Structural basis of amine odorant perception by a mammal olfactory receptor.

Odorants are detected as smell in the nasal epithelium of mammals by two G-protein-coupled receptor families, the odorant receptors and the trace amine-associated receptors1,2 (TAARs). TAARs emerged following the divergence of jawed and jawless fish, and comprise a large monophyletic family of receptors that recognize volatile amine odorants to elicit both intraspecific and interspecific innate behaviours such as attraction and aversion3-5. Here we report cryo-electron microscopy structures of mouse TAAR9 (mTAAR9) and mTAAR9-Gs or mTAAR9-Golf trimers in complex with ß-phenylethylamine, N,N-dimethylcyclohexylamine or spermidine. The mTAAR9 structures contain a deep and tight ligand-binding pocket decorated with a conserved D3.32W6.48Y7.43 motif, which is essential for amine odorant recognition. In the mTAAR9 structure, a unique disulfide bond connecting the N terminus to ECL2 is required for agonist-induced receptor activation. We identify key structural motifs of TAAR family members for detecting monoamines and polyamines and the shared sequence of different TAAR members that are responsible for recognition of the same odour chemical. We elucidate the molecular basis of mTAAR9 coupling to Gs and Golf by structural characterization and mutational analysis. Collectively, our results provide a structural basis for odorant detection, receptor activation and Golf coupling of an amine olfactory receptor.

Structure of mitotic chromosomes.

Chromatin fibers must fold or coil in the process of chromosome condensation. Patterns of coiling have been demonstrated for reconstituted chromatin, but the actual trajectories of fibers in condensed states of chromosomes could not be visualized because of the high density of the material. We have exploited partial decondensation of mitotic chromosomes to reveal their internal structure at sub-nucleosomal resolution by cryo-electron tomography, without the use of stains, fixatives, milling, or sectioning. DNA gyres around nucleosomes were visible, allowing the nucleosomes to be identified and their orientations to be determined. Linker DNA regions were traced, revealing the trajectories of the chromatin fibers. The trajectories were irregular, with almost no evidence of coiling and no short- or long-range order of the chromosomal material. The 146-bp core particle, long known as a product of nuclease digestion, is identified as the native state of the nucleosome, with no regular spacing along the chromatin fibers.

Sphingomonas cremea sp. nov., isolated from ginseng soil.

A novel Gram-stain-negative, aerobic, rod-shaped, non-motile, cream-coloured strain (G124T) was isolated from ginseng soil collected in Yeongju, Republic of Korea. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain G124T belongs to a distinct lineage within the genus Sphingomonas (family Sphingomonadaceae, order Sphingomonadales and class Alphaproteobacteria). Strain G124T was closely related to Sphingomonas rhizophila THG-T61T (98.5 % 16S rRNA gene sequence similarity), Sphingomonas mesophila SYSUP0001T (98.3 %), Sphingomonas edaphi DAC4T (97.6 %) and Sphingomonas jaspsi TDMA-16T (97.6 %). The strain contained ubiquinone 10 as the major respiratory quinone. The major polar lipid profile of strain G124T comprised phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylglycerol, phosphatidylcholine and sphingoglycolipids. The predominant cellular fatty acids of strain G124T were summed feature 8 (C18 : 1 ω7c/C18 : 1 ω6c; 33.4 %), summed feature 3 (C16 : 1 ω6c/C16 : 1 ω7c; 27.2 %) and C16 : 0 (18.3 %). The genome size of strain G124T was 2 549 305 bp. The genomic DNA G+C content is 62.0 mol%. The average nucleotide identity and digital DNA-DNA hybridization values between strain G124T and other Sphingomonas species were in the range of 71.2-75.9 % and 18.7-19.9 %, respectively. Based on the polyphasic analysis such as biochemical, phylogenetic and chemotaxonomic characteristics, strain G124T represents a novel species of the genus Sphingomonas, for which the name Sphingomonas cremea sp. nov. is proposed. The type strain is G124T (=KACC 21691T=LMG 31729T).

Characterization of four novel bacterial species of the genus Sphingomonas, Sphingomonas anseongensis, Sphingomonas alba, Sphingomonas brevis and Sphingomonas hankyongi sp.nov., isolated from wet land.

Four novel bacterial strains, designated as RG327T, SE158T, RB56-2T and SE220T, were isolated from wet soil in the Republic of Korea. To determine their taxonomic positions, the strains were fully characterized. On the basis of genomic information (16S rRNA gene and draft genome sequences), all four isolates represent members of the genus Sphingomonas. The draft genomes of RG327T, SE158T, RB56-2T and SE220T consisted of circular chromosomes of 2 226 119, 2 507 338, 2 593 639 and 2 548 888 base pairs with DNA G+C contents of 64.6, 63.6, 63.0 and 63.1 %, respectively. All the isolates contained ubiquinone Q-10 as the predominant quinone compound and a fatty acid profile with C16 : 0, C17 : 1ω6c, C18 : 1 2-OH, summed feature 3 (C16 : 1ω7c/C16 : 1ω6c) and summed feature 8 (C18 : 1ω7c/C18 : 1ω6c) as the major fatty acids, supporting the affiliation of strains RG327T, SE158T, RB56-2T and SE220T to the genus Sphingomonas. The major identified polar lipids in all four novel isolates were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine, sphingoglycolipid and phosphatidylcholine. Moreover, the physiological, biochemical results and low level of DNA-DNA relatedness and average nucleotide identity values allowed the phenotypic and genotypic differentiation of RG327T, SE158T, RB56-2T and SE220T from other species of the genus Sphingomonas with validly published names and indicated that they represented novel species of the genus Sphingomonas, for which the names Sphingomonas anseongensis sp. nov. (RG327T = KACC 22409T = LMG 32497T), Sphingomonas alba sp. nov. (SE158T = KACC 224408T = LMG 324498T), Sphingomonas brevis (RB56-2T = KACC 22410T = LMG 32496T) and Sphingomonas hankyongi sp. nov., (SE220T = KACC 22406T = LMG 32499T) are proposed.

Structural Analysis of Spermidine Synthase from Kluyveromyces lactis.

Spermidine is a polyamine molecule that performs various cellular functions, such as DNA and RNA stabilization, autophagy modulation, and eIF5A formation, and is generated from putrescine by aminopropyltransferase spermidine synthase (SpdS). During synthesis, the aminopropyl moiety is donated from decarboxylated S-adenosylmethionine to form putrescine, with 5'-deoxy-5'-methylthioadenosine being produced as a byproduct. Although the molecular mechanism of SpdS function has been well-established, its structure-based evolutionary relationships remain to be fully understood. Moreover, only a few structural studies have been conducted on SpdS from fungal species. Here, we determined the crystal structure of an apo-form of SpdS from Kluyveromyces lactis (KlSpdS) at 1.9 Å resolution. Structural comparison with its homologs revealed a conformational change in the α6 helix linked to the gate-keeping loop, with approximately 40° outward rotation. This change caused the catalytic residue Asp170 to move outward, possibly due to the absence of a ligand in the active site. These findings improve our understanding of the structural diversity of SpdS and provide a missing link that expands our knowledge of the structural features of SpdS in fungal species.

Fine-tuning spermidine binding modes in the putrescine binding protein PotF.

A profound understanding of the molecular interactions between receptors and ligands is important throughout diverse research, such as protein design, drug discovery, or neuroscience. What determines specificity and how do proteins discriminate against similar ligands? In this study, we analyzed factors that determine binding in two homologs belonging to the well-known superfamily of periplasmic binding proteins, PotF and PotD. Building on a previously designed construct, modes of polyamine binding were swapped. This change of specificity was approached by analyzing local differences in the binding pocket as well as overall conformational changes in the protein. Throughout the study, protein variants were generated and characterized structurally and thermodynamically, leading to a specificity swap and improvement in affinity. This dataset not only enriches our knowledge applicable to rational protein design but also our results can further lay groundwork for engineering of specific biosensors as well as help to explain the adaptability of pathogenic bacteria.

Revisiting T7 RNA polymerase transcription in vitro with the Broccoli RNA aptamer as a simplified real-time fluorescent reporter.

Methods for rapid and high-throughput screening of transcription in vitro to examine reaction conditions, enzyme mutants, promoter variants, and small molecule modulators can be extremely valuable tools. However, these techniques may be difficult to establish or inaccessible to many researchers. To develop a straightforward and cost-effective platform for assessing transcription in vitro, we used the "Broccoli" RNA aptamer as a direct, real-time fluorescent transcript readout. To demonstrate the utility of our approach, we screened the effect of common reaction conditions and components on bacteriophage T7 RNA polymerase (RNAP) activity using a common quantitative PCR instrument for fluorescence detection. Several essential conditions for in vitro transcription by T7 RNAP were confirmed with this assay, including the importance of enzyme and substrate concentrations, covariation of magnesium and nucleoside triphosphates, and the effects of several typical additives. When we used this method to assess all possible point mutants of a canonical T7 RNAP promoter, our results coincided well with previous reports. This approach should translate well to a broad variety of bacteriophage in vitro transcription systems and provides a platform for developing fluorescence-based readouts of more complex transcription systems in vitro.

The minimal gap-junction network among melanophores and xanthophores required for stripe pattern formation in zebrafish.

Connexin 39.4 (Cx39.4) and connexin 41.8 (Cx41.8), two gap-junction proteins expressed in both melanophores and xanthophores, are crucial for the intercellular communication among pigment cells that is necessary for generating the stripe pigment pattern of zebrafish. We have previously characterized the gap-junction properties of Cx39.4 and Cx41.8, but how these proteins contribute to stripe formation remains unclear; this is because distinct types of connexins potentially form heteromeric gap junctions, which precludes accurate elucidation of individual connexin functions in vivo Here, by arranging Cx39.4 and Cx41.8 expression in pigment cells, we have identified the simplest gap-junction network required for stripe generation: Cx39.4 expression in melanophores is required but expression in xanthophores is not necessary for stripe patterning, whereas Cx41.8 expression in xanthophores is sufficient for the patterning, and Cx41.8 expression in melanophores might stabilize the stripes. Moreover, patch-clamp recordings revealed that Cx39.4 gap junctions exhibit spermidine-dependent rectification property. Our results suggest that Cx39.4 facilitates the crucial cell-cell interactions between melanophores and xanthophores that mediate a unidirectional activation-signal transfer from xanthophores to melanophores, which is essential for melanophore survival.

First Fluorescent Acetylspermidine Deacetylation Assay for HDAC10 Identifies Selective Inhibitors with Cellular Target Engagement.

Histone deacetylases (HDACs) are important epigenetic regulators involved in many diseases, especially cancer. Five HDAC inhibitors have been approved for anticancer therapy and many are in clinical trials. Among the 11 zinc-dependent HDACs, HDAC10 has received relatively little attention by drug discovery campaigns, despite its involvement, e. g., in the pathogenesis of neuroblastoma. This is due in part to a lack of robust enzymatic conversion assays. In contrast to the protein lysine deacetylase and deacylase activity of most other HDAC subtypes, it has recently been shown that HDAC10 has strong preferences for deacetylation of oligoamine substrates like acetyl-putrescine or -spermidine. Hence, it is also termed a polyamine deacetylase (PDAC). Here, we present the first fluorescent enzymatic conversion assay for HDAC10 using an aminocoumarin-labelled acetyl-spermidine derivative to measure its PDAC activity, which is suitable for high-throughput screening. Using this assay, we identified potent inhibitors of HDAC10-mediated spermidine deacetylation in vitro. Based on the oligoamine preference of HDAC10, we also designed inhibitors with a basic moiety in appropriate distance to the zinc binding hydroxamate that showed potent inhibition of HDAC10 with high selectivity, and we solved a HDAC10-inhibitor structure using X-ray crystallography. We could demonstrate selective cellular target engagement for HDAC10 but a lysosomal phenotype in neuroblastoma cells that was previously associated with HDAC10 inhibition was not observed. Thus, we have developed new chemical probes for HDAC10 that allow further clarification of the biological role of this enzyme.

Nucleosome destabilization by polyamines.

The roles and molecular interactions of polyamines (PAs) in the nucleus are not fully understood. Here their effect on nucleosome stability, a key regulatory factor in eukaryotic gene control, is reported, as measured in agarose embedded nuclei of H2B-GFP expressor HeLa cells. Nucleosome stability was assessed by quantitative microscopy [1,2] in situ, in close to native state of chromatin, preserving the nucleosome constrained topology of the genomic DNA. A robust destabilizing effect was observed in the millimolar concentration range in the case of spermine, spermidine as well as putrescine, which was strongly pH and salt concentration-dependent, and remained significant also at neutral pH. The integrity of genomic DNA was not affected by PA treatment, excluding DNA break-elicited topological relaxation as a factor in destabilization. The binding of PAs to DNA was demonstrated by the displacement of ethidium bromide, both from deproteinized nuclear halos and from plasmid DNA. The possibility that DNA methylation patterns may be influenced by PA levels is contemplated in the context of gene expression and DNA methylation correlations identified in the NCI-60 panel-based CellMiner database: methylated loci in subsets of high-ODC1 cell lines and the dependence of PER3 DNA methylation on PA metabolism.

Sphingomonas psychrotolerans sp. nov., isolated from root surface of Leontopodium leontopodioides in the Tianshan Mountains, Xinjiang, China.

A novel rod-shaped, Gram-stain-negative, aerobic bacterial strain, designated Cra20T, was isolated from the root surface of Leontopodium leontopodioides collected in the Tianshan Mountains, Xinjiang, PR China. Phylogenetic analysis based on 16S rRNA gene sequences, indicated that strain Cra20T was affiliated with the genus Sphingomonas, and was most closely related to Sphingomonas gei ZFGT-11T (99.0 %), Sphingomonas naasensis KIS18-15T (97.8%) and Sphingomonas kyeonggiensis THG-DT81T (97.2 %). The average nucleotide identity values between strain Cra20T, S. gei ZFGT-11T, S. naasensis KIS18-15T and S. kyeonggiensis THG-DT81T were 86.2, 84.2 and 78.2 %, respectively. The genomic DNA G+C content of strain Cra20T was 65.6 mol% (whole genome sequence), and Q-10 was the predominant ubiquinone. The major cellular fatty acids of strain Cra20T were summed feature 8 (comprising C18 : 1 ω6c and/or C18 : 1 ω7c, 67.3 %) and C14 : 0 2-OH (6.4 %). On the basis of genotypic, phenotypic and biochemical data, strain Cra20T is considered to represent a novel species of the genus Sphingomonas, for which the name Sphingomonas psychrotolerans sp. nov. is proposed. The type strain is Cra20T (=CGMCC 1.15510T=NBRC 112697T).

Sphingomonas cannabina sp. nov., isolated from Cannabis sativa L. 'Cheungsam'.

A Gram-negative, aerobic, rod-shaped bacterium, designated DM2-R-LB4T was isolated from Cannabis sativa L. 'Cheungsam' in Andong, Republic of Korea. The strain DM2-R-LB4T grew at temperatures of 15-45 °C (optimum, 30-37 °C), pH of 5.5-9 (optimum, 8.0), and 0-2 % (w/v) NaCl concentration (optimum, 0%). Phylogenetic analyses based on the 16S rRNA gene sequences revealed that strain DM2-R-LB4T is related to species of the genus Sphingomonas, and shared 97.8 and 97.5% similarity to Sphingomonas kyenggiensis KCTC 42244T and Sphingomonas leidyi DSM 4733T, respectively. The DNA G+C content was 67.9 mol% and genome analysis of the strain DM2-R-LB4T revealed that the genome size was 4 386 171 bp and contained 4 009 predicted protein-coding genes. The average nucleotide identity (ANI) values between strain DM2-R-LB4T and S. kyenggiensis KCTC 42244T, and S. leidyi DSM 4733T was 76.8 and 76.7 %, respectively, while the values of digital DNA-DNA hybridization (dDDH) were 20.7 and 20.6 %, respectively. C14 : 0 2-OH, C16 : 0, and summed feature 8 (C18 : 1 ω6c and/or C18 : 1 ω7c) were the major fatty acids (>10 %) in the strain DM2-R-LB4T. The polar lipids comprised diphosphatidylglycerol (DPG), phosphatidylethanolamine (PE), phosphatidylglycerol (PG), phosphatidylcholine (PC), sphingoglycolipid (SGL), glycolipid (GL), phospholipid (PL), and two unidentified polar lipids (L1 and L2). Ubiquinone-10 (Q-10) was the only respiratory quinone. The polyamine pattern was found to contain homospermidine, putrescine, and spermidine. The results of phylogenetic anlayses, polyphasic studies, revealed that strain DM2-R-LB4T represents a novel species of the genus Sphingomonas, for which the name Sphingomonas cannabina sp. nov., is proposed. The type strain is DM2-R-LB4T (=KCTC 92075T = GDMCC 1.3018T).

Role of Polyamine-Induced Dimerization of Antizyme in Its Cellular Functions.

The polyamines, spermine (Spm) and spermidine (Spd), are important for cell growth and function. Their homeostasis is strictly controlled, and a key downregulator of the polyamine pool is the polyamine-inducible protein, antizyme 1 (OAZ1). OAZ1 inhibits polyamine uptake and targets ornithine decarboxylase (ODC), the rate-limiting enzyme of polyamine biosynthesis, for proteasomal degradation. Here we report, for the first time, that polyamines induce dimerization of mouse recombinant full-length OAZ1, forming an (OAZ1)2-Polyamine complex. Dimerization could be modulated by functionally active C-methylated spermidine mimetics (MeSpds) by changing the position of the methyl group along the Spd backbone-2-MeSpd was a poor inducer as opposed to 1-MeSpd, 3-MeSpd, and Spd, which were good inducers. Importantly, the ability of compounds to inhibit polyamine uptake correlated with the efficiency of the (OAZ1)2-Polyamine complex formation. Thus, the (OAZ1)2-Polyamine complex may be needed to inhibit polyamine uptake. The efficiency of polyamine-induced ribosomal +1 frameshifting of OAZ1 mRNA could also be differentially modulated by MeSpds-2-MeSpd was a poor inducer of OAZ1 biosynthesis and hence a poor downregulator of ODC activity unlike the other MeSpds. These findings offer new insight into the OAZ1-mediated regulation of polyamine homeostasis and provide the chemical tools to study it.

Self-Assembled Particles Combining SARS-CoV-2 RBD Protein and RBD DNA Vaccine Induce Synergistic Enhancement of the Humoral Response in Mice.

Despite the fact that a range of vaccines against COVID-19 have already been created and are used for mass vaccination, the development of effective, safe, technological, and affordable vaccines continues. We have designed a vaccine that combines the recombinant protein and DNA vaccine approaches in a self-assembled particle. The receptor-binding domain (RBD) of the spike protein of SARS-CoV-2 was conjugated to polyglucin:spermidine and mixed with DNA vaccine (pVAXrbd), which led to the formation of particles of combined coronavirus vaccine (CCV-RBD) that contain the DNA vaccine inside and RBD protein on the surface. CCV-RBD particles were characterized with gel filtration, electron microscopy, and biolayer interferometry. To investigate the immunogenicity of the combined vaccine and its components, mice were immunized with the DNA vaccine pVAXrbd or RBD protein as well as CCV-RBD particles. The highest antigen-specific IgG and neutralizing activity were induced by CCV-RBD, and the level of antibodies induced by DNA or RBD alone was significantly lower. The cellular immune response was detected only in the case of DNA or CCV-RBD vaccination. These results demonstrate that a combination of DNA vaccine and RBD protein in one construct synergistically increases the humoral response to RBD protein in mice.

X-ray Crystallographic Snapshots of Substrate Binding in the Active Site of Histone Deacetylase 10.

Histone deacetylase 10 (HDAC10) is a zinc-dependent polyamine deacetylase enriched in the cytosol of eukaryotic cells. The active site of HDAC10 contains catalytic residues conserved in other HDAC isozymes that function as lysine deacetylases: Y307 assists the zinc ion in polarizing the substrate carbonyl for nucleophilic attack, and the H136-H137 dyad serves general base-general acid functions. As an inducer of autophagy, HDAC10 is an attractive target for the design of selective inhibitors that may be useful in cancer chemotherapy. Because detailed structural information regarding the catalytic mechanism of HDAC10 may inform new approaches to inhibitor design, we now report X-ray crystal structures of HDAC10 in which reaction intermediates with substrates N8-acetylspermidine and N-acetylputrescine are trapped in the active site. The Y307F substitution prevents activation of the substrate carbonyl for nucleophilic attack by the zinc-bound water molecule, thereby enabling crystallographic isolation of intact enzyme-substrate complexes. The H137A substitution removes the catalytically obligatory general acid, thereby enabling crystallographic isolation of oxyanionic tetrahedral intermediates. Finally, the acetate complex with the wild-type enzyme represents a product complex after dissociation of the polyamine coproduct. Taken together, these structures provide snapshots of the reaction coordinate of acetylpolyamine hydrolysis and are consistent with a mechanism in which tandem histidine residues H136 and H137 serve as general base and general acid catalysts, respectively. The function of the histidine dyad in the HDAC10 mechanism appears to be similar to that in HDAC6, but not HDAC8 in which both functions are served by the second histidine of the tandem pair.

Sphingosinicella flava sp. nov., indole acetic acid producing bacteria isolated from maize field soil.

A novel isolated yellow-pigmented bacterial designated strain UDD2T was isolated from a maize field soil sample collected in Ilsan, Republic of Korea. Cells of strain UDD2T were Gram-stain-negative, non-sporulating, long rod-shaped and exhibited flagellar motility. Cells could grow at 15-42 °C and pH 5.5-11.0. Strain UDD2T was sensitive to NaCl and barely tolerated up to 1 % NaCl (w/v). Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain UDD2T formed a separate clade with the members of genus Sphingosinicella within the family Sphingomonadaceae. Strain UDD2T showed the highest 16S rRNA gene sequence similarity to Sphingosinicella vermicomposti KCTC 224446T (98.5 %) and Sphingosinicella humi KCTC 62519T (96.7 %), followed by members of the genus Sphingomonas (96.4-94.5 %) and Sphingobium (96.1-94.9 %), but they were located in other phylogenetic clusters. Average nucleotide identity and digital DNA-DNA hybridization values between strain UDD2T and S. vermicomposti KCTC 224446T and S. humi KCTC 62519T were 80.2/24.2 and 75.6/20.4 %, respectively. The total size of the genome was 2 421 697 bp and composed of one circular chromosome, with a G+C content of 63.7 mol%. Strain UDD2T produced indole acetic acid (IAA) in the presence of l-tryptophan. Bacterial IAA is a crucial phytohormone in plant growth and development. Gene clusters for indole-3-glycerol phosphate synthase and tryptophan synthase were found in the genome of strain UDD2T. To the best of our knowledge, no member of the genus Sphingosinicella has been reported to produce IAA to date. The major cellular fatty acids (>10 %) were found to be C16 : 0, C14 : 0 2OH and summed feature 3 (comprising C16  : 1 ω7c and/or iso-C15  :  0 2-OH). Strain UDD2T had ubiquinone Q-10 as the major respiratory quinone and homospermidine as the major polyamine. The polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, sphingoglycolipid, phosphatidylglycerol, phosphatidylcholine, three unidentified phosphoglycolipids, one unidentified phospholipid, one unidentified aminoglycophospholipid, one unidentified glycolipid and one unidentified polar lipid. Based on the phylogenetic, phenotypic, chemotaxonomic and genotypic data, strain UDD2T represents a novel species of the genus Sphingosinicella, for which the name Sphingosinicella flava is proposed. The type strain is UDD2T (=KCTC 82357T=NBRC 114507T).

Aeromicrobium terrae sp. nov., isolated from a maize field.

A polyphasic taxonomic approach was used to characterize a Gram-stain-positive bacterium, designated strain CC-CFT486T, isolated from soil sampled in a maize field in Taiwan. Cells of strain CC-CFT486T were short rods, motile with polar flagella, catalase-positive and oxidase-positive. Optimal growth occurred at 30 °Ð¡, pH 8 and 1 % NaCl. Phylogenetic analyses based on 16S rRNA genes revealed a distinct taxonomic position attained by strain CC-CFT486T associated with Aeromicrobium panacisoli (97.0 % sequence identity), Aeromicrobium lacus (97.0 %), Aeromicrobium erythreum (96.8 %) and Aeromicrobium alkaliterrae (96.8 %), and lower sequence similarity values to other species. Average nucleotide identity (ANI) values were 70.6-77.8 % (n=11) compared within the type strains of the genus Aeromicrobium. Strain CC-CFT486T contained C16 : 0, C17 : 0, C17 : 1 ω8c and C18 : 1 ω9c as the predominant fatty acids. The polar lipid profile consisted of diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, two unidentified aminophospholipids and three unknown phospholipids. The cell wall peptidoglycan of strains CC-CFT486T contained ll-diaminopimelic acid (ll-DAP) and the major polyamine was spermidine. The DNA G+C content was 70.6 mol% and the predominant quinone was menaquinone 9 (MK-9). Based on its distinct phylogenetic, phenotypic and chemotaxonomic traits together with results of comparative 16S rRNA gene sequence and ANI analyses, strain CC-CFT486T is proposed to represent a novel Aeromicrobium species, for which the name Aeromicrobium terrae sp. nov. (type strain CC-CFT486T=BCRC 81217T=JCM 33499T).

Vineibacter terrae gen. nov., sp. nov., an ammonium-assimilating and nitrate-reducing bacterium isolated from vineyard soil.

A polyphasic taxonomic approach was used to characterize a Gram-stain-negative bacterium, designated strain CC-CFT640T, isolated from vineyard soil sampled in Taiwan. Cells of strain CC-CFT640T were aerobic, non-motile, nitrate-reducing rods. Test results were positive for catalase, oxidase and proteinase activities. Optimal growth occurred at 30 °Ð¡ and pH 7. Strain CC-CFT640T showed highest 16S rRNA gene sequence similarity to members of the genus Enhydrobacter (90.0 %, n=1) followed by Hypericibacter (89.4-90.0 %, n=2), Reyranella (88.8-89.8 %, n=5) and Nitrospirillum (89.2-89.4 %, n=2), and formed a distinct phyletic lineage distantly associated with the clade that predominately accommodated Reynerella species. The DNA G+C composition of the genome (2.1 Mb) was 67.9 mol%. Genes involved in the reduction of nitrate to nitrite, nitric oxide and nitrous oxide were found. In addition, genes encoding dissimilatory nitrate reduction to ammonia, ammonium transport and ammonium assimilation were also detected. Average nucleotide identity values were 73.3 % (n=1), 74.0-74.6 % (n=2), 67.5-68.3 % (n=2) when compared within the type strains of the genera Enhydrobacter, Reyranella and Niveispirillum, respectively. The dominant cellular fatty acids (>5 %) included C16 : 0, iso-C17 : 1 ω10c, C19 : 0 cyclo ω8c, C18 : 1 2-OH and C18 : 1 ω7c/C18 : 1 ω6c. The polar lipid profile consisted of diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, three unidentified aminolipids, three unidentified phospholipids and an unidentified aminophospholipid. The major respiratory quinone was ubiquinone 10 and the major polyamine was spermidine. Based on its distinct phylogenetic, phenotypic and chemotaxonomic traits together with results of comparative 16S rRNA gene sequencing, digital DNA-DNA hybridization, average nucleotide identity and phylogenomic placement, strain CC-CFT640T is considered to represent a novel genus and species of the family Rhodospirillaceae, for which the name Vineibacter terrae gen. nov., sp. nov. is proposed. The type strain is CC-CFT640T (=BCRC 81219T=JCM 33507T).

Specific adsorption of trivalent cations in biological nanopores determines conductance dynamics and reverses ionic selectivity.

Adsorption processes are central to ionic transport in industrial and biological membrane systems. Multivalent cations modulate the conductive properties of nanofluidic devices through interactions with charged surfaces that depend principally on the ion charge number. Considering that ion channels are specialized valves that demand a sharp specificity in ion discrimination, we investigate the adsorption dynamics of trace amounts of different salts of trivalent cations in biological nanopores. We consider here OmpF from Escherichia coli, an archetypical protein nanopore, to probe the specificity of biological nanopores to multivalent cations. We systematically compare the effect of three trivalent electrolytes on OmpF current-voltage relationships and characterize the degree of rectification induced by each ion. We also analyze the open channel current noise to determine the existence of equilibrium/non-equilibrium mechanisms of ion adsorption and evaluate the extent of charge inversion through selectivity measurements. We show that the interaction of trivalent electrolytes with biological nanopores occurs via ion-specific adsorption yielding differential modulation of ion conduction and selectivity inversion. We also demonstrate the existence of non-equilibrium fluctuations likely related to ion-dependent trapping-detrapping processes. Our study provides fundamental information relevant to different biological and electrochemical systems where transport phenomena involve ion adsorption in charged surfaces under nanoscale confinement.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.