Comparative Performance Evaluation of Double-Stranded RNA High-Throughput Sequencing for the Detection of Viral Infection in Temperate Fruit Crops.

There is limited information on the compared performances of biological, serological. and molecular assays with high-throughput sequencing (HTS) for viral indexing in temperate fruit crops. Here, using a range of samples of predetermined virological status, we compared two performance criteria (inclusivity and analytical sensitivity) of enzyme-linked immunosorbent assay (ELISA), molecular hybridization, reverse transcription (RT)-PCR, and double-stranded RNA (dsRNA) HTS for the detection of a total of 14 viruses (10 genera) and four viroids (three genera). When undiluted samples from individual plants were used, ELISA had the lowest performance, with an overall detection rate of 68.7%, followed by RT-PCR (82.5%) and HTS (90.7%; 100% if considering only viruses). The lower performance of RT-PCR reflected the inability to amplify some isolates as a consequence of point mutations affecting primer-binding sites. In addition, HTS identified viruses that had not been identified by other assays in nearly two-thirds of the samples. Analysis of serial dilutions of fruit tree samples allowed comparison of analytical sensitivities for various viruses. ELISA showed the lowest analytical sensitivity, but RT-PCR showed higher analytical sensitivity than HTS for most of the samples. Overall, these results confirm the superiority of HTS over biological indexing in terms of speed and inclusivity and show that while the absolute analytical sensitivity of RT-PCR tends to be higher than that of HTS, PCR inclusivity is affected by viral genetic diversity. Taken together, these results make a strong case for the implementation of HTS-based approaches in fruit tree viral testing protocols supporting quarantine and certification programs.

Diversity and Pathobiology of an Ilarvirus Unexpectedly Detected in Diverse Plants and Global Sequencing Data.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum (S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Molecular and Biological Characterization of Novel and Known Family Secoviridae Members Infecting Lettuce.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.

The Expanding Menagerie of Prunus-Infecting Luteoviruses.

Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High-throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Additionally, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries; the most prevalent virus was NSPaV, followed by PaLV. The genetic diversity of these viruses was also analyzed. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed in either graft-inoculated GF305 indicators or different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution, and prevalence of peach-infecting luteoviruses and suggest that these viruses are likely asymptomatic in peach under most circumstances.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

A new flavi-like virus identified in populations of wild carrots.

We report the discovery of a new flavi-like virus identified in wild carrots (Daucus carota subsp. carota), using a double-stranded (ds)RNA high-throughput sequencing (HTS) approach. The new virus, tentatively named "carrot flavi-like virus 1" (CtFLV-1), has a large genome of 21.8 kb that harbours a single open reading frame encoding a 7,078-aa polyprotein with conserved RNA helicase (Hel) and RNA-dependent RNA polymerase (RdRp) domains. The new virus is phylogenetically related to recently described flavi-like viruses from arthropods, but its closest relative is a plant-associated virus, gentian Kobu-sho-associated virus (GKSaV). A pairwise comparison showed that these two viruses share 38.4% amino acid (aa) sequence identity in their polyproteins and 73% and 47.8% aa sequence identity in their conserved RdRp and Hel domains, respectively. Based on their similar genome organization and phylogenetic relationship, GKSaV and CtFLV-1 could form the basis for a new genus of plant-associated viruses, possibly within the family Flaviviridae, for which the name "Koshovirus" is proposed.

A new potyvirus from hedge mustard (Sisymbrium officinale (L.) Scop.) sheds light on the evolutionary history of turnip mosaic virus.

A novel potyvirus was identified in symptomatic hedge mustard (Sisymbrium officinale (L.) Scop.) and wild radish (Raphanus raphanistrum L.) in France. The nearly complete genome sequence of hedge mustard mosaic virus (HMMV) was determined, demonstrating that it belongs to a sister species to turnip mosaic virus (TuMV). HMMV readily infected several other members of the family Brassicaceae, including turnip, shepherd's purse (Capsella bursa-pastoris), and arabidopsis. The identification of HMMV as a Brassicaceae-infecting virus closely related to TuMV leads us to question the current scenario of TuMV evolution and suggests a possible alternative one in which transition from a monocot-adapted ancestral lifestyle to a Brassicaceae-adapted one could have occurred earlier than previously recognized.Please check and confirm that the authors and their respective affiliations have been correctly identified and amend if necessary.all OK.

Host range and molecular variability of the sadwavirus dioscorea mosaic associated virus.

Dioscorea mosaic associated virus (DMaV) is a member of the genus Sadwavirus, family Secoviridae, that is associated with mosaic symptoms in Dioscorea rotundata in Brazil. The genome of a DMaV isolate detected in D. trifida in Guadeloupe was sequenced by high-throughput sequencing. Using an RT-PCR-based detection assay, we found that DMaV infects D. alata, D. bulbifera, D. cayenensis-rotundata, D. esculenta, and D. trifida accessions conserved in Guadeloupe and Côte d'Ivoire and displays a very high level of molecular diversity in a relatively small region of the genome targeted by the assay. We also provide evidence that DMaV is also present in D. rotundata in Benin and in D. alata in Nigeria.

Molecular characterization of Cordyline virus 1 isolates infecting yam (Dioscorea spp).

Cordyline virus 1 (CoV1) is a velarivirus that has so far only been reported in ornamental Ti plants (Cordyline fruticosa). Using high-throughput sequencing, we identified CoV1 infection in yam accessions from Vanuatu. Using a specific RT-PCR assay, we found that CoV1 is also present and highly prevalent in Dioscorea alata, D. cayenensis, and D. trifida in Guadeloupe. Phylogenetic analysis showed that CoV1 isolates infecting yam in Guadeloupe display a low level of molecular diversity. These data provide insights into the transmission of CoV1 in yam in Guadeloupe.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

Sixty Years from the First Disease Description, a Novel Badnavirus Associated with Chestnut Mosaic Disease.

Although chestnut mosaic disease (ChMD) was described several decades ago, its etiology is still not clear. Using classical approaches and high-throughput sequencing (HTS) techniques, we identified a novel Badnavirus that is a strong etiological candidate for ChMD. Two disease sources from Italy and France were submitted to HTS-based viral indexing. Total RNAs were extracted, ribodepleted, and sequenced on an Illumina NextSeq500 (2 × 150 nt or 2 × 75 nt). In each source, we identified a single contig of ≈7.2 kb that corresponds to a complete circular viral genome and shares homologies with various badnaviruses. The genomes of the two isolates have an average nucleotide identity of 90.5%, with a typical badnaviral genome organization comprising three open reading frames. Phylogenetic analyses and sequence comparisons showed that this virus is a novel species; we propose the name Chestnut mosaic virus (ChMV). Using a newly developed molecular detection test, we systematically detected the virus in symptomatic graft-inoculated indicator plants (chestnut and American oak) as well in chestnut trees presenting typical ChMD symptoms in the field (100 and 87% in France and Italy surveys, respectively). Datamining of publicly available chestnut sequence read archive transcriptomic data allowed the reconstruction of two additional complete ChMV genomes from two Castanea mollissima sources from the United States as well as ChMV detection in C. dentata from the United States. Preliminary epidemiological studies performed in France and central eastern Italy showed that ChMV has a high incidence in some commercial orchards and low within-orchard genetic diversity.

Phytovirome Analysis of Wild Plant Populations: Comparison of Double-Stranded RNA and Virion-Associated Nucleic Acid Metagenomic Approaches.

Metagenomic studies have indicated that the diversity of plant viruses was until recently far underestimated. As important components of ecosystems, there is a need to explore the diversity and richness of the viruses associated with plant populations and to understand the drivers shaping their diversity in space and time. Two viral sequence enrichment approaches, double-stranded RNA (dsRNA) and virion-associated nucleic acids (VANA), have been used and compared here for the description of the virome of complex plant pools representative of the most prevalent plant species in unmanaged and cultivated ecosystems. A novel bioinformatics strategy was used to assess viral richness not only at the family level but also by determining operational taxonomic units (OTU) following the clustering of conserved viral domains. A large viral diversity dominated by novel dsRNA viruses was detected in all sites, while a large between-site variability limited the ability to draw a clear conclusion on the impact of cultivation. A trend for a higher diversity of dsRNA viruses was nevertheless detected in unmanaged sites (118 versus 77 unique OTUs). The dsRNA-based approach consistently revealed a broader and more comprehensive diversity for RNA viruses than the VANA approach, whatever the assessment criterion. In addition, dissimilarity analyses indicated both approaches to be largely reproducible but not necessarily convergent. These findings illustrate features of phytoviromes in various ecosystems and a novel strategy for precise virus richness estimation. These results allow us to reason methodological choices in phytovirome studies and likely in other virome studies where RNA viruses are the focal taxa.IMPORTANCE There are today significant knowledge gaps on phytovirus populations and on the drivers impacting them but also on the comparative performance-methodological approaches for their study. We used and compared two viral sequence enrichment approaches, double-stranded RNAs (dsRNA) and virion-associated nucleic acids (VANA), for phytovirome description in complex pools representative of the most prevalent plant species in unmanaged and cultivated ecosystems. Viral richness was assessed by determining operational taxonomic units (OTU) following the clustering of conserved viral domains. There is some limited evidence of an impact of cultivation on viral populations. These results provide data allowing us to reason the methodological choices in virome studies. For researchers primarily interested in RNA viruses, the dsRNA approach is recommended because it consistently provided a more comprehensive description of the analyzed phytoviromes, but it understandably underrepresented DNA viruses and bacteriophages.

Complete genome sequence of almond luteovirus 1, a novel luteovirus infecting almond.

In this study, we report the complete genome sequence of a novel luteovirus detected in almond using high-throughput sequencing. The genome of the new luteovirus comprises 5,047 nucleotides, and its genomic organization is similar to that of the recently described nectarine stem pitting associated virus (NSPaV), with only four open reading frames, encoding replication-related proteins, the coat protein (CP), and a CP readthrough protein involved in the aphid transmission of luteovirids. Phylogenic and pairwise distance analyses showed that this virus shares 79% and 57.8% amino acid identity in the P1-P2 fusion protein and the P3-P5 protein, respectively, with the most closely related luteovirus, NSPaV, suggesting that it represents a novel species, for which the name "Almond associated luteovirus 1" is proposed. To our knowledge, this is the first report of an almond-infecting luteovirus.

Molecular diversity of grapevine Kizil Sapak virus and implications for its detection.

To characterize their virome, double stranded RNAs extracted from scrapings of two Iranian grapevine varieties held in the Vassal-Montpellier Grapevine Biological Resources Center were analysed by high-throughput sequencing. In addition to several well-known grapevine viruses, divergent isolates of the newly described grapevine Kizil Sapak virus were identified in both accessions. Four complete genome sequences were determined, as well as two additional partial sequences (1,580 and 3,849 nucleotides long). These genomic sequences highlight the molecular diversity of this poorly known virus. In view of the absence of amplification of the GKSV isolates characterized here using the published primer pair, novel degenerate, polyvalent primers were designed, providing a more robust diagnosis.

Yam asymptomatic virus 1, a novel virus infecting yams (Dioscorea spp.) with significant prevalence in a germplasm collection.

A novel virus infecting yams (Dioscorea spp.), tentatively named "yam asymptomatic virus 1" (YaV1), was characterized and sequenced from an asymptomatic D. alata plant from Vanuatu. Sequence comparisons and phylogenetic analysis showed that YaV1 is a novel ampelovirus and has the smallest genome among "subgroup 1" members. RT-PCR-based screening of a yam germplasm collection conserved in Guadeloupe showed that YaV1 is prevalent in D. alata, D. bulbifera, D. cayennensis subsp. rotundata, D. esculenta and D. trifida accessions but causes no apparent symptoms. Additional phylogenetic analysis revealed a low variability of YaV1 in Guadeloupe in a limited part of the genome, and suggested the occurrence of plant-to-plant transmission.

First Report of Alfalfa mosaic virus in Chayote in Italy.

Chayote (Sechium edule (Jacq.) Sw.) is a vigorous perennial and climbing cucurbits, native to Mesoamerica, and cultivated for alimentary purposes in the American continent, Australia, New Zealand, South Europe, Asia and Africa. During spring 2019, some chayote plants showing bright yellow vein banding rings and lines were observed in a private garden in South Italy (Campania region). Symptoms coalesced in some leaves, covering almost the whole foliar area. Double-stranded RNAs were extracted from symptomatic leaves of a single chayote plant and reverse-transcribed, randomly amplified, and submitted to Illumina sequencing (Marais et al., 2018). Reads were assembled using CLC Genomics Workbench 11.1 (http://www.clcbio.com). Contigs were then annotated by Blastn and Blastx comparison with the Genbank database, which allowed the identification of eight contigs of between 380 and 980 nucleotides sharing significant identity with alfalfa mosaic virus (AMV) genomic RNAs. No other viral contigs were identified. Mapping of reads on AMV genomic RNAs identified 4,209 AMV reads (1.26% of total reads) and allowed the scaffolding of the contigs into three scaffolds corresponding to the three AMV genomic RNAs. To complete the sequence of the AMV chayote isolate genome (named See-1), primers were designed from the contig sequences and used to amplify RACE PCR products spanning the 5' and 3' terminal regions of the three genomic RNAs using the SMARTer™ RACE cDNA Amplification Kit (Clontech, China). All amplicons were cloned into the pGEM-T vector (Promega, USA) and sequenced (three clones for each amplicon) by Microsynth Seqlab (Microsynth AG, Switzerland). Finally, the complete genomic sequences of the three RNAs were assembled by MacVector 17.5 (MacVector Inc., USA). The RNA1, RNA2 and RNA3 of See-1 are 3,643, 2,593 and 2,037 nt respectively (GenBank accession Nos. MT093209 to MT093211), and share the highest nt sequence identity with the RNA1 and RNA3 of AMV isolate (HZ) from tobacco (99.5% for RNA1, HQ316635; 98.7% for RNA3, HQ316637) and with the RNA2 of isolate AMV-Gym from Gynostemma pentaphyllum (98.1%, MH332898), both from China. AMV isolate See-1 was classified as belonging to subgroup I based on the presence of a BamH I and two AvaII sites in the CP ORF (Parrella et al., 2000). Reverse transcription polymerase chain reaction, using primers targeting the CP gene (Parrella et al., 2000), confirmed AMV infection in three symptomatic cayote plants including that used for Illumina sequencing, with 100% of nt sequence identity of amplicons. Three plants each of Chenopodium amaranticolor, Nicotiana benthamiana and Solanum lycopersicon were mechanically inoculated with sap from isolate See-1 infected plant, leading to the appearance of typical AMV symptoms in all three hosts ten days post-inoculation (Jaspars & Bos, 1980). This note describes the first detection of AMV in cayote in Italy and, to the best of our knowledge, in the world. In some areas of Southern Italy, climatic conditions are favorable enough to allow chayote development in the wild. Further studies would be desirable to determine the distribution and incidence of AMV in chayote and to understand the possibility that this species may play a role in AMV epidemiology, representing a threat to other susceptible crops.

First report of lettuce necrotic leaf curl virus infecting cultivated lettuce in France.

Lettuce necrotic leaf curl virus (LNLCV, genus Torradovirus, family Secoviridae) has a bipartite single-stranded RNA genome and has so far only been reported in the Netherlands in open field lettuce (Verbeek et al. 2014). It was the first Torradovirus described from non-tomato host and, contrary to whitefly-transmitted tomato torradoviruses, aphids are its natural vectors (Verbeek et al. 2017). In October 2019, a symptomatic lettuce (JG3, cv. "Tregoney") was collected in an open field in southwestern France. Symptoms included stunted and deformed leaves with light necrosis and yellow spotting along minor veins of older leaves. Double-stranded RNAs were purified from JG3 leaves as described (Marais et al. 2018) and a cDNA library prepared and analyzed by Illumina NovaSeq sequencing. Analysis of sequence data identified two nearly fully assembled RNAs integrating respectively 28.9% and 60.9% of the sequencing reads and sharing respectively 85.5% and 83.3% nucleotide (nt) identity with the RNAs 1 and 2 of the LNLCV reference isolate, (NC_035214 and NC_035219, respectively). To confirm the presence of LNLCV in the original JG3 plant, it was used to mechanically inoculate indicator Nicotiana benthamiana, Chenopodium quinoa and C. amaranticolor plants. Only N. benthamiana developed symptoms, in the form of smaller and yellowed leaves. All inoculated plants were tested one month post-inoculation for the presence of LNLCV. Total RNAs were extracted according to Foissac et al. (2005) and used for RT-PCR tests with primers designed from the alignment between NC_035214 and our RNA1 sequence (LNLCV-S 5'-ATATTTTCCAAGTTGGAGGCTC-3' and LNLCV-R 5'-AGTRACAAAGGGACTAACTG-3'). LNLCV was detected in 3 out of 4 inoculated N. benthamiana plants. The full length RNA1 sequence (7577 nt) and the near complete RNA2 (5286 nt, lacking 3 nt at the 5' end as compared to NC_035219) could be assembled from the JG3 sequencing data and have been deposited in GenBank (MW172270 and MW172271, respectively). The lettuce JG3 isolate RNA1 shows 86.5% nt identity with the reference isolate while the taxonomically informative protease-polymerase regions share 96.8% aa identity. JG3 RNA2 shares 84.8% nt identity with NC_035219 while the movement protein and capsid subunits share respectively 92.5% and 98.3% aa identity. The smaller upstream ORF that slightly overlaps with the large MP-CP1/2/3 ORF is also conserved and shows 94.8% aa identity with the reference isolate. To our knowledge, this represents the first report of a natural infection of LNLCV in cultivated lettuce in France and anywhere outside the Netherlands. Since no other viruses were detected in the sequence dataset, LNLCV is most likely responsible for the mild necrosis and leaf deformation symptoms observed on the JG3 plant that appear to be similar to those initially described for LNLCV (Verbeek et al. 2014). While the pathogenicity of LNLCV in lettuce appears to be firmly established, further studies are needed to establish its distribution and prevalence, to understand why this pathogenic and aphid-transmitted virus is not more widely reported and whether it has the potential to increase in impact as a potential emerging agent on field lettuce crops.

Determination of the complete genomic sequence of grapevine virus H, a novel vitivirus infecting grapevine.

The present work reports the discovery and the complete genome sequencing of a novel member of the genus Vitivirus in the family Betaflexiviridae (subfamily Trivirinae) from a symptomless grapevine of unknown variety from Portugal. Total RNAs extracted from phloem scrapings were sequenced using Illumina technology. Bioinformatic analysis of the RNA-seq data revealed a mixed infection involving three viruses and two viroids in addition to a novel vitivirus. Completion and analysis of the genome sequence (7446 nt excluding the polyA tail) showed a typical vitivirus genomic organization. Phylogenetic analysis of the various ORFs clearly showed the new virus to belong in the genus Vitivirus, but sequence divergence firmly establishes it as a member of a new species, for which the name "Grapevine virus H" is proposed.

Genome characterization of a divergent isolate of the mycovirus Botrytis virus F from a grapevine metagenome.

As part of a grapevine metagenome study, total RNA extracted from grapevine phloem scrapings was analyzed by Illumina sequencing. For one 420A rootstock sample, reads mapping against a reference database and BLAST annotation of contigs identified the presence of a divergent isolate of Botrytis virus F (BVF). The full genome sequence of this isolate (IVC-5-77) was determined (6,828 nucleotides [nt], excluding the poly(A) tail) and shown to be collinear with that of the BVF reference isolate, with the two open reading frames encoding a replication-associated protein (REP) and a coat protein (CP). The IVC-5-77 isolate, however, is very divergent, showing only 81.3-81.6% nucleotide sequence identity to the two other sequenced BVF isolates. The internal non-coding region was also found to be highly variable between BVF isolates. Analysis of the RNASeq reads demonstrated that close to 20% of them belong to Botrytis cinerea, the putative host of the IVC-5-77 isolate. These results extend our knowledge of the diversity and variability of BVF and demonstrate its detectability, together with that of its B. cinerea host, in total RNA RNASeq data from grapevine phloem scrapings.