Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

First report of tomato chlorotic dwarf viroid infecting litchi tomato (Solanum sisymbriifolium).

Litchi tomato (LT) (Solanum sisymbriifolium) is a solanaceous weed that is considered a biological control tool to manage potato cyst nematode (PCN) in Europe and is being explored for use in Idaho. Two Several LT lines were clonally maintained as stocks in the university greenhouse since 2013 and were also established in tissue culture at the same time. In 2018, tomato (Solanum lycopersicum cv. Alisa Craig) scions were grafted onto two LT rootstocks originating either from healthy-looking greenhouse stocks or from tissue culture-maintained plants. Unexpectedly, tomatoes grafted onto the greenhouse-maintained rootstocks of LT displayed severe symptoms of stunting, foliar deformation, and chlorosis, while grafts onto the same LT lines from tissue culture produced healthy-looking tomato plants. Tests for the presence of several viruses known to infect solanaceous plants were conducted on symptomatic tomato scion tissues using ImmunoStrips (Agdia, Elkhard, IN) and RT-PCR (Elwan et al. 2017) but yielded negative results. High throughput sequencing (HTS) was then used to identify possible pathogens that could have been responsible for the symptoms observed in tomato scions. Samples from two symptomatic tomato scions, two asymptomatic scions grafted onto the tissue culture-derived plants, and two greenhouse-maintained rootstocks were subjected to HTS. Total RNA from the four tomato and two LT samples was depleted of ribosomal RNA and subjected to HTS on an Illumina MiSeq platform producing 300-bp paired-end reads and raw reads were adapter and quality cleaned. For the tomato samples, the clean reads were mapped against the S. lycopersicum L. reference genome, and unmapped paired reads were assembled producing between 4,368 and 8,645 contigs. For the LT samples, all clean reads were directly assembled, producing 13,982 and 18,595 contigs. In the symptomatic tomato scions and the two LT rootstock samples, a 487-nt contig was found, comprising an ~1.35 tomato chlorotic dwarf viroid (TCDVd) genome and exhibiting 99.7% identity with it (GenBank accession AF162131; Singh et al. 1999). No other virus-related or viroid contigs were identified. RT-PCR analysis using a pospiviroid primer set Pospi1-FW/RE (Verhoeven et al. 2004), and a TCDVd-specific primer set TCDVd-Fw/TCDVd-Rev (Olmedo-Velarde et al. 2019) produced 198-nt and 218-nt bands, respectively, thus confirming the presence of TCDVd in tomato and LT samples. These PCR products were Sanger sequenced and confirmed to be TCDVd-specific; the complete sequence of the Idaho isolate of TCDVd was deposited in GenBank under the accession number OQ679776. Presence of TCDVd in LT plant tissue was confirmed by the APHIS PPQ Laboratory in Laurel, MD. Asymptomatic tomatoes and LT plants from tissue culture were found negative for TCDVd. Previously, TCDVd was reported to affect greenhouse tomatoes in Arizona and Hawaii (Ling et al. et al. 2009; Olmedo-Velarde et al. 2019), however, this is the first report of TCDVd infecting litchi tomato (S. sisymbriifolium). Five additional greenhouse-maintained LT lines were found TCDVd-positive using RT-PCR and Sanger sequencing. Given the very mild or asymptomatic infection of TCDVd in this host, molecular diagnostic methods should be used to screen LT lines for the presence of this viroid to avoid inadvertent spread of TCDVd. Another viroid, potato spindle tuber viroid, was reported to be transmitted through LT seed (Fowkes et al. 2021), and transmission of TCDVd through LT seed may also be responsible for this TCDVd outbreak in the university greenhouse, although no direct evidence was collected. To the best of our knowledge, this is the first report of TCDVd infection in S. sisymbriifolium and also the first report of the TCDVd occurrence in Idaho.

A Case of Gene Fragmentation in Plant Mitochondria Fixed by the Selection of a Compensatory Restorer of Fertility-Like PPR Gene.

The high mutational load of mitochondrial genomes combined with their uniparental inheritance and high polyploidy favors the maintenance of deleterious mutations within populations. How cells compose and adapt to the accumulation of disadvantageous mitochondrial alleles remains unclear. Most harmful changes are likely corrected by purifying selection, however, the intimate collaboration between mitochondria- and nuclear-encoded gene products offers theoretical potential for compensatory adaptive changes. In plants, cytoplasmic male sterilities are known examples of nucleo-mitochondrial coadaptation situations in which nuclear-encoded restorer of fertility (Rf) genes evolve to counteract the effect of mitochondria-encoded cytoplasmic male sterility (CMS) genes and restore fertility. Most cloned Rfs belong to a small monophyletic group, comprising 26 pentatricopeptide repeat genes in Arabidopsis, called Rf-like (RFL). In this analysis, we explored the functional diversity of RFL genes in Arabidopsis and found that the RFL8 gene is not related to CMS suppression but essential for plant embryo development. In vitro-rescued rfl8 plantlets are deficient in the production of the mitochondrial heme-lyase complex. A complete ensemble of molecular and genetic analyses allowed us to demonstrate that the RFL8 gene has been selected to permit the translation of the mitochondrial ccmFN2 gene encoding a heme-lyase complex subunit which derives from the split of the ccmFN gene, specifically in Brassicaceae plants. This study represents thus a clear case of nuclear compensation to a lineage-specific mitochondrial genomic rearrangement in plants and demonstrates that RFL genes can be selected in response to other mitochondrial deviancies than CMS suppression.

A new picorna-like virus identified in populations of the potato psyllid Bactericera cockerelli.

The potato/tomato psyllid Bactericera cockerelli (Hemiptera: Triozidae) is a pest of Solanaceae plants and a vector of the pathogenic bacterium 'Candidatus Liberibacter solanacearum', which is associated with zebra chip disease in potato. This disease is controlled through insecticide treatments, and more environmentally friendly management options are desirable. The objective of this study was to identify viruses present in potato psyllid populations that might be used as biocontrol agents for this insect pest. A new picorna-like virus, tentatively named "Bactericera cockerelli picorna-like virus" (BcPLV), was discovered in B. cockerelli populations maintained in greenhouses, through the use of high-throughput sequencing data and subsequent confirmation by RT-PCR and Sanger sequencing. BcPLV has a positive-sense 9,939-nt RNA genome encoding a single 2,947-aa polyprotein and is related to the Diaphorina citri picorna-like virus (DcPLV) found in Asian citrus psyllid Diaphorina citri populations. Based on their genome organization and the phylogeny of their RNA-dependent RNA polymerase domains, BcPLV and DcPLV together are proposed to comprise a new genus, provisionally named "Psylloidivirus", within the family Iflaviridae.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

Protein aggregation as a cellular response to oxidative stress induced by heme and iron.

Hemolytic diseases include a variety of conditions with diverse etiologies in which red blood cells are destroyed and large amounts of hemeproteins are released. Heme has been described as a potent proinflammatory molecule that is able to induce multiple innate immune responses, such as those triggered by TLR4 and the NLRP3 inflammasome, as well as necroptosis in macrophages. The mechanisms by which eukaryotic cells respond to the toxic effects induced by heme to maintain homeostasis are not fully understood, however. Here we describe a previously uncharacterized cellular response induced by heme: the formation of p62/SQTM1 aggregates containing ubiquitinated proteins in structures known as aggresome-like induced structures (ALIS). This action is part of a response driven by the transcription factor NRF2 to the excessive generation of reactive oxygen species induced by heme that results in the expression of genes involved in antioxidant responses, including p62/SQTM1. Furthermore, we show that heme degradation by HO-1 is required for ALIS formation, and that the free iron released on heme degradation is necessary and sufficient to induce ALIS. Moreover, ferritin, a key protein in iron metabolism, prevents excessive ALIS formation. Finally, in vivo, hemolysis promotes an increase in ALIS formation in target tissues. Our data unravel a poorly understood aspect of the cellular responses induced by heme that can be explored to better understand the effects of free heme and free iron during hemolytic diseases such as sickle cell disease, dengue fever, malaria, and sepsis.

Prevalence of 'Candidatus Liberibacter solanacearum' Haplotypes in Potato Tubers and Psyllid Vectors in Idaho From 2012 to 2018.

'Candidatus Liberibacter solanacearum' (Lso) is an uncultured, phloem-associated bacterium causing a severe tuber disease in potato called zebra chip (ZC). Seven haplotypes of Lso have been described in different hosts, with haplotypes A and B found associated with infections in potato and tomato. In the field, Lso is transmitted by the potato psyllid (Bactericera cockerelli), and between 2011 and 2015, a significant change in Lso haplotype prevalence was previously reported in Idaho: from exclusively A haplotype found in tested psyllids in 2012 to mainly B haplotype found in collected psyllids in 2015. However, prevalence of Lso haplotypes in Idaho was not analyzed in potato tubers exhibiting symptoms of ZC. To fill in this knowledge gap, prevalence of Lso haplotypes was investigated in potato tubers harvested in southern Idaho between 2012 and 2018, and it was found to change from exclusively A haplotype in the 2012 season to an almost equal A and B haplotype distribution during the 2016 season. During the same period, haplotype distribution of Lso in psyllid vectors collected using yellow sticky traps also changed, but in psyllids, the shift from A haplotype of Lso to B haplotype was complete, with no A haplotype detected in 2016 to 2018. The changes in the haplotype prevalence of the Lso circulating in potato fields in southern Idaho may be, among other factors, responsible for a decrease in the ZC incidence in Idaho potato fields between an outbreak of the disease in 2012 and a very low level of ZC afterward.

A Novel Genetic Variant of Grapevine leafroll-associated virus-3 (GLRaV-3) from Idaho Grapevines.

Grapevine leafroll-associated virus-3 (GLRaV-3) is a major constraint on profitable grapevine cultivation. The virus is transmitted efficiently by mealybugs and soft scale insects, or through vegetative propagation by cuttings, and is present worldwide, wherever grapevines are grown. GLRaV-3 exists as a complex of genetic variants currently classified in several phylogenetic groups that can differ from each other by as much as 30% in nucleotide sequence of the whole genome. In the course of the GLRaV-3 testing of wine grapes in southern Idaho, plants of two grapevine cultivars were found to harbor a novel genetic variant of GLRaV-3, named ID45, which exhibited ≤80% nucleotide sequence identity level to the known GLRaV-3 isolates in its most conserved HSP70h gene. The ID45 variant caused no foliar symptoms in 'Cabernet Sauvignon' in the fall, and was demonstrated to have poor reactivity to commercial virus-specific antibodies. The entire 18,478-nt genome sequence of the GLRaV-3-ID45 was determined using a combination of high-throughput and conventional Sanger sequencing, and demonstrated to have typical organization for the genus Ampelovirus (family Closteroviridae), with only 70 to 77% identity level to the GLRaV-3 genomes from other established phylogroups. We concluded that ID45 represented a new phylogenetic group IX of GLRaV-3. Database search using ID45 nucleotide sequence as a query suggested that this novel ID45 variant is present in at least one other grape-growing state in the U.S., California, and in Brazil. An RT-PCR based test was developed to distinguish ID45 from the predominant GLRaV-3 phylogroup I found in Idaho in single and mixed infections.

The MTL1 Pentatricopeptide Repeat Protein Is Required for Both Translation and Splicing of the Mitochondrial NADH DEHYDROGENASE SUBUNIT7 mRNA in Arabidopsis.

Mitochondrial translation involves a complex interplay of ancient bacteria-like features and host-derived functionalities. Although the basic components of the mitochondrial translation apparatus have been recognized, very few protein factors aiding in recruiting ribosomes on mitochondria-encoded messenger RNA (mRNAs) have been identified in higher plants. In this study, we describe the identification of the Arabidopsis (Arabidopsis thaliana) MITOCHONDRIAL TRANSLATION FACTOR1 (MTL1) protein, a new member of the Pentatricopeptide Repeat family, and show that it is essential for the translation of the mitochondrial NADH dehydrogenase subunit7 (nad7) mRNA. We demonstrate that mtl1 mutant plants fail to accumulate the Nad7 protein, even though the nad7 mature mRNA is produced and bears the same 5' and 3' extremities as in wild-type plants. We next observed that polysome association of nad7 mature mRNA is specifically disrupted in mtl1 mutants, indicating that the absence of Nad7 results from a lack of translation of nad7 mRNA. These findings illustrate that mitochondrial translation requires the intervention of gene-specific nucleus-encoded PPR trans-factors and that their action does not necessarily involve the 5' processing of their target mRNA, as observed previously. Interestingly, a partial decrease in nad7 intron 2 splicing was also detected in mtl1 mutants, suggesting that MTL1 is also involved in group II intron splicing. However, this second function appears to be less essential for nad7 expression than its role in translation. MTL1 will be instrumental to understand the multifunctionality of PPR proteins and the mechanisms governing mRNA translation and intron splicing in plant mitochondria.

Relative Abundance of Potato Psyllid Haplotypes in Southern Idaho Potato Fields During 2012 to 2015, and Incidence of 'Candidatus Liberibacter solanacearum' Causing Zebra Chip Disease.

Zebra chip (ZC) disease, a serious threat to the potato industry, is caused by the bacterium 'Candidatus Liberibacter solanacearum' (Lso). Five haplotypes (hapA to hapE) of this pathogen have been described so far in different crops, with only hapA and hapB being associated with ZC in potato. Both haplotypes are vectored and transmitted to a variety of solanaceaeous plants by the tomato/potato psyllid, Bactericera cockerelli (Sulc). Psyllids are native to North America, and four haplotypes have been identified and named based on their predominant geographic association: Northwestern, Central, Western, and Southwestern. Although all psyllid haplotypes have been found in southern Idaho potato fields, data on relative haplotype abundances and dynamic changes in the fields over time have not previously been reported. Here, psyllid samples collected in Idaho potato fields from 2012 to 2015 were used to clarify spatial and temporal patterns in distribution and abundance of psyllid and Lso haplotypes. A shift from hapA toward hapB population of Lso was revealed during these four seasons, indicating possible evolution of Lso in Idaho fields. Although we confirmed that Western psyllids were the most abundant by far during the four seasons of observation, we also observed changes in abundance of other haplotypes, including increased diversity of psyllid haplotypes during 2015. Seasonal changes observed for the Northwestern and Central haplotypes could potentially be linked to psyllid migration and/or habitat changes. South-central Idaho exhibited more diversity in psyllid haplotypes than southwestern Idaho.

Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis.

The pentatricopeptide repeat MTSF1 protein stabilizes the nad4 mRNA in Arabidopsis mitochondria.

Gene expression in plant mitochondria involves a complex collaboration of transcription initiation and termination, as well as subsequent mRNA processing to produce mature mRNAs. In this study, we describe the function of the Arabidopsis mitochondrial stability factor 1 (MTSF1) gene and show that it encodes a pentatricopeptide repeat protein essential for the 3'-processing of mitochondrial nad4 mRNA and its stability. The nad4 mRNA is highly destabilized in Arabidopsis mtsf1 mutant plants, which consequently accumulates low amounts of a truncated form of respiratory complex I. Biochemical and genetic analyses demonstrated that MTSF1 binds with high affinity to the last 20 nucleotides of nad4 mRNA. Our data support a model for MTSF1 functioning in which its association with the last nucleotides of the nad4 3' untranslated region stabilizes nad4 mRNA. Additionally, strict conservation of the MTSF1-binding sites strongly suggests that the protective function of MTSF1 on nad4 mRNA is conserved in dicots. These results demonstrate that the mRNA stabilization process initially identified in plastids, whereby proteins bound to RNA extremities constitute barriers to exoribonuclease progression occur in plant mitochondria to protect and concomitantly define the 3' end of mature mitochondrial mRNAs. Our study also reveals that short RNA molecules corresponding to pentatricopeptide repeat-binding sites accumulate also in plant mitochondria.

Bactericera cockerelli Picorna-like Virus and Three New Viruses Found Circulating in Populations of Potato/Tomato Psyllids (Bactericera cockerelli).

An investigation of viruses circulating in populations of field and laboratory potato/tomato psyllids (Bactericera cockerelli) was conducted using high-throughput sequencing (HTS) technology and conventional RT-PCR. Three new viruses were discovered: one from the family Tymoviridae and two from the family Solemoviridae. A tymo-like virus sequence represented a nearly complete 6843 nt genome of a virus named Bactericera cockerelli tymo-like virus (BcTLV) that spanned five open reading frames (ORFs) which encoded RNA-dependent RNA polymerase (RdRP), helicase, protease, methyltransferase, and a capsid protein. Phylogenetic analyses placed the RdRP of BcTLV inside a divergent lineage of the viruses from the family Tymoviridae found in insect and plant hosts in a sister clade to the genera Tymovirus, Marafivirus, and Maculavirus. Four solemo-like virus sequences were identified in the HTS outputs, representing two new viruses. One virus found only in field-collected psyllids and named Bactericera cockerelli solemo-like virus 1 (BcSLV-1) had a 5479 nt genome which spanned four ORFs encoding protease and RdRP. Three solemo-like sequences displayed 87.4-99.7% nucleotide sequence identity among themselves, representing variants or strains of the same virus named Bactericera cockerelli solemo-like virus 2 (BcSLV-2). The genome of BcSLV-2 spanned only two ORFs that encoded a protease and an RdRP. Phylogenetic analysis placed the RdRPs of BcSLV-1 and BcSLV-2 in two separate lineages as sister clades to viruses from the genus Sobemovirus found in plant hosts. All three new psyllid viruses were found circulating in psyllids collected from potato fields in southern Idaho along with a previously identified Bactericera cockerelli picorna-like virus. Any possible role of the three viruses in controlling populations of the field psyllids remains to be elucidated.

The Rf and Rf-like PPR in higher plants, a fast-evolving subclass of PPR genes.

In the last years, a number of nuclear genes restoring cytoplasmic male sterility (CMS) have been cloned in various crop species. The majority of these genes have been shown to encode pentatricopeptide repeat proteins (PPR) that act by specifically suppressing the expression of sterility-causing mitochondrial transcripts. Functional analysis of these proteins has indicated that the inhibitory effects of restoring PPR (Rf-PPR) proteins involve various mechanisms, including RNA cleavage, RNA destabilization, or translation inhibition. Cross-species sequence comparison of PPR protein complements revealed that most plant genomes encode 10-30 Rf-like (RFL) proteins sharing high-sequence similarity with the identified Rf-PPRs from crops. Evolutionary analyses further showed that they constitute a monophyletic group apart in the PPR family, with peculiar evolution dynamic and constraints. Here we review recent data on RF-PPRs and present the latest discoveries on the RFL family, with prospects on the functionality and evolution of this peculiar subclass of PPR.

Stem cell-like micro-RNA signature driven by Myc in aggressive liver cancer.

Myc activation has been implicated in the pathogenesis of hepatoblastoma (HB), a rare embryonal neoplasm derived from liver progenitor cells. Here, microRNA (miR) expression profiling of 65 HBs evidenced differential patterns related to developmental stage and Myc activity. Undifferentiated aggressive HBs overexpressed the miR-371-3 cluster with concomitant down-regulation of the miR-100/let-7a-2/miR-125b-1 cluster, evoking an ES cell expression profile. ChIP and Myc inhibition assays in hepatoma cells demonstrated that both miR clusters are regulated by Myc in an opposite manner. We show that the two miR clusters exert antagonistic effects on cell proliferation and tumorigenicity. Moreover, their combined deregulation cooperated in modulating the hepatic tumor phenotype, implicating stem cell-like regulation of Myc-dependent miRs in poorly differentiated HBs. Importantly, a four-miR signature representative of these clusters efficiently stratified HB patients, and when applied to 241 hepatocellular carcinomas (HCCs), it identified invasive tumors with a poor prognosis. Our data argue that Myc-driven reprogramming of miR expression patterns contributes to the aggressive phenotype of liver tumors originating from hepatic progenitor cells.

Grapevine Endophyte Endornavirus and Two New Endornaviruses Found Associated with Grapevines (Vitis vinifera L.) in Idaho, USA.

Five virus genomes, ranging between 12.0 and 12.3 kb in length and identified as endornaviruses, were discovered through a high-throughput sequencing (HTS) analysis of the total RNA samples extracted from two wine grape cultivars collected in the State of Idaho. One was found in a declining Chardonnay vine and was determined to be a local isolate of grapevine endophyte endornavirus (GEEV), and four others represented two novel endornaviruses named grapevine endornavirus 1 (GEV1) and grapevine endornavirus 2 (GEV2). All three virus genomes span a large, single open reading frame encoding polyproteins with easily identifiable helicase (HEL) and RNA-dependent RNA polymerase (RdRP) domains, while the GEV2 polyprotein also contains a glycosyltransferase domain. The GEV1 genome found in an asymptomatic Cabernet franc vine was related to, but distinct from, GEEV: the 5'-proximal, 4.7 kb segment of the GEV1 genome had a 72% identical nucleotide sequence to that of GEEV, while the rest of the genome displayed no significant similarity to the GEEV nucleotide sequence. Nevertheless, the amino acid sequence of the RdRP domain of GEV1 exhibited the closest affinity to the RdRP of GEEV. GEV2 was found in declining Chardonnay and asymptomatic Cabernet franc vines as three genetic variants exhibiting a 91.9-99.8% nucleotide sequence identity among each other; its RdRP had the closest affinity to the Shahe endorna-like virus 1 found in termites. In phylogenetic analyses, the RdRP and HEL domains of the GEV1 and GEV2 polyproteins were placed in two separate clades inside the large lineage of alphaendornaviruses, showing an affinity to GEEV and Phaseolus vulgaris endornavirus 1, respectively.

Genome Sequences of Two Grapevine Rupestris Stem Pitting-Associated Virus Variants from Vitis vinifera cv. Riesling in Idaho, USA.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

The four and a half LIM-only protein 2 regulates liver homeostasis and contributes to carcinogenesis.

BACKGROUND & AIMS: The four and a half LIM-only protein 2 (FHL2) is upregulated in diverse pathological conditions. Here, we analyzed the effects of FHL2 overexpression in the liver of FHL2 transgenic mice (Apo-FHL2). METHODS: We first examined cell proliferation and apoptosis in Apo-FHL2 livers and performed partial hepatectomy to investigate high FHL2 expression in liver regeneration. Expression of FHL2 was then analyzed by real time PCR in human hepatocellular carcinoma and adjacent non-tumorous livers. Finally, the role of FHL2 in hepatocarcinogenesis was assessed using Apo-FHL2;Apc(lox/lox) mice. RESULTS: Six-fold increase in cell proliferation in transgenic livers was associated with concomitant apoptosis, resulting in normal liver mass. In Apo-FHL2 livers, both cyclin D1 and p53 were markedly increased. Evidence supporting a p53-dependent cell death mechanism was provided by the findings that FHL2 bound to and activated the p53 promoter, and that a dominant negative p53 mutant compromised FHL2-induced apoptosis in hepatic cells. Following partial hepatectomy in Apo-FHL2 mice, hepatocytes displayed advanced G1 phase entry and DNA synthesis leading to accelerated liver weight restoration. Interestingly, FHL2 upregulation in human liver specimens showed significant association with increasing inflammation score and cirrhosis. Finally, while Apo-FHL2 mice developed no tumors, the FHL2 transgene enhanced hepatocarcinogenesis induced by liver-specific deletion of the adenomatous polyposis coli gene and aberrant Wnt/ß-catenin signaling in Apc(lox/lox) animals. CONCLUSIONS: Our results implicate FHL2 in the regulation of signaling pathways that couple proliferation and cell death machineries, and underscore the important role of FHL2 in liver homeostasis and carcinogenesis.

A Novel Rhabdovirus Associated with the Idaho Population of Potato Cyst Nematode Globodera pallida.

Globodera pallida, a potato cyst nematode (PCN), is a quarantine endoparasitic pest of potato (Solanum tuberosum) in the US due to its effects on yield and quality of potato tubers. A new rhabdovirus, named potato cyst nematode rhabdovirus (PcRV), was revealed and characterized in the G. pallida populations collected in Idaho through use of high-throughput sequencing (HTS) and RT-PCR and found to be most closely related to soybean cyst nematode rhabdovirus (ScRV). PcRV has a 13,604 bp long, single-stranded RNA genome encoding five open reading frames, including four rhabdovirus-specific genes, N, P, G, and L, and one unknown gene. PcRV was found present in eggs, invasive second-stage juveniles, and parasitic females of G. pallida, implying a vertical transmission mode. RT-PCR and partial sequencing of PcRV in laboratory-reared G. pallida populations maintained over five years suggested that the virus is highly persistent and genetically stable. Two other Globodera spp. reproducing on potato and reported in the US, G. rostochiensis and G. ellingtonae, tested negative for PcRV presence. To the best of our knowledge, PcRV is the first virus experimentally found infecting G. pallida. Based on their similar genome organizations, the phylogeny of their RNA-dependent RNA polymerase domains (L gene), and relatively high identity levels in their protein products, PcRV and ScRV are proposed to form a new genus, provisionally named "Gammanemrhavirus", within the family Rhabdoviridae.