Treatment of Obesity with Thyroid hormones in Europe. Data from the THESIS* Collaboration.

PURPOSE: The use of thyroid hormones (TH) to treat obesity is unsupported by evidence as reflected in international guidelines. We explored views about this practice, and associations with respondent characteristics among European thyroid specialists. METHODS: Specialists from 28 countries were invited to a survey via professional organisations. The relevant question was whether "Thyroid hormones may be indicated in biochemically euthyroid patients with obesity resistant to lifestyle interventions". RESULTS: Of 17,232 invitations 5695 responses were received (33% valid response rate; 65% women; 90% endocrinologists). Of these, 290 (5.1%) stated that TH may be indicated as treatment for obesity in euthyroid patients. This view was commoner among non-endocrinologists (8.7% vs. 4.7%, p < 0.01), private practice (6.5% vs. 4.5%, p < 0.01), and varied geographically (Eastern Europe, 7.3%; Southern Europe, 4.8%; Western Europe, 2.7%; and Northern Europe, 2.5%). Respondents from Northern and Western Europe were less likely to use TH than those from Eastern Europe (p < 0.01). Gross national income (GNI) correlated inversely with this view (OR 0.97, CI: 0.96-0.97; p < 0.001). Having national guidelines on hypothyroidism correlated negatively with treating obesity with TH (OR 0.71, CI: 0.55-0.91). CONCLUSIONS: Despite the lack of evidence, and contrary to guidelines' recommendations, about 5% of respondents stated that TH may be indicated as a treatment for obesity in euthyroid patients resistant to life-style interventions. This opinion was associated with (i) respondent characteristics: being non-endocrinologist, working in private practice, treating a small number of hypothyroid patients annually and (ii) national characteristics: prevalence of obesity, Eastern Europe, low GNI and lack of national hypothyroidism guidelines.

Pheochromocytoma: A three-decade clinical experience in a multicenter study. / Feocromocitoma: experiencia clínica de tres décadas en un estudio multicéntrico.

OBJECTIVE: To analyze the clinical and analytical features, diagnostic tests, therapies, and outcomes of pheochromocytoma (PCC). DESIGN AND METHODS: A multicenter retrospective study in surgically treated patients with PCC followed in 3 Spanish tertiary referral hospitals. RESULTS: A total of 106 patients (61 [57.5%] women, mean age 52.3 ± 14.8 years) were evaluated. At diagnosis, PCC was symptomatic in 62% and sporadic in 83%. Patients with familial PCC were significantly younger than those with sporadic disease (40.8 ± 14.2 years vs. 54.5 ± 13.9 years, p<.001). Familial PCCs were more frequently associated with MEN2A (n=8). Levels of 24-h urinary fractionated metanephrines were positively related to tumor size. The maximum tumor diameter was 4.3cm (3-6cm); 27.7% of the patients had tumors ≥6cm. Incidental PCCs were significantly smaller than symptomatic PCCs (3.4cm [2.4-5.0cm] vs. 5.6cm [4.0-7.0cm], p<.001). Scintigraphy by 123I-metaiodobenzylguanidine showed a high sensitivity (81.9%). Preoperative alpha blockade with phenoxybenzamine was used in 93.6% and doxazosin in the rest. Laparoscopic surgery was used in 2/3 of the patients, with a low conversion (1.9%) to open surgery. Perioperative complications appeared in approximately 20% of patients, mainly hypertensive crisis (9.4%). Recurrent disease appeared in 10%, and malignant PCC was uncommon (6.3%). CONCLUSIONS: PCCs surgically treated in Spain are usually large, symptomatic, and sporadic tumors diagnosed around the sixth decade of life. Hereditary PCC is usually associated with MEN2A. The main type of surgical technique used is laparoscopic surgery, and the prevalence of metastatic PCC is low.

Characterization of small RNAs originating from mitoviruses infecting the conifer pathogen Fusarium circinatum.

Deep sequencing of small RNAs has proved effective in the diagnosis of mycovirus infections. In this study, the presence of mycoviruses in ten isolates of the phytopathogenic fungus Fusarium circinatum was investigated by high-throughput sequencing (HTS) of small RNAs. The contigs resulting from de novo assembly of the reads were aligned to viral genome sequences. The presence of each mycovirus detected in the isolates was confirmed by RT-PCR analysis with four previously described primer pairs and seven new pairs designed on the basis of sequencing data. The findings demonstrate the potential use of HTS for reconstructing previously identified mitoviruses infecting F. circinatum.

Pazopanib in pretreated advanced neuroendocrine tumors: a phase II, open-label trial of the Spanish Task Force Group for Neuroendocrine Tumors (GETNE).

BACKGROUND: The management of advanced neuroendocrine tumors (NETs) has recently changed. We assessed the activity of pazopanib after failure of other systemic treatments in advanced NETs. METHODS: This was a multicenter, open-label, phase II study evaluating pazopanib as a single agent in advanced NETs (PAZONET study). The clinical benefit rate (CBR) at 6 months was the primary end point. Translational correlation of radiological response and progression-free survival (PFS) with circulating and tissue biomarkers was also evaluated. RESULTS: A total of 44 patients were enrolled. Twenty-five patients (59.5%) were progression-free at 6 months (4 partial responses, 21 stable diseases) with a median PFS of 9.5 months [95% confidence interval (CI) 4.8-14.1]. The CBR varied according to prior therapy received, with 73%, 60% and 25% in patients treated with prior multitarget inhibitors, prior mTOR inhibitors and both agents, respectively. A nonsignificant increase in PFS was observed in patients presenting lower baseline circulating tumor cell (CTC) counts (9.1 versus 5.8 months; P = 0.22) and in those with decreased levels of soluble-vascular endothelial growth factor receptor-2 (sVEGFR-2) (12.6 versus 9.1 months; P = 0.067). A trend toward reduced survival was documented in patients with VEGFR3 rs307821 and rs307826 missense polymorphisms [hazard ratio (HR): 12.3; 95% CI 1.09-139.2; P = 0.042 and HR: 6.9; 95% CI 0.96-49.9; P = 0.055, respectively]. CONCLUSIONS: Pazopanib showed clinical activity in patients with advanced NETs regardless of previous treatments. Additionally, CTCs, soluble-s VEFGR-2 and VEGFR3 gene polymorphisms constitute potential biomarkers for selecting patients for pazopanib (NCT01280201). CLINICAL TRIAL NUMBER: NCT01280201.

Hypogonadism in aged hospitalized male patients: prevalence and clinical outcome.

OBJECTIVE: Male hypogonadism is common in the elderly and has been associated with increased risk of mortality. Our objective has been to assess the prevalence of primary and central hypogonadism in elderly male patients admitted to the hospital because of acute illness. We also evaluated the relationships between gonadal dysfunction and in-hospital mortality. PATIENTS AND METHODS: 150 patients, aged ≥65 years, admitted during 2010 and 2011 in our geriatric unit, were studied. Serum concentrations total, bioavailable and free testosterone, as well as of follicle-stimulating hormone and luteinizing hormone were quantified in every patient. Hypogonadism was defined by the presence of serum testosterone levels lower than 200 ng/dl. RESULTS: Hypogonadism was found in 80 patients (53.3 %). Serum gonadotropin concentrations were elevated in 43.7 % of these patients, whereas 41.3 % of hypogonadic patients showed normal and 15 % low gonadotropin concentrations. Respiratory tract infection and congestive heart failure were the main causes of hospitalization in hypogonadal men, whereas acute cerebrovascular disease was the main reason for admission in eugonadal patients. Of the 13 patients who died during hospitalization, 12 were hypogonadic. Patients who died showed significantly lower serum levels of total, free and bioavailable testosterone than those found in patients who survived. CONCLUSION: Our results show that about half of patients admitted for acute illness have hypogonadism, mainly of non-hypergonadotropic type. Gonadal hypofunction is significantly related with in-hospital mortality. A low value of serum testosterone may be a predictor for mortality in elderly male patients.

First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain.

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 µm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 µm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 µm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

An analysis of the relative risk for hypothyroidism in patients with Type 2 diabetes.

AIMS: We aimed to assess the relative risk for hypothyroidism in patients with Type 2 diabetes. METHODS: In this study, 1112 patients with Type 2 diabetes (58% women, mean age 66.7 years, median duration of diabetes 10 years, 179 with previous history of thyroid disease) and 911 subjects without diabetes were evaluated. RESULTS: The gender-, age- and weight-adjusted relative risk (odds ratio) of newly identified hypothyroidism in patients with Type 2 diabetes in comparison with control subjects was 2.81 (1.77-4.48). This odds ratio was significant in patients over 65 years [4.02 (1.95-8.31)], as well as in both men [4.84 (1.58-14.80)] and women [2.60 (1.54-4.38)], in obese patients [2.56 (1.36-4.82)] and non-obese patients [3.11 (1.56-6.20)] and in individuals with [4.26 (1.73-10.46)] and without [2.93 (1.50-5.75)] thyroid autoantibodies. Logistic regression analysis showed that newly diagnosed hypothyroidism was significantly and directly related not only with thyroid autoimmunity [19.15 (8.73-42.01)], but also with the presence of macroangiopathy [2.85 (1.51-5.35)] and metformin treatment [2.51 (1.28-4.92)]. CONCLUSIONS: Our results favour screening for hypothyroidism in patients with Type 2 diabetes older than 65 years, especially in the presence of diabetic macroangiopathy or treatment with metformin.

First Report of Heterobasidion annosum on Pinus pinaster in Spain.

The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2'41″N, 3°18'14″W, elevation 1,096 m and 41°55'40″N, 3°12'3″W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 µm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and 4 (5'-TCCTCCGCTTATTGATATGC-3'). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.

Effect of pituitary adenoma consistency on surgical outcomes in patients undergoing endonasal endoscopic transsphenoidal surgery.

BACKGROUND: Most pituitary adenomas (PAs) are considered to have a soft tumor consistency. However, there is a non-negligible percentage (5-13%) of tumors presenting or exhibiting a fibrous consistency that would entail a more difficult and complicated surgical excision with higher surgical morbidity and mortality rates. PURPOSE: To analyze the clinical consequences of PA tumor consistency on the surgical outcomes in patients undergoing endonasal endoscopic transsphenoidal (EET) pituitary surgery. METHODS: An ambispective study of patients with PAs operated on through an EET approach in two Spanish tertiary hospitals over the last 12 years. A total of 226 consecutive interventions were carried out in the Neurosurgery Departments of the Hospital Universitario Ramón y Cajal (HURC) and the Hospital Universitario Puerta del Sur by the same neurosurgeon. PAs were grouped into soft (n = 150) and fibrous (n = 76). All patients underwent hormonal and magnetic resonance imaging (MRI) studies before and after surgery. In addition, neurosurgical complications were recorded in each patient. RESULTS: Fibrous adenomas were independently associated with lower resection rates compared to soft adenomas (fibrous gross total resection [GTR] rate 48.7% vs. 76.3%, p < 0.001), even in those adenomas without invasion of the cavernous sinus (Knosp grades 0, I, and II). There were more intraoperative cerebrospinal fluid (CSF) leaks in patients with fibrous PAs. Moreover, fibrous PAs showed higher rates of postoperative hypopituitarism, permanent diabetes insipidus (DI) and postoperative treatments (hormonal treatment and radiotherapy). The excision of a fibrous PA required a longer surgical time (22.5 min more than soft PAs, p = 0.014), regardless of other factors. CONCLUSION: The consistency of the PAs significantly conditions both the results of surgery (lower resections rates), complications (higher incidence of postoperative hypopituitarism, permanent DI), and the prognosis (higher incidence of postoperative treatments) of the patient undergoing EET.

Serum concentrations of osteocalcin, procollagen type 1 N-terminal propeptide and beta-CrossLaps in obese subjects with varying degrees of glucose tolerance.

AIMS: To evaluate serum levels of osteocalcin (OC), procollagen type 1 N-terminal propeptide (P1PN) and beta-CrossLaps (beta-CTx) in obese subjects and their relationship with glucose metabolism parameters. SUBJECTS: Sixty-four obese patients classified according to their glucose tolerance. DESIGN: Case-control study. MEASUREMENTS: A 75-g oral glucose tolerance test was performed with determinations of glucose and insulin between 0 and 120 min. Serum concentrations of OC, P1PN and beta-CTx were quantified in baseline samples. RESULTS: Patients with type 2 diabetes (T2D, n = 24) exhibited OC serum levels (2·6 ± 1·0 nm) significantly lower than those found in subjects with normal glucose tolerance (NGT, n = 20, 3·9 ± 1·5 nm, P < 0·01). We found no significant differences in P1NP and beta-CTX levels among patients with NGT, prediabetes and T2D. Multiple regression analysis showed that serum OC concentration, but not P1NP or beta-CTx levels, was independently related to 2-h plasma glucose. CONCLUSION: Obese patients with T2D showed significantly reduced levels of OC in comparison with patients with lower degrees of glucose tolerance derangement. Our results also suggest that OC was the only bone marker independently related to the degree of glucose metabolism derangement in these patients.

Clinical significance of anaemia associated with prolactin-secreting pituitary tumours in men.

BACKGROUND: An association between prolactin-secreting pituitary adenomas and anaemia in male patients has been recently reported. Our aim has been to evaluate the prevalence of anaemia in men with prolactinomas and to assess the relationships between haemoglobin concentrations and pituitary function at diagnosis in these patients. METHODS: In a retrospective analysis, 26 male patients with prolactinomas (22 macroprolactinomas and 4 microprolactinomas) were studied. Blood haemoglobin concentration, haematocrit value and baseline hormonal levels were collected at the time of prolactinoma diagnosis. The presence or absence of partial or total hypopituitarism was also evaluated at diagnosis. Logistic regression analysis was used to assess the presence of anaemia as a function of serum hormone concentrations and pituitary dysfunction. RESULTS: Patient bearing macroprolactinomas showed significant lower haemoglobin concentrations than those found in patients with microprolactinomas (13.5 ± 1.2 g/dl vs. 15.1 ± 0.9 g/dl, p < 0.05). Anaemia (haemoglobin < 13 g/dl) was present in nine (34.6%) patients, all of them with macroprolactinomas. The degree of anaemia was mild (haemoglobin > 11 g/dl) in all patients. No correlation between haemoglobin and serum prolactin was found. Haemoglobin concentration was significantly lower in men with hypogonadism (n = 14) than in eugonadal men. Haemoglobin value was also significantly lower in patients with total hypopituitarism in comparison with patients with partial hypopituitarism (12.4 ± 1.0 g/dl, n = 7 vs. 14.0 ± 1.2 g/dl, n = 13, p = 0.007). The number of affected pituitary axes was found to be related with the presence of anaemia. Logistic regression analysis showed that anaemia was related with FT4 (OR 0.23; 95% CI 0.06-0.81, p = 0.02), cortisol (OR 0.81; 95% CI 0.68-0.96, p= 0.02) and the presence of hypopituitarism (OR 20.0; 95% CI 1.68-238.63, p = 0.02). CONCLUSIONS: Anaemia was found in about a third of men with prolactinomas. Our results also suggest that the presence of anaemia in these patients seems to be associated with panhypopituitarism.

Fasting hyperglycaemia and in-hospital mortality in elderly population.

BACKGROUND: Admission hyperglycaemia has shown to be a marker of poor clinical outcome. The prevalence of admission hyperglycaemia and its relationship with in-hospital mortality in elderly population has not been clearly defined. We assessed the prevalence and prognostic significance of admission fasting hyperglycaemia in aged patients. METHODS: A total of 808 elderly patients were studied. Patients were classified into group I (serum glucose < 126 mg/dl), II (126-180 mg/dl) and III (> 180 mg/dl). Groups II and III were considered newly recognised fasting hyperglycaemia (NRFH) in non-diabetic patients. RESULTS: NRFH was present in 18.6%. After excluding diabetic patients (n = 206, 25.5%), the distribution of patients (n = 602, 74.5%) was as follows: group I (n = 452, 55.9%), group II (n = 122, 15.1%) and group III (n = 28, 3.5%). In the whole cohort, median fasting glucose was lower in patients who survived [105 mg/dl (88-135)] than in those who died [127 mg/dl (93-159), p < 0.001]. This significant difference was maintained only when non-diabetic patients were considered [100 mg/dl (87-122) vs. 118 mg/dl (92-149), p < 0.001]. In-hospital mortality rate in groups I, II and III was 8.5%, 14.1% and 22.9%, respectively (p < 0.001). Mortality rate was 8.4%, 18.0% and 32.1% (p < 0.001) in groups I, II and III, respectively in non-diabetic population. Both low albumin and high glucose serum concentrations were the only independent risk factors for in-hospital all-cause mortality in non-diabetic patients. CONCLUSIONS: In non-diabetic elderly patients admitted for acute disease, serum glucose concentration is an important, simple and independent predictor of hospital mortality.

Pheochromocytoma: A three-decade clinical experience in a multicenter study.

OBJECTIVE: To analyze the clinical and analytical features, diagnostic tests, therapies, and outcomes of pheochromocytoma (PCC). DESIGN AND METHODS: A multicenter retrospective study in surgically treated patients with PCC followed in 3 Spanish tertiary referral hospitals. RESULTS: A total of 106 patients (61 [57.5%] women, mean age 52.3 ±â€¯14.8 years) were evaluated. At diagnosis, PCC was symptomatic in 62% and sporadic in 83%. Patients with familial PCC were significantly younger than those with sporadic disease (40.8 ±â€¯14.2 years vs 54.5 ±â€¯13.9 years, p < .001). Familial PCCs were more frequently associated with MEN2A (n = 8). Levels of 24-h urinary fractionated metanephrines were positively related to tumor size. The maximum tumor diameter was 4.3 cm (3-6 cm); 27.7% of the patients had tumors ≥6 cm. Incidental PCCs were significantly smaller than symptomatic PCCs (3.4 cm [2.4-5.0 cm] vs 5.6 cm [4.0-7.0 cm], p < .001). Scintigraphy by ¹²³I-metaiodobenzylguanidine showed a high sensitivity (81.9%). Preoperative alpha blockade with phenoxybenzamine was used in 93.6% and doxazosin in the rest. Laparoscopic surgery was used in 2/3 of the patients, with a low conversion (1.9%) to open surgery. Perioperative complications appeared in approximately 20% of patients, mainly hypertensive crisis (9.4%). Recurrent disease appeared in 10%, and malignant PCC was uncommon (6.3%). CONCLUSIONS: PCCs surgically treated in Spain are usually large, symptomatic, and sporadic tumors diagnosed around the sixth decade of life. Hereditary PCC is usually associated with MEN2A. The main type of surgical technique used is laparoscopic surgery, and the prevalence of metastatic PCC is low.

Patterns of proliferation and cell differentiation during hepatic ontogeny in the alpaca.

The liver has multiple functions that change throughout ontogeny. South American camelids (SAC) have unique characteristics related to adaptation to extreme environments and metabolism. However, the process of hepatic cell differentiation has not been studied in any SAC. We study the patterns of cell differentiation and proliferation in the liver of the alpaca at different times of the ontogeny, excluding the hematopoietic components. Immunohistochemical techniques were performed in 66 specimens, including embryos, fetuses, neonates and adults. Supplementary analyses were performed by lectinhistochemistry. The hepatocytic differentiation was performed by the identification of Hepatocyte (Clone: ​​OCH1ES Dako®). It began in the specimens of 1.8-2.5 cm of crown to rump length (CRL), from Days 25-29 (ovulation = Day 0), continued during gestation and intensified towards its end. The cholangiocytic differentiation was performed by the identification of cytokeratin 7 (CK7, Dako®). It was manifested at the final of gestation (specimens of 28.4 cm CRL, from Day 223 onwards). Parenchymal cells underwent a process of gradual differentiation (differentiation of hepatocytes preceded that of cholangiocytes). Cell proliferation was observed along gestation using the nuclear proliferation antigen (PCNA) and Ki-67. Hepatic organogenesis in the alpacas shares similar differentiation and proliferation mechanisms with other altricial, but phylogenetically distant, species.

Severe hyperthyroidism: aetiology, clinical features and treatment outcome.

BACKGROUND: Severe hyperthyroidism (SH) is a serious medical disorder that can compromise life. There have not been systematic studies in which SH has been evaluated in detail. Here, our aims were: (1) to analyse both clinical and analytical features and outcome in patients with SH and (2) to compare these data with those found in more usual forms of hyperthyroidism. Patients and methods All patients diagnosed of SH (free thyroxine, FT4 > 100 pmol/l, NR: 11-23) seen in our endocrinology clinic in the last 15 years were studied and compared with a sample of patients with mild (mH; FT4, 23-50 pmol/l) and moderate (MH; FT4, 51-100 pmol/l) hyperthyroidism. Aetiology, clinical analytical and imaging data at diagnosis, therapeutic response and outcome were registered. Results A total of 107 patients with overt hyperthyroidism (81 females, mean age +/- SD 46.9 +/- 16.1 years) were evaluated. We studied a historic group with SH (n = 21; 14 females, 40.9 +/- 17.2 years) and, as a comparator group, we analyszed the data of 86 hyperthyroid patients (67 females, 48.4 +/- 15.5.6 years, NS) comparable in age and gender. The comparator group was classified in MH (n = 37, 26 females, 47.2 +/- 16.6 years) and mH (n = 49, 41 females, 49.4 +/- 14.8 years). In comparison with mH group, SH patients were significantly (P < 0.05) younger and showed a greater proportion of first episode of thyroid hyperfunction (P < 0.05). Graves' disease was the main aetiology in the three groups, but patients with SH showed the highest titre of TSH-receptor antibodies (TRAb) (P < 0.001). Heart rate and size of goitre were higher in SH group than in mH and MH groups (P < 0.01). Atrial fibrillation was more frequently reported in SH group than in MH and mH groups (15.8%vs. 5.4% and 0%, respectively, P < 0.05). RESULTS: from logistic regression analysis showed that younger age [OR 0.958 (95% CI, 0.923-0.995), P = 0.026], presence of asthenia [OR 4.35 (1.48-12.78), P = 0.008] and higher heart rate [OR 1.03 (1.01-1.06), P = 0.013] were independent clinical variables associated to SH. SH patients showed similar biochemical parameters in comparison with mH group, except for increased serum aspartate aminotransferase (AST) (P < 0.01) and calcium (P < 0.05) levels, and decreased serum cholesterol (P < 0.05) and albumin (P < 0.05) concentrations. Logistic regression analysis showed that only AST [OR 1.07 (1.02-1.11), P = 0.005] was an independent biochemical variable associated to SH. No differences in the type of therapy, cure rate and time in achieving cure were found in SH subjects in relation to patients with milder forms of hyperthyroidism. FT4 was the only independent predictor of cure [OR 0.98 (CI 95%, 0.97-0.99), P < 0.05]. CONCLUSIONS: Graves' disease is the most common aetiology in patients with SH. This type of hyperthyroidism is usually de novo and is accompanied by more clinical signs, symptoms, and analytical derangements, as well as higher titres of TRAb at diagnosis than milder forms of hyperthyroidism. The present data are not able to show differences in treatment modality, time to achieve cure, and remission rate among patients with mild, moderate and severe hyperthyroidism.

Are low concentrations of serum triiodothyronine a good marker for long-term mortality in hemodialysis patients?

INTRODUCTION: Low serum free triiodothyronine (FT3) concentrations have been reported in a high percentage of chronic renal failure patients and have been considered as an independent predictor of mortality in dialysis patients. OBJECTIVE: Our aim has been to evaluate the prognostic value of FT3 levels for long-term mortality in stable hemodialysis patients surviving at least 12 months. PATIENTS AND MEASUREMENTS: We retrospectively analyzed 89 stable hemodialysis patients (50 males; mean age 67.9 +/- 11.8 years). All patients had a baseline clinical and analytical evaluation. We analyzed the relationship between baseline FT3 and mortality by means of survival analysis (Kaplan-Meier) and Cox regression analysis. RESULTS: Mean values of thyroid function test were: thyrotropin (TSH) 2.02 +/- 1.5 microU/ml, free thyroxine (FT4) 1.26 +/- 0.23 ng/dl, and FT3 2.7 +/- 0.4 pg/ml. During a median follow-up time of 33.6 +/- 14.9 (12 - 62) months, 41 patients died. FT3 was similar in patients who died or survived (2.6 +/- 0.5 vs. 2.7 +/- 0.4 pg/ml ns). Kaplan-Meier analysis did not show significant differences in mean survival according to tertiles of FT3. In multivariate Cox regression analysis, FT3 was not a predictor of mortality (RR 0,001; 95% CI; 0.000 to 1.73). CONCLUSIONS: These data suggest that low FT3 levels are not predictive for mortality in a subgroup of stable HD patients who could survive more than 12 months.

Serum thyrotropin concentration is an early marker of normalization of low triiodothyronine syndrome in aged hospitalized patients after discharge.

OBJECTIVES: To assess short-term spontaneous evolution of alterations in thyroid function tests in aged hospitalized patients after discharge. METHODS: A group of 146 patients (mean age±SD 85.9±6.2 yr) was studied. Serum concentrations of TSH, free T4 (FT4), and free T3 (FT3) were evaluated in every patient both after admission and 1 month after discharge. RESULTS: At entry, both serum TSH [median (interquartile range), 2.19mU/l (0.89-2.31)] and FT4 (mean±SD, 16.7±3.4 pmol/l) concentrations were into the normal range, whereas serum FT3 concentrations were low (3.3±0.7 pmol/l). After discharge TSH and FT4 concentrations remained normal and FT3 low. However, both serum TSH [2.53 mU/l (1.24-3.33); p<0.01] and FT3 (3.7±1.0 pmol/l; p<0.001) concentrations significantly increased. Most patients (no.=124, 84.9%) showed the euthyroid sick syndrome (ESS). After discharge, ESS diminished to 76 (52.1%) subjects. Patients who normalized thyroid function tests showed significantly lower TSH values at entry compared with those who persisted with altered thyroid function tests [1.27 mU/l (0.69-1.89) vs 1.69mU/l (0.96-2.91), p<0.05]. Logistic regression analysis showed that serum levels of TSH at admission was the only variable negatively related to normalization of thyroid function [odds ratio 0.730; confidence interval 95%, 0.567-0.940; p=0.01). CONCLUSIONS: About 35%of aged patients hospitalized for acute illness spontaneously normalize their thyroid function tests 1 month after discharge, mainly due to the correction of ESS. Serum TSH levels at admission seem to be the only variable negatively related to normalization of thyroid function at this time.

[Thyroid dysfunction in hospital worker population]. / Disfunción tiroidea en población laboral hospitalaria.

INTRODUCTION: The prevalence of thyroid dysfunction (TD) and thyroid autoimmunity (TA) in hospital employees in our country is unknown. OBJECTIVE: To study the prevalence of TD and TA in a group of hospital employees. STUDY SUBJECTS AND METHODS: We studied thyroid function (thyrotropin, TSH, free thyroxine, T4, and free triiodothyronine, T3) and thyroid autoimmunity (anti-thyroglobulin, antiTg and anti-thyroid peroxidase, antiTPO) in 310 adult subjects (18-70 years) from the hospital General, Segovia, Spain during 2007. RESULTS: Eleven subjects (3.5%, 10 women) had previously known TD. Thirty-four subjects (11.0%) were diagnosed of unknown TD, mainly subclinical hypothyroidism (8.4%). Prevalence of total TD was 14.2%. TA was positive in 44 (14.2%) subjects. Both TD (P<0.05) and TA (P<0.05) were associated with female sex, and antiTPO levels were related to the presence of unknown TD (OR 1.007; 95% CI, 1.004-1.010; P<0.001). CONCLUSION: In this population, total prevalence of TD and TA is similar (14%). Increased antiTPO titers are predictors of unknown TD.

Alterations in thyroid function tests in aged hospitalized patients: prevalence, aetiology and clinical outcome.

BACKGROUND: Thyroid dysfunction is common in aged people and has recently been associated to mortality. AIMS: Our aims have been (1) to assess the prevalence of alterations in thyroid function tests in hospitalized patients over age 60 years and (2) to study the relationship between thyroid functional status and mortality during hospitalization. METHODS: We studied a group of 447 patients (62% women), aged 61-101 year, hospitalized during 2005. Thyroid dysfunction was assessed by measuring serum concentrations of thyrotrophin (TSH), free thyroxine (FT4), and free thriiodothyronine (FT3). Thyroid autoimmune status was evaluated through thyroid peroxidase (TPO) and thyroglobulin (TG) antibodies quantification. RESULTS: Twenty-one patients (4.7%, 19 women) showed previously known thyroid dysfunction. 332 patients (74.3%) showed alterations in thyroid function tests. Euthyroid sick syndrome (ESS) was the derangement more frequently found (n = 278, 62.2%). After excluding ESS patients, 60 patients (13.4%) showed thyroid dysfunction: overt hypothyroidism, 14 (3.1%); subclinical hypothyroidism, 25 (5.6%); overt hyperthyroidism, 11 (2.5%), and subclinical hyperthyroidism, 10 patients (2.2%). Thyroid autoimmunity was positive in only 4.0% and 2.3% of patients, for TPOAb and TgAb, respectively. The presence of alterations in thyroid function tests was positively associated with the age of the patients and mortality during hospital stay (P < 0.001). Serum levels of FT3 were negatively related to death during hospitalization (OR 0.56; CI 95%, 0.38-0.81; P < 0.01). CONCLUSIONS: About three quarters of patients admitted in our geriatric unit exhibited alterations in thyroid function tests. This finding was associated with elevated age and poor prognosis. The reduction of FT3 values was a powerful predictor for mortality during hospitalization in elderly patients.

Current treatments in the management of patients with primary hyperparathyroidism.

Primary hyperparathyroidism (PHP) develops as a consequence of autonomous hypersecretion of parathyroid hormone (PTH) by parathyroid glands usually because of a solitary parathyroid adenoma. Parathyroidectomy, a surgical procedure with a high success rate, is currently the treatment of choice. Pathological parathyroid tissue excision can be achieved by surgical and non-surgical ablative therapy. Bilateral cervical surgical exploration performed by an experienced parathyroid surgeon is curative in 95-98% of PHP and is associated with a low complication rate. In some patients, such as those with a single parathyroid adenoma adequately localised in presurgical imaging studies, this type of surgery may be more extensive than is needed. Moreover, the introduction of new intraoperative parathyroid-localising techniques, such as intraoperative PTH measurement and nuclear mapping, has boosted the development of new and less invasive parathyroid surgical techniques. Other non-surgical ablative techniques, such as selective percutaneous ethanol injection and transcatheter ablation of pathological parathyroid tissue, may be adequate in cases in which surgery is contraindicated. Lastly, among the therapeutic alternatives to parathyroidectomy are antiresorptive drugs (bisphosphonates, oestrogens and selective oestrogen receptor modulators) and inhibitors of PTH secretion (calcimimetics). A combination of drugs with diverse mechanisms of action may have a synergistic effect in the symptomatic control of PHP.