioxidant defense machinery, glyoxalase system, and osmotic regulatory substances.

BACKGROUND: Vermicompost contains humic acids, nutrients, earthworm excretions, beneficial microbes, growth hormones, and enzymes, which help plants to tolerate a variety of abiotic stresses. Effective microorganisms (EM) include a wide range of microorganisms' e.g. photosynthetic bacteria, lactic acid bacteria, yeasts, actinomycetes, and fermenting fungi that can stimulate plant growth and improve soil fertility. To our knowledge, no study has yet investigated the possible role of vermicompost and EM dual application in enhancing plant tolerance to water scarcity. METHODS: Consequently, the current study investigated the effectiveness of vermicompost and EM in mitigating drought-induced changes in wheat. The experiment followed a completely randomized design with twelve treatments. The treatments included control, as well as individual and combined applications of vermicompost and EM at three different irrigation levels (100%, 70%, and 30% of field capacity). RESULTS: The findings demonstrated that the application of vermicompost and/or EM significantly improved wheat growth and productivity, as well as alleviated drought-induced oxidative damage with decreased the generation of superoxide anion radical and hydrogen peroxide. This was achieved by upregulating the activities of several antioxidant enzymes, including superoxide dismutase, catalase, peroxidase, ascorbate peroxidase, glutathione peroxidase, monodehydroascorbate reductase, dehydroascorbate reductase, and glutathione reductase. Vermicompost and/or EM treatments also enhanced the antioxidant defense system by increasing the content of antioxidant molecules such as ascorbate, glutathione, phenolic compounds, and flavonoids. Additionally, the overproduction of methylglyoxal in water-stressed treated plants was controlled by the enhanced activity of the glyoxalase system enzymes; glyoxalase I and glyoxalase II. The treated plants maintained higher water content related to the higher content of osmotic regulatory substances like soluble sugars, free amino acids, glycinebetaine, and proline. CONCLUSIONS: Collectively, we offer the first report that identifies the underlying mechanism by which the dual application of vermicompost and EM confers drought tolerance in wheat by improving osmolyte accumulation and modulating antioxidant defense and glyoxalase systems.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Rice A20/AN1 protein, OsSAP10, confers water-deficit stress tolerance via proteasome pathway and positive regulation of ABA signaling in Arabidopsis.

KEY MESSAGE: Overexpression of rice A20/AN1 zinc-finger protein, OsSAP10, improves water-deficit stress tolerance in Arabidopsis via interaction with multiple proteins. Stress-associated proteins (SAPs) constitute a class of A20/AN1 zinc-finger domain containing proteins and their genes are induced in response to multiple abiotic stresses. The role of certain SAP genes in conferring abiotic stress tolerance is well established, but their mechanism of action is poorly understood. To improve our understanding of SAP gene functions, OsSAP10, a stress-inducible rice gene, was chosen for the functional and molecular characterization. To elucidate its role in water-deficit stress (WDS) response, we aimed to functionally characterize its roles in transgenic Arabidopsis, overexpressing OsSAP10. OsSAP10 transgenics showed improved tolerance to water-deficit stress at seed germination, seedling and mature plant stages. At physiological and biochemical levels, OsSAP10 transgenics exhibited a higher survival rate, increased relative water content, high osmolyte accumulation (proline and soluble sugar), reduced water loss, low ROS production, low MDA content and protected yield loss under WDS relative to wild type (WT). Moreover, transgenics were hypersensitive to ABA treatment with enhanced ABA signaling and stress-responsive genes expression. The protein-protein interaction studies revealed that OsSAP10 interacts with proteins involved in proteasomal pathway, such as OsRAD23, polyubiquitin and with negative and positive regulators of stress signaling, i.e., OsMBP1.2, OsDRIP2, OsSCP and OsAMTR1. The A20 domain was found to be crucial for most interactions but insufficient for all interactions tested. Overall, our investigations suggest that OsSAP10 is an important candidate for improving water-deficit stress tolerance in plants, and positively regulates ABA and WDS signaling via protein-protein interactions and modulation of endogenous genes expression in ABA-dependent manner.

Enhancing crop diversity for food security in the face of climate uncertainty.

Global agriculture is dominated by a handful of species that currently supply a huge proportion of our food and feed. It additionally faces the massive challenge of providing food for 10 billion people by 2050, despite increasing environmental deterioration. One way to better plan production in the face of current and continuing climate change is to better understand how our domestication of these crops included their adaptation to environments that were highly distinct from those of their centre of origin. There are many prominent examples of this, including the development of temperate Zea mays (maize) and the alteration of day-length requirements in Solanum tuberosum (potato). Despite the pre-eminence of some 15 crops, more than 50 000 species are edible, with 7000 of these considered semi-cultivated. Opportunities afforded by next-generation sequencing technologies alongside other methods, including metabolomics and high-throughput phenotyping, are starting to contribute to a better characterization of a handful of these species. Moreover, the first examples of de novo domestication have appeared, whereby key target genes are modified in a wild species in order to confer predictable traits of agronomic value. Here, we review the scale of the challenge, drawing extensively on the characterization of past agriculture to suggest informed strategies upon which the breeding of future climate-resilient crops can be based.

MdGH3.6 is targeted by MdMYB94 and plays a negative role in apple water-deficit stress tolerance.

Drought significantly limits apple fruit production and quality. Decoding the key genes involved in drought stress tolerance is important for breeding varieties with improved drought resistance. Here, we identified GRETCHEN HAGEN3.6 (GH3.6), an indole-3-acetic acid (IAA) conjugating enzyme, to be a negative regulator of water-deficit stress tolerance in apple. Overexpressing MdGH3.6 reduced IAA content, adventitious root number, root length and water-deficit stress tolerance, whereas knocking down MdGH3.6 and its close paralogs increased IAA content, adventitious root number, root length and water-deficit stress tolerance. Moreover, MdGH3.6 negatively regulated the expression of wax biosynthetic genes under water-deficit stress and thus negatively regulated cuticular wax content. Additionally, MdGH3.6 negatively regulated reactive oxygen species scavengers, including antioxidant enzymes and metabolites involved in the phenylpropanoid and flavonoid pathway in response to water-deficit stress. Further study revealed that the homolog of transcription factor AtMYB94, rather than AtMYB96, could bind to the MdGH3.6 promoter and negatively regulated its expression under water-deficit stress conditions in apple. Overall, our results identify a candidate gene for the improvement of drought resistance in fruit trees.

Genotype-dependent changes of cell wall composition influence physiological traits of a long and a non-long shelf-life tomato genotypes under distinct water regimes.

Water shortage strongly affects plants' physiological performance. Since tomato (Solanum lycopersicum) non-long shelf-life (nLSL) and long shelf-life (LSL) genotypes differently face water deprivation, we subjected a nLSL and a LSL genotype to four treatments: control (well watering), short-term water deficit stress at 40% field capacity (FC) (ST 40% FC), short-term water deficit stress at 30% FC (ST 30% FC), and short-term water deficit stress at 30% FC followed by recovery (ST 30% FC-Rec). Treatments promoted genotype-dependent elastic adjustments accompanied by distinct photosynthetic responses. While the nLSL genotype largely modified mesophyll conductance (gm ) across treatments, it was kept within a narrow range in the LSL genotype. However, similar gm values were achieved under ST 30% FC conditions. Particularly, modifications in the relative abundance of cell wall components and in sub-cellular anatomic parameters such as the chloroplast surface area exposed to intercellular air space per leaf area (Sc /S) and the cell wall thickness (Tcw ) regulated gm in the LSL genotype. Instead, only changes in foliar structure at the supra-cellular level influenced gm in the nLSL genotype. Even though further experiments testing a larger range of genotypes and treatments would be valuable to support our conclusions, we show that even genotypes of the same species can present different elastic, anatomical, and cell wall composition-mediated mechanisms to regulate gm when subjected to distinct water regimes.

Diallel analysis of cowpea (Vigna unguiculata (L.) Walp.) genotypes under water deficit stress.

Combining ability is referred to as the hybridization value of the parental genotypes involved in the crossing to develop hybrids. The best parents are selected through combining ability methods and subsequently used to produce high yielding and resistant hybrids. Thus, the objectives of this study were to (i) understand the nature and action of genes controlling water deficit tolerance, and (ii) identify superior genotypes from the genetic breadth provided by hybridization in cowpea. Twenty-four genotypes were subjected to normal irrigation and water deficit condition to examine combining ability, genotypic and phenotypic correlations for traits directly related to water deficit (proline and chlorophylls), grain yield and yield components. The results showed the presence of the action of additive and non-additive genes under both water regime conditions. However, there was the predominance of the action of additive genes for most of the traits studied under both conditions. The parents KVX61-1, IT06K242-3, IT07K-211-1-8, Kpodjiguèguè, IT99K-573-1-1, Tawa and IT97K-206-1-1 were observed to be good general combiners for proline content, chlorophyll content and traits associated with yield, while KVX61-1 × KVX396-18, IT06K242-3 × KVX396-18, IT07K-211-1-1 × KVX396-18, Kpodjiguèguè x KVX396-18, KVX61 -1 × IT97K-206-1-1, IT06K242-3 × IT97K-206-1-1, IT07K-211-1-1 × IT97K-206-1-1 and Kpodjiguèguè x IT97K-206-1-1 were proven to be the best specific combiners for traits directly related to water deficit tolerance and yield. It should be noted that number of days to pod maturity, pod length, number of pods per plant and weight of hundred seeds were highly heritable traits in this study.

Assessing the effects of 24-epibrassinolide and yeast extract at various levels on cowpea's morphophysiological and biochemical responses under water deficit stress.

BACKGROUND: Due to the factor of water deficit, which has placed human food security at risk by causing a 20% annual reduction in agricultural products, addressing this growing peril necessitates the adoption of inventive strategies aimed at enhancing plant tolerance. One such promising approach is employing elicitors such as 24-epibrassinolide (EBR) and yeast extract, which are potent agents capable of triggering robust defense responses in plants. By employing these elicitors, crops can develop enhanced adaptive mechanisms to combat water deficit and improve their ability to withstand drought condition. This study investigates the impact of different levels of EBR (0, 5, 10 µm) and yeast extract (0 and 12 g/l) on enhancing the tolerance of cowpea to water deficit stress over two growing seasons. RESULTS: The findings of this study demonstrate that, the combined application of EBR (especially 10 µm) and yeast extract (12 g/l) can increase seed yield (18%), 20-pod weight (16%), the number of pods per plant (18%), total chlorophyll content (90%), and decrease malondialdehyde content (45%) in cowpea, compared to plants grown under water deficit stress without these treatments. Upon implementing these treatments, impressive results were obtained, with the highest recorded values observed for the seed yield (1867.55 kg/ha), 20-pod weight (16.29 g), pods number per plant (9), and total chlorophyll content (19.88 mg g-1 FW). The correlation analysis indicated a significant relationship between the seed yield, and total chlorophyll (0.74**), carotenoids (0.82**), weight of 20 seeds (0.67**), and number of pods (0.90**). These traits should be prioritized in cowpea breeding programs focusing on water deficit stress. CONCLUSIONS: The comprehensive exploration of the effects of EBR and yeast extract across various levels on cowpea plants facing water deficit stress presents a pivotal contribution to the agricultural domain. This research illuminates a promising trajectory for future agricultural practices and users seeking sustainable solutions to enhance crops tolerance. Overall, the implications drawn from this study contribute significantly towards advancing our understanding of plant responses to water deficit stress while providing actionable recommendations for optimizing crop production under challenging environmental conditions.

Exploring the quantitative genetics of traits associated with drought tolerance and yield in Pimpinella anisum L. under different water regimes.

MAIN CONCLUSION: Genetic improvement of seed yield and drought resistance could be simultaneously gained in anise when breeding for drought resistance. Improving the water use efficiency of anise is a primary objective of anise breeding programs aimed at mitigating the impacts of drought stress. This study aimed to determine the predominant mechanisms involved in drought tolerance and investigate the genetic control of associated traits with drought tolerance and higher grain yield. According to these aims, 10 half-diallel hybrids and their five parents were evaluated in both field and greenhouse lysimetric experiments under well-watered and water deficit stress conditions. The results indicated that the inheritance of grain yield is complex and affected by water deficit stress. Similar heritability and genetic architecture were detected for flowering time and percentages of photosynthate partitioned to grain (PPPG) in both well-watered and water deficit stress treatments. Significant negative genetic correlations were observed between grain yield and flowering time, root dry mass, root diameter, root volume, root number, percentages of photosynthate partitioned to shoot, and percentages of photosynthate partitioned to root. Therefore, the selection of low values of these attributes can be used to improve grain yield under drought conditions. In contrast, a positive significant genetic linkage between grain yield and PPPG, chlorophyll content, cell membrane stability, and leaf relative water content reveal selection for high values of these attributes is favored. These attributes could be used as surrogate selection criteria in the early segregating generations. The P1 parent (early ripening parent) contained key genes associated with PPPG and drought escape. It was concluded that improvement of drought tolerance and grain yield could be simultaneously achieved in anise breeding programs.

Real-time expression and in silico characterization of pea genes involved in salt and water-deficit stress.

BACKGROUND: To tolerate salt and water-deficit stress, the plant adapts to the adverse environment by regulating its metabolism and expressing certain stress-induced metabolic pathways. This research analyzed the relative expression of four pea genes (P5CR, PAL1, SOD, and POX) in three pea varieties (Climax, Green grass, and Meteor) under different levels of salt and water-deficit stress. METHODS AND RESULTS: The experiments on salt stress and water-deficit stress were carried out within greenhouse settings under controlled environment. The saturation percentage was employed to create artificial salinity conditions: Control without NaCl treatment, Treatment 1: 50 mM NaCl treatment, Treatment 2: 75 mM NaCl treatment, and Treatment 3: 100 mM NaCl treatment. Field capacity (FC) was used for the development of artificial water-deficit treatments in the pots, i.e., Treatment 1 (Control; water application 100% of FC), Treatment 2 (water application 75% of FC), and Treatment 3 (water application 50% of FC). Pea genes involved in biosynthetic pathways of proline, flavonoids, and enzymatic antioxidant enzymes including P5CR, PAL1, SOD, and POX were selected based on literature. Quantitative real-time PCR using cDNA as a template was used to analyze the gene expression. Pea genes were analyzed for phylogenetic analysis in closely related crops having similarity percent identity 80% and above. In silico characterization of selected proteins including the family classification was done by the NCBI CDD and INTERPRO online servers. Results from RT-qPCR analysis showed increased expression of P5CR, PAL1, and POX genes, while SOD gene expression decreased under both stresses. Climax exhibited superior stress tolerance with elevated expression of P5CR and PAL1, while Meteor showed better tolerance through increased POX expression. Phylogenetic analysis revealed common ancestry with other species like chickpea, red clover, mung bean, and barrel clover, suggesting the cross relationship among these plant species. Conserved domain analysis of respective proteins revealed that these proteins contain PLNO 2688, PLN02457, Cu-Zn Superoxide dismutase, and secretory peroxidase conserved domains. Furthermore, protein family classification indicated that the oxidation-reduction process is the most common chemical process involved in these stresses given to pea plant which validates the relationship of these proteins. CONCLUSIONS: Salt and water-deficit stresses trigger distinct metabolic pathways, leading to the up-regulation of specific genes and the synthesis of corresponding proteins. These findings further emphasize the conservation of stress-tolerance-related genes and proteins across various plant species. This knowledge enhances our understanding of plant adaptation to stress and offers opportunities for developing strategies to improve stress resilience in crops, thereby addressing global food security challenges.

Drought Stress Alleviator Melatonin Reconfigures Water-Stressed Barley (Hordeum vulgare L.) Plants' Photosynthetic Efficiency, Antioxidant Capacity, and Endogenous Phytohormone Profile.

The production of crops is severely limited by water scarcity. We still do not fully understand the underlying mechanism of exogenous melatonin (MT)-mediated water stress tolerance in barley. This study is the first of its kind to show how MT can potentially mitigate changes in barley's physio-biochemical parameters caused by water deficiency. Barley was grown under three irrigation levels (100%, 70%, and 30% of field capacity) and was foliar sprayed with 70 µM MT. The results showed that exogenously applied MT protected the photosynthetic apparatus by improving photosynthetic pigment content, photochemical reactions of photosynthesis, Calvin cycle enzyme activity, gas exchange capacity, chlorophyll fluorescence system, and membrane stability index. Furthermore, the increased levels of salicylic acid, gibberellins, cytokinins, melatonin, and indole-3-acetic acid, as well as a decrease in abscisic acid, indicated that foliar-applied MT greatly improved barley water stress tolerance. Additionally, by increasing the activity of antioxidant enzymes such as superoxide dismutase, catalase, ascorbate peroxidase, monodehydroascorbate reductase, dehydroascorbate reductase, and glutathione reductase and decreasing hydrogen peroxide content, lipid peroxidation, and electrolyte leakage, MT application lessened water stress-induced oxidative stress. According to the newly discovered data, MT application improves barley water stress tolerance by reprogramming endogenous plant hormone production and antioxidant activity, which enhances membrane stability and photosynthesis. This study unraveled MT's crucial role in water deficiency mitigation, which can thus be applied to water stress management.

Proteomic analysis of the meristematic root zone in contrasting genotypes reveals new insights in drought tolerance in rice.

Drought is responsible for major losses in rice production. Root tips contain meristematic and elongation zones that play major roles in determination of root traits and adaptive strategies to drought. In this study we analysed two contrasting genotypes of rice: IR64, a lowland, drought-susceptible, and shallow-rooting genotype; and Azucena, an upland, drought-tolerant, and deep-rooting genotype. Samples were collected of root tips of plants grown under control and water deficit stress conditions. Quantitative proteomics analysis resulted in the identification of 7294 proteins from the root tips of IR64 and 6307 proteins from Azucena. Data are available via ProteomeXchange with identifier PXD033343. Using a Partial Least Square Discriminant Analysis on 4170 differentially abundant proteins, 1138 statistically significant proteins across genotypes and conditions were detected. Twenty two enriched biological processes showing contrasting patterns between two genotypes in response to stress were detected through gene ontology enrichment analysis. This included identification of novel proteins involved in root elongation with specific expression patterns in Azucena, including four Expansins and seven Class III Peroxidases. We also detected an antioxidant network and a metallo-sulfur cluster assembly machinery in Azucena, with roles in reactive oxygen species and iron homeostasis, and positive effects on root cell cycle, growth and elongation.

Signaling Transduction of ABA, ROS, and Ca2+ in Plant Stomatal Closure in Response to Drought.

Drought is a global threat that affects agricultural production. Plants have evolved several adaptive strategies to cope with drought. Stomata are essential structures for plants to control water status and photosynthesis rate. Stomatal closure is an efficient way for plants to reduce water loss and improve survivability under drought conditions. The opening and closure of stomata depend on the turgor pressure in guard cells. Three key signaling molecules, including abscisic acid (ABA), reactive oxygen species (ROS), and calcium ion (Ca2+), play pivotal roles in controlling stomatal closure. Plants sense the water-deficit signal mainly via leaves and roots. On the one hand, ABA is actively synthesized in root and leaf vascular tissues and transported to guard cells. On the other hand, the roots sense the water-deficit signal and synthesize CLAVATA3/EMBRYO-SURROUNDING REGION RELATED 25 (CLE25) peptide, which is transported to the guard cells to promote ABA synthesis. ABA is perceived by pyrabactin resistance (PYR)/PYR1-like (PYL)/regulatory components of ABA receptor (RCAR) receptors, which inactivate PP2C, resulting in activating the protein kinases SnRK2s. Many proteins regulating stomatal closure are activated by SnRK2s via protein phosphorylation. ABA-activated SnRK2s promote apoplastic ROS production outside of guard cells and transportation into the guard cells. The apoplastic H2O2 can be directly sensed by a receptor kinase, HYDROGEN PEROXIDE-INDUCED CA2+ INCREASES1 (HPCA1), which induces activation of Ca2+ channels in the cytomembrane of guard cells, and triggers an increase in Ca2+ in the cytoplasm of guard cells, resulting in stomatal closure. In this review, we focused on discussing the signaling transduction of ABA, ROS, and Ca2+ in controlling stomatal closure in response to drought. Many critical genes are identified to have a function in stomatal closure under drought conditions. The identified genes in the process can serve as candidate genes for genetic engineering to improve drought resistance in crops. The review summarizes the recent advances and provides new insights into the signaling regulation of stomatal closure in response to water-deficit stress and new clues on the improvement of drought resistance in crops.

Isolation and characterization of drought and ABA responsive promoter of a transcription factor encoding gene from rice.

Water deficit is a significant impediment to enhancing rice yield. Genetic engineering tools have enabled agriculture researchers to develop drought-tolerant cultivars of rice. A common strategy to achieve this involves expressing drought-tolerant genes driven by constitutive promoters such as CaMV35S. However, the use of constitutive promoters is often limited by the adverse effects it has on the growth and development of the plant. Additionally, it has been observed that monocot-derived promoters are more successful in driving gene expression in monocots than in dicots. Substitution of constitutive promoters with stress-inducible promoters is the currently used strategy to overcome this limitation. In the present study, a 1514 bp AP2/ERF promoter that drives the expression of a transcription factor was cloned and characterized from drought-tolerant Indian rice genotype N22. The AP2/ERF promoter was fused to the GUS gene (uidA) and transformed in Arabidopsis and rice plants. Histochemical GUS staining of transgenic Arabidopsis plants showed AP2/ERF promoter activity in roots, stems, and leaves. Water deficit stress and ABA upregulate promoter activity in transformed Arabidopsis and rice. Quantitative PCR for uidA expression confirmed induced GUS activity in Arabidopsis and rice. This study showed that water deficit inducible Os-AP2/ERF-N22 promoter can be used to overcome the limitations of constitutive promoters. Transformants overexpressing Os-AP2/ERF-N22 showed higher relative water content, membrane stability index, total chlorophyll content, chlorophyll stability index, wax content, osmotic potential, stomatal conductance, transpiration rate, photosynthetic rate and radical scavenging activity. Drought tolerant (N22) showed higher expression of Os-AP2/ERF-N22 than the susceptible (MTU1010) cultivar. Supplementary Information: The online version contains supplementary material available at 10.1007/s12298-022-01246-9.

An improved extraction method enables the comprehensive analysis of lipids, proteins, metabolites and phytohormones from a single sample of leaf tissue under water-deficit stress.

Phytohormones play essential roles in the regulation of growth and development in plants. Plant hormone profiling is therefore essential to understand developmental processes and the adaptation of plants to biotic and/or abiotic stresses. Interestingly, commonly used hormone extraction and profiling methods do not adequately resolve other molecular entities, such as polar metabolites, lipids, starch and proteins, which would be required to comprehensively describe the continuing biological processes at a systematic level. In this article we introduce an updated version of a previously published liquid:liquid metabolite extraction protocol, which not only allows for the profiling of primary and secondary metabolites, lipids, starch and proteins, but also enables the quantitative analysis of the major plant hormone classes, including abscisic acid, auxins, cytokinins, jasmonates and salicylates, from a single sample aliquot. The optimization of the method, which uses the introduction of acidified water, enabling the complete purification of major plant hormones into the organic (methyl-tert-butyl-ether) phase, eliminated the need for solid-phase extraction for sample clean-up, and therefore reduces both sampling time and cost. As a proof-of-concept analysis, Arabidopsis thaliana plants were subjected to water-deficit stress, which were then profiled for hormonal, metabolic, lipidomic and proteomic changes. Surprisingly, we determined not only previously described molecular changes but also significant changes regarding the breakdown of specific galactolipids, followed by the substantial accumulation of unsaturated fatty-acid derivatives and diverse jasmonates in the course of adaptation to water-deficit stress.

Dynamic changes in cell wall composition of mature sunflower leaves under distinct water regimes affect photosynthesis.

In previous work, we identified that exposure to limited water availability induced changes in cell wall composition of mature Helianthus annuus L. leaves that affected mesophyll conductance to CO2 diffusion (gm). However, it is unclear on which timescale these changes in cell wall composition occurred. Here, we subjected H. annuus to control (i.e. water availability), different levels of short-term water deficit stress (ST), long-term water deficit stress (LT), and long-term water deficit stress followed by gradual recoveries addressed at different timescales (LT-Rec) to evaluate the dynamics of modifications in the main composition of cell wall (cellulose, hemicelluloses, pectins and lignins) affecting photosynthesis. During gradual ST treatments, pectins enhancement was associated with gm decline. However, during LT-Rec, pectins content decreased significantly after only 5 h, while hemicelluloses and lignins amounts changed after 24 h, all being uncoupled from gm. Surprisingly, lignins increased by around 200% compared with control and were related to stomatal conductance to gas diffusion (gs) during LT-Rec. Although we suspect that the accuracy of the protocols to determine cell wall composition should be re-evaluated, we demonstrate for the first time that a highly dynamic cell wall composition turnover differently affects photosynthesis in plants subjected to distinct water regimes.

EMS Derived Wheat Mutant BIG8-1 (Triticum aestivum L.)-A New Drought Tolerant Mutant Wheat Line.

Drought response in wheat is considered a highly complex process, since it is a multigenic trait; nevertheless, breeding programs are continuously searching for new wheat varieties with characteristics for drought tolerance. In a previous study, we demonstrated the effectiveness of a mutant known as RYNO3936 that could survive 14 days without water. In this study, we reveal another mutant known as BIG8-1 that can endure severe water deficit stress (21 days without water) with superior drought response characteristics. Phenotypically, the mutant plants had broader leaves, including a densely packed fibrous root architecture that was not visible in the WT parent plants. During mild (day 7) drought stress, the mutant could maintain its relative water content, chlorophyll content, maximum quantum yield of PSII (Fv/Fm) and stomatal conductance, with no phenotypic symptoms such as wilting or senescence despite a decrease in soil moisture content. It was only during moderate (day 14) and severe (day 21) water deficit stress that a decline in those variables was evident. Furthermore, the mutant plants also displayed a unique preservation of metabolic activity, which was confirmed by assessing the accumulation of free amino acids and increase of antioxidative enzymes (peroxidases and glutathione S-transferase). Proteome reshuffling was also observed, allowing slow degradation of essential proteins such as RuBisCO during water deficit stress. The LC-MS/MS data revealed a high abundance of proteins involved in energy and photosynthesis under well-watered conditions, particularly Serpin-Z2A and Z2B, SGT1 and Calnexin-like protein. However, after 21 days of water stress, the mutants expressed ABC transporter permeases and xylanase inhibitor protein, which are involved in the transport of amino acids and protecting cells, respectively. This study characterizes a new mutant BIG8-1 with drought-tolerant characteristics suited for breeding programs.

Tolerance mechanisms in maize identified through phenotyping and transcriptome analysis in response to water deficit stress.

Water deficit is a key limiting factor for maize (Zea mays L.) productivity. Elucidating the molecular regulatory networks of stress tolerance is crucial for genetic enhancement of drought tolerance. Two genotypes of maize contrasting in their yield response to water deficit were evaluated for tolerance traits of water relations, net CO2 assimilation rate, antioxidative metabolism and grain yield in relation to the expression levels, based on transcription profiling of genes involved in stress signaling, protein processing and energy metabolism to identify functional tolerance mechanisms. In the genotype SNJ201126 upregulation of calcium mediated signaling, plasma membrane and tonoplast intrinsic proteins and the membrane associated transporters contributed to better maintenance of water relations as evident from the higher relative water content and stomatal conductance at seedling and anthesis stages coupled with robust photosynthetic capacity and antioxidative metabolism. Further the protein folding machinery consisting of calnexin/calreticulin (CNX/CRT) cycle was significantly upregulated only in SNJ201126. While the down regulation of genes involved in photosystems and the enzymes of carbon fixation led to the relative susceptibility of genotype HKI161 in terms of reduced net CO2 assimilation rate, biomass and grain yield. Our results provide new insight into intrinsic functional mechanisms related to tolerance in maize. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s12298-021-01003-4.

Genetic components of root architecture and anatomy adjustments to water-deficit stress in spring barley.

Roots perform vital roles for adaptation and productivity under water-deficit stress, even though their specific functions are poorly understood. In this study, the genetic control of the nodal-root architectural and anatomical response to water deficit were investigated among diverse spring barley accessions. Water deficit induced substantial variations in the nodal root traits. The cortical, stele, and total root cross-sectional areas of the main-shoot nodal roots decreased under water deficit, but increased in the tiller nodal roots. Root xylem density and arrested nodal roots increased under water deficit, with the formation of root suberization/lignification and large cortical aerenchyma. Genome-wide association study implicated 11 QTL intervals in the architectural and anatomical nodal root response to water deficit. Among them, three and four QTL intervals had strong effects across seasons and on both root architectural and anatomical traits, respectively. Genome-wide epistasis analysis revealed 44 epistatically interacting SNP loci. Further analyses showed that these QTL intervals contain important candidate genes, including ZIFL2, MATE, and PPIB, whose functions are shown to be related to the root adaptive response to water deprivation in plants. These results give novel insight into the genetic architectures of barley nodal root response to soil water deficit stress in the fields, and thus offer useful resources for root-targeted marker-assisted selection.

Genetic control of root architectural plasticity in maize.

Root phenotypes regulate soil resource acquisition; however, their genetic control and phenotypic plasticity are poorly understood. We hypothesized that the responses of root architectural phenes to water deficit (stress plasticity) and different environments (environmental plasticity) are under genetic control and that these loci are distinct. Root architectural phenes were phenotyped in the field using a large maize association panel with and without water deficit stress for three seasons in Arizona and without water deficit stress for four seasons in South Africa. All root phenes were plastic and varied in their plastic response. We identified candidate genes associated with stress and environmental plasticity and candidate genes associated with phenes in well-watered conditions in South Africa and in well-watered and water-stress conditions in Arizona. Few candidate genes for plasticity overlapped with those for phenes expressed under each condition. Our results suggest that phenotypic plasticity is highly quantitative, and plasticity loci are distinct from loci that control phene expression in stress and non-stress, which poses a challenge for breeding programs. To make these loci more accessible to the wider research community, we developed a public online resource that will allow for further experimental validation towards understanding the genetic control underlying phenotypic plasticity.