Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 2 de 2
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Ano de publicação
Tipo de documento
País de afiliação
Intervalo de ano de publicação
1.
Mol Biol Rep ; 48(4): 3417-3422, 2021 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-33864586

RESUMO

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.


Assuntos
Anisakis/isolamento & purificação , Larva , Perciformes/parasitologia , Animais , Peixes/parasitologia , Marrocos , Alimentos Marinhos/parasitologia , Estações do Ano
2.
J Virol Methods ; 330: 115013, 2024 Aug 28.
Artigo em Inglês | MEDLINE | ID: mdl-39209160

RESUMO

Human enteric viruses, as adenovirus (HAdV), norovirus (HuNoV) and rotavirus (RVA) are significant causes of gastroenteritis associated with consumption of contaminated water worldwide. Various methods have been described for their detection and monitoring in water. The aim of this study was to compare the performance of four conditions for concentrating HAdV, HuNoV and RVA from water matrices, in order to develop a single protocol that could simultaneously concentrate all target viruses from tap water. The tested conditions were based on the adsorption-elution using electronegative filters, in which we evaluated cation-coated filtration by MgCl2 with or without acid rinse by H2SO4 and two elution buffers, namely NaOH and tris-glycine-beef extract. Genomic material was extracted and amplified by real-time PCR and real-time RT-PCR using commercial kits. Based on the statistical analysis of amplification results (cycles of quantification), the condition involving cation-coated filtration by MgCl2 using electronegative filters with acid rinse by H2SO4 combined with NaOH elution allowed efficient recovery of both HAdV, HuNoV and RVA from tap water compared to the other conditions. These findings confirm the effectiveness of the approach used to monitor three major enteric viruses in tap water.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA