Hepatic ZBTB22 promotes hyperglycemia and insulin resistance via PEPCK1-driven gluconeogenesis.

Excessive gluconeogenesis can lead to hyperglycemia and diabetes through as yet incompletely understood mechanisms. Herein, we show that hepatic ZBTB22 expression is increased in both diabetic clinical samples and mice, being affected by nutritional status and hormones. Hepatic ZBTB22 overexpression increases the expression of gluconeogenic and lipogenic genes, heightening glucose output and lipids accumulation in mouse primary hepatocytes (MPHs), while ZBTB22 knockdown elicits opposite effects. Hepatic ZBTB22 overexpression induces glucose intolerance and insulin resistance, accompanied by moderate hepatosteatosis, while ZBTB22-deficient mice display improved energy expenditure, glucose tolerance, and insulin sensitivity, and reduced hepatic steatosis. Moreover, hepatic ZBTB22 knockout beneficially regulates gluconeogenic and lipogenic genes, thereby alleviating glucose intolerance, insulin resistance, and liver steatosis in db/db mice. ZBTB22 directly binds to the promoter region of PCK1 to enhance its expression and increase gluconeogenesis. PCK1 silencing markedly abolishes the effects of ZBTB22 overexpression on glucose and lipid metabolism in both MPHs and mice, along with the corresponding changes in gene expression. In conclusion, targeting hepatic ZBTB22/PEPCK1 provides a potential therapeutic approach for diabetes.

Characterization of the CT-based risk factors for concomitant patellofemoral instability in patients with anterior cruciate ligament injury.

OBJECTIVES: Underestimation of concomitant patellofemoral instability in patients with anterior cruciate ligament (ACL) injury has aroused extensive attention. However, the characteristics of the combined injury is not well recognized. Hence, we aimed to characterize the features of the combined injury, and determine the radiographic risk factors. METHODS: Fifteen radiological parameters were identified after discussion and pilot-tested. Radiographic measurements were compared using the analysis of variance model with Tukey post hoc analysis. A stepwise binomial logistic regression was performed and a nomogram model combining the significant risk factors was created. The model performance was validated by C-index, calibration plot, and decision curve. RESULTS: A total of 204 patients (mean [SD] age, 25.1 [6.7] years; 108 [52.9%] male) were included. The final model was updated through regression analysis using 4 parameters as significant risk factors: lateral femoral condyle ratio (OR (95% CI), 1.194 (1.023 to 1.409)), medial anterior tibial subluxation (mATS) (OR (95% CI), 1.234 (1.065 to 1.446)), medial posterior plateau tibial angle (mPPTA) (OR (95% CI), 1.266 (1.088 to 1.500)), and trochlear depth (OR (95% CI), 0.569 (0.397 to 0.784)). C-index for the nomogram was 0.802 (95% CI, 0.731 to 0.873) and was confirmed to be 0.784 through bootstrapping validation. Calibration plot established a good agreement between prediction and observation. Decision curve analysis showed that if threshold probability was over 10%, using the nomogram adds more benefit than either all or none scheme. CONCLUSIONS: Lateral femoral condyle ratio, mATS, mPPTA, and trochlear depth are strong adverse predictors of patellofemoral instability in patients with ACL injury. CLINICAL RELEVANCE: This study characterizes the radiological features of the combined injury. Patellofemoral instability should be noted when treating ACL injuries. KEY POINTS: • The radiological characteristics of the combined ACL injury and patellofemoral instability is not well recognized. • Lateral femoral condyle ratio, mATS, mPPTA, and trochlear depth are predominant risk factors for patellofemoral instability in patients with ACL injury. • Patellofemoral instability should be noted when treating ACL injuries.

Theoretical study on electrocatalytic carbon dioxide reduction over copper with copper-based layered double hydroxides.

The conversion of CO2 into valuable fuels and multi-carbon chemical substances by electrical energy is an effective strategy to solve environmental problems by using renewable energy sources. In this work, the density functional theory (DFT) method is used to reveal the electrocatalytic mechanism of CO2 reduction reaction (CO2RR) over the surface of CuAl-Cl-layered double hydroxides (LDHs) with Cu monoatoms (Cu@CuAl-Cl-LDH), Cu2 diatoms (Cu2@CuAl-Cl-LDH), orthotetrahedral Cu4 clusters (Td-Cu4@CuAl-Cl-LDH) and planar Cu4 clusters (Pl-Cu4@CuAl-Cl-LDH). The active sites, density of states, adsorption energy, charge density difference and free energy are calculated. The results show that CO2RR over all the above five catalysts can generate C2 products. Pl-Cu4@CuAl-Cl-LDH tends to generate C2H5OH, while the remaining four structures all tend to produce C2H4. Cuδ+ favors CO2RR, and Td-Cu4@CuAl-Cl-LDH with a larger positively charged area at the active site has the better electrocatalytic performance among the calculated systems with a maximum step height of 0.78 eV. The selectivity of the products C2H4 and C2H5OH depends on the dehydration of the intermediate *C2H2O to *C2H3O or *CCH; if the dehydration produces *CCH intermediate, the final product is C2H4, and if no dehydration occurs, C2H5OH is produced. This work provides theoretical information and guidance for further rational design of efficient CO2RR catalysts for energy saving and emission reduction.

Associations between organophosphate esters and bone mineral density in adults in the United States: 2011-2018 NHANES.

BACKGROUND: Organophosphate esters (OPEs) are used extensively as flame retardants and plasticizers. Laboratory studies have shown that OPEs exhibit osteotoxicity by inhibiting osteoblast differentiation; however, little is known about how OPEs exposure is associated with bone health in humans. OBJECTIVES: We conducted a cross-sectional study to investigate the association between OPEs exposure and bone mineral density (BMD) in adults in the United States using data from the 2011-2018 National Health and Nutrition Examination Survey (NHANES). METHODS: Multivariate linear regression models were used to assess the association between concentrations of individual OPE metabolites and BMDs. We also used the Bayesian kernel machine regression (BKMR) and quantile g-computation (qgcomp) models to estimate joint associations between OPE mixture exposure and BMDs. All the analyses were stratified according to gender. RESULTS: A total of 3546 participants (median age, 40 years [IQR, 30-50 years]; 50.11% male) were included in this study. Five urinary OPE metabolites with a detection rate of > 50% were analyzed. After adjusting for the potential confounders, OPE metabolite concentrations were associated with decreased total-body BMD and lumbar spine BMD in males, although some associations only reached significance for bis(1-chloro-2-propyl) phosphate (BCPP), dibutyl phosphate (DBUP), and bis(2-chloroethyl) phosphate (BCEP) (ß = -0.013, 95% CI: -0.026, -0.001 for BCPP and total-body BMD; ß = -0.022, 95% CI: -0.043, -0.0001 for DBUP and lumbar spine BMD; ß=-0.018, 95% CI: -0.034, -0.002 for BCEP and lumbar spine BMD). OPE mixture exposure was also inversely associated with BMD in males, as demonstrated in the BMKR and qgcomp models. CONCLUSIONS: This study provides preliminary evidence that urinary OPE metabolite concentrations are inversely associated with BMD. The results also suggested that males were more vulnerable than females. However, further studies are required to confirm these findings.

First Report of Colletotrichum fructicola Causing Leaf Spot on Smilax glabra Roxb in China.

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

Astaxanthin Alleviates the Process of Cardiac Hypertrophy by Targeting the METTL3/Circ_0078450/MiR-338-3p/GATA4 Pathway.

Astaxanthin (ASX) is a natural antioxidant with preventive and therapeutic effects on various human diseases. However, the role of ASX in cardiac hypertrophy and its underlying molecular mechanisms remain unclear.Cardiomyocytes (AC16) were used with angiotensin-II (Ang-II) to mimic the cardiac hypertrophy cell model. The protein levels of hypertrophy genes, GATA4, and methyltransferase-like 3 (METTL3) were determined by western blot analysis. Cell size was assessed using immunofluorescence staining. The expression of circ_0078450, miR-338-3p, and GATA4 were analyzed by quantitative real-time PCR. Also, the interaction between miR-338-3p and circ_0078450 or GATA4 was confirmed by dual-luciferase reporter and RIP assays, and the regulation of METTL3 on circ_0078450 was verified by MeRIP and RIP assays.ASX reduced the hypertrophy gene protein expression and cell size in Ang-II-induced AC16 cells. Circ_0078450 was promoted under Ang-II treatment, and ASX reduced circ_0078450 expression in Ang-II-induced AC16 cells. Circ_0078450 could sponge miR-338-3p to positively regulate GATA4 expression, and GATA4 overexpression overturned the suppressive effect of circ_0078450 knockdown on Ang-II-induced cardiomyocyte hypertrophy. Also, the inhibitory effect of ASX on Ang-II-induced cardiomyocyte hypertrophy could be reversed by circ_0078450 or GATA4 overexpression. In addition, METTL3 mediated the m6A methylation of circ_0078450 to enhance circ_0078450 expression. Moreover, METTL3 knockdown suppressed Ang-II-induced cardiomyocyte hypertrophy by inhibiting circ_0078450 expression.Our data showed that ASX repressed cardiac hypertrophy by regulating the METTL3/circ_0078450/miR-338-3p/GATA4 axis.

A laser-induced graphene-based electrochemical immunosensor for nucleic acid methylation detection.

The detection of methylation in DNA and RNA is essential for the diagnosis and treatment of a wide range of diseases. A one-step fabricated laser-induced graphene (LIG) electrode has received increasing attention due to its good electrical conductivity, large specific surface area, ease of miniaturization, low cost and flexibility. Herein, a potential biosensor for N6-methyladenosine (m6A-RNA) and 5-methylcystosine-single strand DNA (5mC-ssDNA) detection was designed. The aim of this paper is to address the problem of detecting the m6A-RNA and 5mC-ssDNA content in cells. By stepwise modification of gold nanoparticles (AuNPs), sulfhydryl-modified nucleic acid chains, biotin-modified antibodies, and streptavidin-modified horseradish peroxidase (SA-HRP) at the LIG electrode, the peak current responses exhibited an increase proportional to the concentration of m6A-RNA and 5mC-ssDNA in the hydrogen peroxide-hydroquinone (H2O2-HQ) system. This method demonstrated a low detection limit of 2.81 pM for m6A-RNA and 9.53 pM for 5mC-ssDNA, with a linear detection range of 0.01 nM to 10 nM for both targets. The regression equation was determined as ΔI = 4.83 log c + 12.32 (R2 = 0.9980) for m6A-RNA and ΔI = 9.82 log c + 22.09 (R2 = 0.9903) for 5mC-ssDNA. Our method has good selectivity toward different detection targets of nucleic acid chains, stability for long-term storage and consecutive scanning (RSD of 9.42% and 2.08%, respectively) and reproducibility of 5 electrodes (RSD of 6.85%). This method utilizes gold-sulfur bonding to immobilize the detection target, which improves the conductivity of the LIG electrode and introduces an amplified portion of the signal by taking advantage of antigen-antibody specific binding. Thus, dual detection of m6A-RNA and 5mC-ssDNA was realized. Importantly, this approach is successfully applied for the detection of targets in spiked samples extracted from HeLa cells, suggesting its potential for clinical applications and providing a new perspective for the development of point-of care testing (POCT) techniques.

A DFT study on methanol decomposition over single atom Pt/CeO2 catalysts: the effect of the position of Pt.

Pt/CeO2 catalysts exhibit excellent catalytic performance for the methanol dehydrogenation (MD) reaction. In this work, MD reactions on three systems of Pt1/CeO2(110)), Pt7/CeO2(110), and Pt1/Ce1-xO2(110) are investigated via density functional theory (DFT) calculations. The CH3OH adsorption, electronic structure of the catalyst, and mechanism of methanol decomposition (MD) are systematically calculated. The results reveal that the d-band center of the Pt atom moves away from the Fermi level in the order of Pt1/CeO2(110) < Pt7/CeO2(110) < Pt1/Ce1-xO2(110), and the order of the activity of the MD reaction is Pt1/CeO2(110) < Pt7/CeO2(110) < Pt1/Ce1-xO2(110). The results of the microkinetic dynamics simulation verify that only Pt1/Ce1-xO2(110) is conducive to the decomposition of methanol at low temperatures (373 K), and the products CO and H2 are easily dissociated from the catalyst surface. This work uncovers that both the small size and the Ce vacancy substituted sites of Pt favor the performance of the Pt/CeO2 catalyst, and provides theoretical guidance for the construction and design of efficient metal-support catalysts for the MD reaction.

Genetic variants in epoxyeicosatrienoic acid processing and degradation pathways are associated with gestational diabetes mellitus.

AIM: To explore the genetic effects of CYP2C8, CYP2C9, CYP2J2, and EPHX2, the key genes involved in epoxyeicosatrienoic acid processing and degradation pathways in gestational diabetes mellitus (GDM) and metabolic traits in Chinese pregnant women. METHODS: A total of 2548 unrelated pregnant women were included, of which 938 had GDM and 1610 were considered as controls. Common variants were genotyped using the Infinium Asian Screening Array. Association studies of single nucleotide polymorphisms (SNPs) with GDM and related traits were performed using logistic regression and multivariable linear regression analyses. A genetic risk score (GRS) model based on 12 independent target SNPs associated with GDM was constructed. Logistic regression was used to estimate odds ratios and 95% confidence intervals, adjusting for potential confounders including age, pre-pregnancy body mass index, history of polycystic ovarian syndrome, history of GDM, and family history of diabetes, with GRS entered both as a continuous variable and categorized groups. The relationship between GRS and quantitative traits was also evaluated. RESULTS: The 12 SNPs in CYP2C8, CYP2C9, CYP2J2, and EPHX2 were significantly associated with GDM after adjusting for covariates (all P < 0.05). The GRS generated from these SNPs significantly correlated with GDM. Furthermore, a significant interaction between CYP2J2 and CYP2C8 in GDM (PInteraction = 0.014, ORInteraction= 0.61, 95%CI 0.41-0.90) was observed. CONCLUSION: We found significant associations between GDM susceptibility and 12 SNPs of the four genes involved in epoxyeicosatrienoic acid processing and degradation pathways in a Chinese population. Subjects with a higher GRS showed higher GDM susceptibility with higher fasting plasma glucose and area under the curve of glucose and poorer ß-cell function.

The Degree of Anxiety and Depression in Patients With Cardiovascular Diseases as Assessed Using a Mobile App: Cross-Sectional Study.

BACKGROUND: Depression and anxiety are common comorbidities in cardiovascular clinic outpatients. Timely identification and intervention of these mental and psychological disorders can contribute to correct diagnosis, better prognosis, less medical expenses, and improved quality of life. The convenience of online doctor-patient communication platforms has increasingly attracted patients to online consultations. However, online health care and offline health care are very different. Research on how to identify psychological disorders in patients who engage in an online cardiology consultation is lacking. OBJECTIVE: This study aimed to explore the feasibility of using a self-rating scale to assess mental illness among patients who consult with a cardiologist online and to compare the differences in anxiety and depression between online and offline patients. METHODS: From June 2022 to July 2022, we conducted follow-up visits with 10,173 patients on the Haodf platform. We conducted detailed consultations with 286 patients who visited the same cardiologist in the outpatient department. We used the self-rated Generalized Anxiety Disorder (GAD-7) and Patient Health Questionnaire (PHQ-9) scales to assess anxiety and depression, respectively. We analyzed the influencing factors related to the degree of coordination of online patients. We also compared the prevalence of anxiety or depression between online and offline patients and analyzed the factors related to anxiety or depression. RESULTS: Of the 10,173 online consultation patients, only 186 (1.8%) responded effectively. The response rate of the offline consultation patients was 96.5% (276/286). Frequent online communication and watching live video broadcasts were significantly related to effective responses from online patients (P<.001). The prevalence of anxiety (70/160, 43.7% vs 69/266, 25.8%; P<.001) or depression (78/160, 48.7% vs 74/266, 27.7%; P<.001) in online consultation patients was significantly higher than that in offline patients. In bivariate analyses, the factors related to anxiety included female sex, unemployment, no confirmed cardiovascular disease, and the online consultation mode, while smokers and those who underwent COVID-19 quarantine were less likely to present with anxiety. The factors related to depression included female sex, divorced or separated individuals, and the online consultation mode. COVID-19 quarantine was related with a lower likelihood of depression. BMI was negatively correlated with depression. In multiple ordered logistic regression analysis, women were more likely than men to present with anxiety (odds ratio [OR] 2.181, 95% CI 1.365-3.486; P=.001). Women (OR 1.664, 95% CI 1.082-2.559; P=.02) and online patients (OR 2.631, 95% CI 1.305-5.304; P=.007) were more likely to have depression. CONCLUSIONS: Online patients had more anxiety or depression than offline patients. Anxiety was more prevalent in women, the unemployed, and those without confirmed cardiovascular disease. Women and divorced or separated individuals were more prone to depression. Increasing the frequency of doctor-patient communication and participating in video interactions can help improve patient cooperation.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Identification of Fusarium sacchari Causing Foliar Blight on Begonia semperflorens in China.

Begonia semperflorens Link et Otto (Begoniaceae) is a flowering, ornamental plant widely cultivated in China. In April of 2020, a foliar blight disease on B. semperflorens was observed in plant nurseries (∼0.2 ha), with ~ 20% disease incidence (n = 150) in Nanning, Guangxi Province, China. Initial symptoms included irregular to circular, grayish white spots surrounded by a dark brown halo, mainly scattered on the edges the leaves. In severe infections, the spots frequently coalesced to form large, blighted areas, followed by defoliation. To isolate the pathogen, three representative plants exhibiting symptoms were collected from the nurseries. Leaf tissues (5 × 5 mm) were cut from the margin of necrotic lesions (n = 18), surface disinfected in 1% NaOCl for 2 min, then rinsed three times in sterile H2O. Then the tissues were plated on potato dextrose agar (PDA), and incubated at 28°C (12 h photoperiod) for 3 days. Hyphal tips from recently germinated spores were transferred to PDA to purify fungal isolates. A total of 11 isolates (85% isolation frequency) with similar morphological characteristics were obtained. Colonies on PDA plates were villose, had a dense growth of white aerial mycelia and appeared pale but becoming violet with age. On Spezieller Nährstoffarmer Agar (SNA), the macroconidia were slender, slight falcate, two to three septate, and 23.5 to 48.8 × 2.8 to 4.8 µm (n = 60), and the microconidia were abundant and formed in false heads on monophialides or polyphialides, slim, oval, zero to one septate, and 7.8 to 22.4 × 2.4 to 4.0 µm (n = 60). For molecular identification, the internal transcribed spacer (ITS) region of rDNA, and partial translation elongation factor-1 alpha (TEF-1α), and RNA polymerase second largest subunit (RPB2) genes of the representative isolate HT-2B were amplified and sequenced using primer pairs ITS1/ITS4 (White et al. 1990), EF-1/EF-2 (O'Donnell et al. 1998), and 5f2/11ar (Liu et al. 1999, Reeb et al. 2004), respectively. The obtained sequences were deposited in NCBI GenBank under the accession numbers OQ048268 (TIS), OP994260 (TEF-1α), OP994262 (RPB2) and showed 99.4%, 99.8%, and 99.4% similarity with the corresponding sequences (X94168，AF160278，and JX171580, respectively) of Fusarium sacchari from type material. In addition, a phylogenetic analysis showed that HT-2B was grouped with F. sacchari. Therefore, based on morphological (Leslie et al. 2005) and molecular characteristics, the isolates were identified as F. sacchari. To test pathogenicity, three healthy leaves on each of three B. semperflorens plants were stab-wounded with a sterile syringe and inoculated with a 10-µl droplet of a conidial suspension (106 spores/ml) of the isolate HT-2B. As a control, another three leaves were wound inoculated with sterilized dH2O. All plants were enclosed in transparent plastic bags and incubated in a greenhouse at 28°C (12 h photoperiod, ~ 80% relative humidity). Six days post-inoculation, symptoms appeared on the inoculated leaves. No symptoms were detected on control plants. Experiments were replicated three times with similar results. To fulfill Koch's postulates, the F. sacchari isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of F. sacchari causing foliar blight on B. semperflorens in China. This result will help develop management strategies for this disease.

Inhibition of lipogenesis and sebum secretion for Lotus corniculatus seed extract in vitro and in vivo.

BACKGROUND: Botanical ingredients are widely used in hair- and skin-care products. However, few studies have investigated the effectiveness of botanical products on counteracting sebum synthesis and secretion. OBJECTIVE: To investigate the composition of Lotus corniculatus seed extract (LC) and its potential inhibition of lipogenesis in SZ95 sebocytes and oily human skin. METHODS: The active components of LC solutions were identified by high-performance liquid chromatography (HPLC) and nuclear magnetic resonance (NMR). The in vitro effects of LC were evaluated using SZ95 cells treated with linoleic acid (LA) and dihydrotestosterone (DHT) and incubated with LCs for 24 h and 72 h. Lipogenesis was assessed by Oil Red O and Nile Red staining of the cells. In vivo effects were assessed on 30 subjects with oily skin who were enrolled in a randomized, blank-controlled trial and were treated with LC solution for 6 h and 4 weeks. The skin sebum contents and area on the forehead and cheeks were evaluated using a Sebumeter SM815 and Sebfix sebutape with Visioscan VC98. In addition, VISIA was used to collect half-face photos for analysis. RESULTS: A novel active molecule, 5'-o-rhamnosyl uridine, was identified in LC. LC exhibited a dose-dependent inhibitory effect on LA and DHT-induced lipid synthesis. When 5% LC was applied for 3 h, the skin sebum contents and area were significantly reduced compared with the vehicle control, with an obvious reduction after 6 h. Continued use of the serum containing 5% LC for 4 weeks resulted in a significant reduction in the skin sebum contents and area. No adverse reactions were reported during the study. CONCLUSIONS: Topical application of LC resulted in an immediate and long-lasting reduction of the sebum contents and area of oily human skin by reducing sebaceous lipogenesis through the LA and DHT pathways. This indicates the potential of LC as a new biological treatment for oily skin.

CONTEXTE: Les ingrédients végétaux sont largement utilisés dans les produits de soins des cheveux et de la peau. Cependant, peu d'études ont examiné l'efficacité des produits végétaux dans l'inhibition de la synthèse et de la sécrétion de sébum. OBJECTIF: Étudier les composants de l'extrait de graines de lotus (LC) et son effet inhibiteur potentiel sur la lipogenèse des cellules sébacées SZ95 et de la peau grasse. MÉTHODES: Les composants actifs de la solution LC ont été identifiés par chromatographie liquide à haute performance (HPLC) et par résonance magnétique nucléaire (NMR). Les effets de la LC in vitro ont été évalués à l'aide de cellules SZ95 traitées à l'acide linoléique (LA) et à la dihydrotestostérone (DHT) et incubées avec la LC pendant 24 et 72 heures. Les effets in vivo ont été évalués chez 30 sujets à peau grasse qui ont participé à un essai contrôlé randomisé à blanc et qui ont été traités avec une solution de LC pendant 6 heures et 4 semaines. Le sebumeter SM815 et le sebfix sebutape et le visioscan VC98 ont été utilisés pour évaluer la teneur en sébum et la surface de la peau sur le front et les joues. De plus, des photos de demi - visage ont été recueillies pour analyse à l'aide de VISIA. RÉSULTATS: Une nouvelle molécule active, 5'-o-rhamnosyluridine, a été identifiée dans la LC. La LC a un effet inhibiteur dose - dépendant sur la synthèse lipidique induite par LA et DHT. La teneur et la surface du sébum cutané ont été significativement diminuées par rapport à celles du support photographique après 3 heures d'application de 5% de LC, et significativement diminuées après 6 heures. L'utilization de sérum contenant 5% de LC pendant quatre semaines consécutives a entraîné une réduction significative de la teneur en sébum et de la surface de la peau. Aucun effet indésirable n'a été signalé au cours de l'étude. CONCLUSION: L'application topique de LC peut réduire la production de sébum par les voies LA et DHT, ce qui réduit immédiatement et durablement la teneur en sébum et la surface de la peau huileuse humaine. Cela démontre le potentiel de la LC en tant que nouveau traitement biologique de la peau huileuse.

COVID-19 vaccination coverage among patients with psychiatric disorders in China during the pandemic: a cross-sectional study.

BACKGROUND: To investigate the Coronavirus Disease 2019 (COVID-19) vaccination coverage and the influential factors of vaccination among patients with mental disorders, we conducted a cross-sectional study in China. METHOD: The anonymous questionnaires including demographic data, vaccination status, intention to be vaccinated and its reasons were collected in the Second Xiangya Hospital, one of the biggest four psychiatric centers in China. Mental health of these participants were measured by the Patient Health Questionnaire (PHQ-9) and the Generalized Anxiety Disorder-7 items (GAD-7). The influential factors associated with vaccination status were analyzed by Fisher exact tests and binary logistical analysis. RESULT: 1328 patients and 922 family members completed the survey. The vaccination rate of patients included was 69.4%, whereas 85.5% patients were willing to be vaccinated. Being hospitalized (aOR 0.41, 95% CI:0.27-0.60), suffering from schizophrenia (aOR 0.38, 95% CI: 0.19-0.75) and secondary school educational background (aOR 0.58, 95% CI: 0.37-0.93) were significantly associated with less likelihood to get vaccinated. Uptaking vaccines could reduce depressive (aOR 0.63, 95% CI: 0.41-0.98) or anxious symptoms (aOR 0.40, 95% CI: 0.25-0.63) in these patients for a short period. CONCLUSION: Further COVID-19 immunization programme should prioritize hospitalized psychiatric patients and schizophrenic patients since their demands for vaccination had been partly ignored during the current inoculation.

Bioinformatic Analysis Identifying PSMB 1/2/3/4/6/8/9/10 as Prognostic Indicators in Clear Cell Renal Cell Carcinoma.

Renal cancer incidence has been increasing across the world, clear cell renal cell carcinoma (ccRCC) represents the major subtype of renal cancer. The proteasome is involved in onset, metabolism and survival of tumor and has been recognized as a therapeutic target for various malignancies, while the role of ß subunits of proteasome, PSMB gene family, in ccRCC has not been fully unveiled. Herein we investigated the expression and the prognostic role of PSMBs in ccRCC by analyzing a series of databases, including ONCOMINE, UALCAN, cBioPortal, STRING, GEPIA, GO and KEGG. Over-expressions of PSMB1/2/4/7/8/9/10 mRNA were found in ccRCC tissues compared to normal tissues, transcriptional levels of PSMB2/3/4/6/8/9/10 were significantly positively associated with patients' individual cancer stages and grades. Similar or higher levels of proteins encoded by PSMB1/2/3/7/8/9/10 were observed in tumor tissues compared to normal renal tissues. Further, high mRNA levels of PSMB1/2/3/4/6/10 were correlated with shorter overall survival in univariate analysis. Taken together, the results of our analysis implied that overexpression of PSMB1/2/3/4/6/8/9/10 were indicative of worse prognosis of ccRCC. However, further researches were required to validate our findings.

Constitutive modeling of strain-dependent bond breaking and healing kinetics of chemical polyampholyte (PA) gel.

A finite strain nonlinear viscoelastic constitutive model is used to study the uniaxial tension behaviour of chemical polyampholyte (PA) gel. This PA gel is cross-linked by chemical and physical bonds. Our constitutive model attempts to capture the time and strain dependent breaking and healing kinetics of physical bonds. We compare model prediction by uniaxial tension, cyclic and relaxation tests. Material parameters in our model are obtained by least squares optimization. These parameters gave fits that are in good agreement with the experiments.

Time dependent fracture of soft materials: linear versus nonlinear viscoelasticity.

Toughness of soft materials such as elastomers and gels depends on their ability to dissipate energy and to reduce stress concentration at the crack tip. The primary energy dissipation mechanism is viscoelasticity. Most analyses and models of fracture are based on linear viscoelastic theory (LVT) where strains are assumed to be small and the relaxation mechanisms are independent of stress or strain history. A well-known paradox is that the size of the dissipative zone predicted by LVT is unrealistically small. Here we use a physically based nonlinear viscoelastic model to illustrate why the linear theory breaks down. Using this nonlinear model and analogs of crack problems, we give a plausible resolution to this paradox. In our model, viscoelasticity arises from the breaking and healing of physical cross-links in the polymer network. When the deformation is small, the kinetics of bond breaking and healing are independent of the strain/stress history and the model reduces to the standard linear theory. For large deformations, localized bond breaking damages the material near the crack tip, reducing stress concentration and dissipating energy at the same time. The damage zone size is a new length scale which depends on the strain required to accelerate bond breaking kinetics. These effects are illustrated by considering two cases with stress concentrations: the evolution of spherical damage in a viscoelastic body subjected to internal pressure, and a zero degree peel test.

Crucial roles of cadmium retention in nodeâ ¡ for restraining cadmium transport from straw to ear at reproductive period in a grain low-cadmium rice line (Oryza sativa L.).

Using an ideal parental line to breed hybrid rice with low cadmium (Cd) accumulation in grain is an environmental-friendly approach to reduce the risk of Cd contamination in field. A grain low-Cd rice line YaHui2816 has stably low Cd in grain but strong Cd accumulation in straw, revealing specific pattern of its straw-grain Cd remobilization is beneficial to effectively breed hybrid rice for safe production as well as phytoremediation. In this study, a pot experiment was conducted to investigate Cd partitioning of YaHui2816 at different stages by comparison with a common rice C268A. The Cd from lower nodes and leaves was restricted in nodeⅡ, this Cd retention led to weak Cd transport from straw to ear in YaHui2816. Cd concentration in nodeⅡ of YaHui2816 was 1.56-fold and 7.36-fold higher than C268A at filling and mature stages. Thus, glutathione (GSH) and phytochelatin (PC) concentration, PC synthase (OsPCS1), GSH S-Transferase (OsGST) and Cd-remobilization associated genes were measured at filling stage. OsHMA2 and OsCCX2 were up-regulated in nodeⅡ of YaHui2816, relative expression of them were significantly higher than C268A. PCs participated in Cd remobilization process, remarkable PC increase in nodeⅡ of YaHui2816 was found in response to Cd treatment under regulation of OsPCS1 and OsGST of which PC2 was dominant form. Taken as a whole, the Cd retention in nodeⅡ of YaHui2816 acts as a 'firewall' to restrain Cd transport to grain. This work provides more insight to understand possible function of alleles for reducing Cd concentration in grain as well as strengthening Cd accumulation in straw of YaHui2816.

Genotoxic effects of imidacloprid in human lymphoblastoid TK6 cells.

Among neonicotinoid insecticides, the fastest growing class of insecticides worldwide over the past decade, imidacloprid (IMI) is the most widely used one. The effects of IMI on human health, especially on genetic toxicity have gradually aroused more attention. In this study, a combined in vitro approach employing the thymidine kinase (TK) gene mutation assay, the comet assay and the micronucleus test was taken to assess the genotoxicity of IMI. The mechanism behind IMI was also explored by measuring reactive oxygen species (ROS) in the human lymphoblastoid TK6 cells. The cells were treated with 0.01, 0.1, 1, 5, and 10 µg/mL IMI, and ROS generation was measured by the use of 2,7,-dichlorofluorescin diacetate (DCFH-DA) assay. IMI significantly increased the micronucleus (MN) frequency, TK mutations and DNA damage with a dose-effect relationship, and the lowest effective concentration in those tests was 0.1 µg/mL. However, no obvious change of intracellular ROS was observed for any concentrations. The results indicate that IMI has potential genotoxic effects on TK6 cells, but ROS does not seem to be involved as a mechanism of genotoxicity under the experimental conditions.

Preventive treatment with ginsenoside Rb1 ameliorates monocrotaline-induced pulmonary arterial hypertension in rats and involves store-operated calcium entry inhibition.

CONTEXT: Ginsenoside Rb1, the main active ingredient of ginseng, exhibits ex vivo depression of store-operated calcium entry (SOCE) and related vasoconstriction in pulmonary arteries derived from pulmonary hypertension (PH) rats. However, the in vivo effects of ginsenoside Rb1 on PH remain unclear. OBJECTIVE: This study explored the possibility of using ginsenoside Rb1 as an in vivo preventive medication for type I PH, i.e., pulmonary arterial hypertension (PAH), and potential mechanisms involving SOCE. MATERIALS AND METHODS: Male Sprague-Dawley rats (170-180 g) were randomly divided into Control, MCT, and MCT + Rb1 groups (n = 20). Control rats received only saline injection. Rats in the MCT + Rb1 and MCT groups were intraperitoneally administered single doses of 50 mg/kg monocrotaline (MCT) combined with 30 mg/kg/day ginsenoside Rb1 or equivalent volumes of saline for 21 consecutive days. Subsequently, comprehensive parameters related to SOCE, vascular tone, histological changes and hemodynamics were measured. RESULTS: Ginsenoside Rb1 reduced MCT-induced STIM1, TRPC1, and TRPC4 expression by 35.00, 31.96, and 32.24%, respectively, at the protein level. SOCE-related calcium entry and pulmonary artery contraction decreased by 162.6 nM and 71.72%. The mean pulmonary artery pressure, right ventricle systolic pressure, and right ventricular mass index decreased by 19.5 mmHg, 21.6 mmHg, and 39.50%. The wall thickness/radius ratios decreased by 14.67 and 17.65%, and the lumen area/total area ratios increased by 18.55 and 15.60% in intrapulmonary vessels with 51-100 and 101-150 µm o.d. CONCLUSION: Ginsenoside Rb1, a promising candidate for PH prevention, inhibited SOCE and related pulmonary vasoconstriction, and relieved MCT-induced PAH in rats.