Effective drug combinations in breast, colon and pancreatic cancer cells.

Combinations of anti-cancer drugs can overcome resistance and provide new treatments1,2. The number of possible drug combinations vastly exceeds what could be tested clinically. Efforts to systematically identify active combinations and the tissues and molecular contexts in which they are most effective could accelerate the development of combination treatments. Here we evaluate the potency and efficacy of 2,025 clinically relevant two-drug combinations, generating a dataset encompassing 125 molecularly characterized breast, colorectal and pancreatic cancer cell lines. We show that synergy between drugs is rare and highly context-dependent, and that combinations of targeted agents are most likely to be synergistic. We incorporate multi-omic molecular features to identify combination biomarkers and specify synergistic drug combinations and their active contexts, including in basal-like breast cancer, and microsatellite-stable or KRAS-mutant colon cancer. Our results show that irinotecan and CHEK1 inhibition have synergistic effects in microsatellite-stable or KRAS-TP53 double-mutant colon cancer cells, leading to apoptosis and suppression of tumour xenograft growth. This study identifies clinically relevant effective drug combinations in distinct molecular subpopulations and is a resource to guide rational efforts to develop combinatorial drug treatments.

Correction: Plasmids manipulate bacterial behaviour through translational regulatory crosstalk.

[This corrects the article DOI: 10.1371/journal.pbio.3001988.].

Plasmids manipulate bacterial behaviour through translational regulatory crosstalk.

Beyond their role in horizontal gene transfer, conjugative plasmids commonly encode homologues of bacterial regulators. Known plasmid regulator homologues have highly targeted effects upon the transcription of specific bacterial traits. Here, we characterise a plasmid translational regulator, RsmQ, capable of taking global regulatory control in Pseudomonas fluorescens and causing a behavioural switch from motile to sessile lifestyle. RsmQ acts as a global regulator, controlling the host proteome through direct interaction with host mRNAs and interference with the host's translational regulatory network. This mRNA interference leads to large-scale proteomic changes in metabolic genes, key regulators, and genes involved in chemotaxis, thus controlling bacterial metabolism and motility. Moreover, comparative analyses found RsmQ to be encoded on a large number of divergent plasmids isolated from multiple bacterial host taxa, suggesting the widespread importance of RsmQ for manipulating bacterial behaviour across clinical, environmental, and agricultural niches. RsmQ is a widespread plasmid global translational regulator primarily evolved for host chromosomal control to manipulate bacterial behaviour and lifestyle.

IMG/PR: a database of plasmids from genomes and metagenomes with rich annotations and metadata.

Plasmids are mobile genetic elements found in many clades of Archaea and Bacteria. They drive horizontal gene transfer, impacting ecological and evolutionary processes within microbial communities, and hold substantial importance in human health and biotechnology. To support plasmid research and provide scientists with data of an unprecedented diversity of plasmid sequences, we introduce the IMG/PR database, a new resource encompassing 699 973 plasmid sequences derived from genomes, metagenomes and metatranscriptomes. IMG/PR is the first database to provide data of plasmid that were systematically identified from diverse microbiome samples. IMG/PR plasmids are associated with rich metadata that includes geographical and ecosystem information, host taxonomy, similarity to other plasmids, functional annotation, presence of genes involved in conjugation and antibiotic resistance. The database offers diverse methods for exploring its extensive plasmid collection, enabling users to navigate plasmids through metadata-centric queries, plasmid comparisons and BLAST searches. The web interface for IMG/PR is accessible at https://img.jgi.doe.gov/pr. Plasmid metadata and sequences can be downloaded from https://genome.jgi.doe.gov/portal/IMG_PR.

Horizontal gene transfer and ecological interactions jointly control microbiome stability.

Genes encoding resistance to stressors, such as antibiotics or environmental pollutants, are widespread across microbiomes, often encoded on mobile genetic elements. Yet, despite their prevalence, the impact of resistance genes and their mobility upon the dynamics of microbial communities remains largely unknown. Here we develop eco-evolutionary theory to explore how resistance genes alter the stability of diverse microbiomes in response to stressors. We show that adding resistance genes to a microbiome typically increases its overall stability, particularly for genes on mobile genetic elements with high transfer rates that efficiently spread resistance throughout the community. However, the impact of resistance genes upon the stability of individual taxa varies dramatically depending upon the identity of individual taxa, the mobility of the resistance gene, and the network of ecological interactions within the community. Nonmobile resistance genes can benefit susceptible taxa in cooperative communities yet damage those in competitive communities. Moreover, while the transfer of mobile resistance genes generally increases the stability of previously susceptible recipient taxa to perturbation, it can decrease the stability of the originally resistant donor taxon. We confirmed key theoretical predictions experimentally using competitive soil microcosm communities. Here the stability of a susceptible microbial community to perturbation was increased by adding mobile resistance genes encoded on conjugative plasmids but was decreased when these same genes were encoded on the chromosome. Together, these findings highlight the importance of the interplay between ecological interactions and horizontal gene transfer in driving the eco-evolutionary dynamics of diverse microbiomes.

Plasmid fitness costs are caused by specific genetic conflicts enabling resolution by compensatory mutation.

Plasmids play an important role in bacterial genome evolution by transferring genes between lineages. Fitness costs associated with plasmid carriage are expected to be a barrier to gene exchange, but the causes of plasmid fitness costs are poorly understood. Single compensatory mutations are often sufficient to completely ameliorate plasmid fitness costs, suggesting that such costs are caused by specific genetic conflicts rather than generic properties of plasmids, such as their size, metabolic burden, or gene expression level. By combining the results of experimental evolution with genetics and transcriptomics, we show here that fitness costs of 2 divergent large plasmids in Pseudomonas fluorescens are caused by inducing maladaptive expression of a chromosomal tailocin toxin operon. Mutations in single genes unrelated to the toxin operon, and located on either the chromosome or the plasmid, ameliorated the disruption associated with plasmid carriage. We identify one of these compensatory loci, the chromosomal gene PFLU4242, as the key mediator of the fitness costs of both plasmids, with the other compensatory loci either reducing expression of this gene or mitigating its deleterious effects by up-regulating a putative plasmid-borne ParAB operon. The chromosomal mobile genetic element Tn6291, which uses plasmids for transmission, remained up-regulated even in compensated strains, suggesting that mobile genetic elements communicate through pathways independent of general physiological disruption. Plasmid fitness costs caused by specific genetic conflicts are unlikely to act as a long-term barrier to horizontal gene transfer (HGT) due to their propensity for amelioration by single compensatory mutations, helping to explain why plasmids are so common in bacterial genomes.

The Association of Neighborhood Socioeconomic Status with Executive Function and Processing Speed in Cognitively Normal Mexican American Elders from the Health and Aging Brains Study: Health Disparities Cohort.

INTRODUCTION: Neighborhood socioeconomic status (NSES) has been linked with overall health, and this study will evaluate whether NSES is cross-sectionally associated with cognition in non-Hispanic whites (NHWs) and Mexican Americans (MAs) from the Health and Aging Brain: Health Disparities Study (HABS-HD). METHODS: The HABS-HD is a longitudinal study conducted at the University of North Texas Health Science Center. The final sample analyzed (n = 1,312) were 50 years or older, with unimpaired cognition, and underwent an interview, neuropsychological examination, imaging, and blood draw. NSES was measured using the national area deprivation index (ADI) percentile ranking, which considered socioeconomic variables. Executive function and processing speed were assessed by the trail making tests (A and B) and the digit-symbol substitution test, respectively. Linear regression was used to assess the association of ADI and cognitive measures. RESULTS: MAs were younger, more likely to be female, less educated, had higher ADI scores, performed worse on trails B (all p < 0.05), and had lower prevalence of APOE4 + when compared to NHWs (p < 0.0001). A higher percentage of MAs lived in the most deprived neighborhoods than NHWs. For NHWs, ADI did not predict trails B or DSS scores, after adjusting for demographic variables and APOE4. For MAs, ADI predicted trails A, trails B, and DSS after adjusting for demographic covariates and APOE4 status. CONCLUSION: Our study revealed that living in an area of higher deprivation was associated with lower cognitive function in MAs but not in NHWs, which is important to consider in future interventions to slow cognitive decline.

Adolescent delinquency following co-occurring childhood head injuries and conduct problem symptoms: findings from a UK longitudinal birth cohort.

Childhood conduct problems and head injuries share a bidirectional association, but how this affects the risk of adolescent delinquency is unknown. Due to their similar underlying mechanisms (i.e. increased impulsivity), this study aims to identify whether their co-occurrence increases the risk of adolescent delinquency. Data was obtained from 11,272 children at age 14 and 10,244 at age 17 years enrolled in the UK Millennium Cohort Study. Conduct problem symptoms (via the Strengths and Difficulties Questionnaire) and head injuries were parent reported from ages 3 to 14 years. Delinquency was self-reported at ages 14 and 17 including substance use, criminality, and antisocial behaviour. Incident rate ratios (IRR) were estimated for delinquency at ages 14 and 17 by childhood conduct problem and head injury status. Co-occurring head injuries and high conduct problem symptoms presented the greatest risk for overall delinquency and substance use at age 14 compared to those with the presence of one or neither (IRRs from 1.20 to 1.60). At age 17, conduct problems (with or without co-occurring head injuries) presented the greatest risk for overall delinquency, substance use, and antisocial behaviour. There was no evidence for an increased risk of delinquency at ages 14 or 17 following a head injury only. Whilst these findings suggest childhood head injuries alone do not increase the risk of adolescent delinquency, when co-occurring alongside high conduct problem symptoms there is a heightened earlier risk. These results provide further insight into adolescent delinquency and the outcomes of co-occurring childhood head injury and conduct problem symptoms.

The bidirectional relationship between head injuries and conduct problems: longitudinal modelling of a population-based birth cohort study.

Childhood head injuries and conduct problems increase the risk of aggression and criminality and are well-known correlates. However, the direction and timing of their association and the role of their demographic risk factors remain unclear. This study investigates the bidirectional links between both from 3 to 17 years while revealing common and unique demographic risks. A total of 8,603 participants (50.2% female; 83% White ethnicity) from the Millennium Cohort Study were analysed at 6 timepoints from age 3 to 17. Conduct problems were parent-reported for ages 3 to 17 using the Strengths and Difficulties Questionnaire (SDQ) and head injuries at ages 3 to 14. A cross-lagged path model estimated the longitudinal bidirectional effects between the two whilst salient demographic risks were modelled cumulatively at three ecological levels (child, mother, and household). Conduct problems at age 5 promoted head injuries between 5 and 7 (Z = 0.07; SE = 0.03; 95% CI, 0.02-0.13), and head injuries at ages 7 to 11 promoted conduct problems at age 14 (ß = .0.06; SE = .0.03; 95% CI, 0.01-0.12). Head injuries were associated with direct child-level risk at age 3, whereas conduct problems were associated with direct risks from all ecological levels until 17 years. The findings suggest a sensitive period at 5-11 years for the bidirectional relationship shared between head injuries and conduct problems. They suggest that demographic risks for increased head injuries play an earlier role than they do for conduct problems. Both findings have implications for intervention timing.

Structural analyses of the PKA RIIß holoenzyme containing the oncogenic DnaJB1-PKAc fusion protein reveal protomer asymmetry and fusion-induced allosteric perturbations in fibrolamellar hepatocellular carcinoma.

When the J-domain of the heat shock protein DnaJB1 is fused to the catalytic (C) subunit of cAMP-dependent protein kinase (PKA), replacing exon 1, this fusion protein, J-C subunit (J-C), becomes the driver of fibrolamellar hepatocellular carcinoma (FL-HCC). Here, we use cryo-electron microscopy (cryo-EM) to characterize J-C bound to RIIß, the major PKA regulatory (R) subunit in liver, thus reporting the first cryo-EM structure of any PKA holoenzyme. We report several differences in both structure and dynamics that could not be captured by the conventional crystallography approaches used to obtain prior structures. Most striking is the asymmetry caused by the absence of the second cyclic nucleotide binding (CNB) domain and the J-domain in one of the RIIß:J-C protomers. Using molecular dynamics (MD) simulations, we discovered that this asymmetry is already present in the wild-type (WT) RIIß2C2 but had been masked in the previous crystal structure. This asymmetry may link to the intrinsic allosteric regulation of all PKA holoenzymes and could also explain why most disease mutations in PKA regulatory subunits are dominant negative. The cryo-EM structure, combined with small-angle X-ray scattering (SAXS), also allowed us to predict the general position of the Dimerization/Docking (D/D) domain, which is essential for localization and interacting with membrane-anchored A-Kinase-Anchoring Proteins (AKAPs). This position provides a multivalent mechanism for interaction of the RIIß holoenzyme with membranes and would be perturbed in the oncogenic fusion protein. The J-domain also alters several biochemical properties of the RIIß holoenzyme: It is easier to activate with cAMP, and the cooperativity is reduced. These results provide new insights into how the finely tuned allosteric PKA signaling network is disrupted by the oncogenic J-C subunit, ultimately leading to the development of FL-HCC.

Increasing the π-Expansive Ligands in Ruthenium(II) Polypyridyl Complexes: Synthesis, Characterization, and Biological Evaluation for Photodynamic Therapy Applications.

Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP)2phen]Cl2 and [Ru(dppz)2phen](PF6)2 have also been obtained. It is well-known that compound [Ru(dppz)(phen)2]Cl2 binds to DNA by intercalation. Therefore, we used [Ru(dppz)2phen]Cl2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC50 in the micro- or even nanomolar range (0.06-7 µM). Confocal microscopy studies showed that [Ru(DIP)2phen]Cl2 and [Ru(DIP)2TAP]Cl2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn)2phen](PF6)2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn)2phen](PF6)2 stands out for its very good IC50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.

NHC Carbene-Metal Complex Ligand Binding Energies.

The ligand binding energies (LBEs) of N-heterocyclic carbenes (NHCs) and CH2 and CF2 adducts with group 1, 2, 10, and 11 metals and complexes with metals from these groups are predicted at the coupled cluster CCSD(T) level of theory by using density functional theory optimized geometries. The differences in LBEs as a function of the metal and the types of bonding interactions as well as the type of carbene are described. The bonding between the alkali cations and alkaline earth dications is predominantly ionic with a linear correlation between the LBEs and the cation hardness. In contrast, the bonding behaviors of the group 10 and 11 metals and metal complexes have only a weak, indirect correlation between the LBEs and the metal hardness. The difference in bonding behavior between the groups of metals arises due to the accessibility of electron donation between the ligand and the metal in the transition metal complexes, which results in more covalent-like bonding behavior. The presence of the methyl groups on the NHC nitrogen results in only slightly more delocalized charge from the metal onto the ring, but there is significant redistribution of the charge on the ring. Saturation of the NHC ring had a much smaller effect on how the charge was distributed on the ring. The analysis of the bonding behavior of NHCs with various metal groups enables improved understanding of carbene-metal interactions to inform rational design of NHC-based systems.

Linked head injury and conduct problem symptom pathways from early childhood to adolescence and their associated risks: Evidence from the millennium cohort study.

Conduct problems and head injuries increase the risk of delinquency and share a bidirectional association. However, how they link across development is unknown. The present study aimed to identify their linked developmental pathways and associated risk factors. Latent class analysis was modeled from Millennium Cohort Study data (n = 8,600) to identify linked pathways of conduct problem symptoms and head injuries. Head injuries were parent-reported from ages 3 to 14 and conduct problems from ages 3 to 17 using the Strengths and Difficulties Questionnaire (SDQ). Multinomial logistic regression then identified various risk factors associated with pathway membership. Four distinct pathways were identified. Most participants displayed low-level conduct problem symptoms and head injuries (n = 6,422; 74.7%). Three groups were characterized by clinically relevant levels of conduct problem symptoms and high-risk head injuries in childhood (n = 1,422; 16.5%), adolescence (n = 567; 6.6%), or persistent across development (n = 189; 2.2%). These clinically relevant pathways were associated with negative maternal parenting styles. These findings demonstrate how pathways of conduct problem symptoms are uniquely linked with distinct head injury pathways. Suggestions for general preventative intervention targets include early maternal negative parenting styles. Pathway-specific interventions are also required targeting cumulative risk at different ecological levels.

Medical comorbidities and ethnicity impact plasma Alzheimer's disease biomarkers: Important considerations for clinical trials and practice.

INTRODUCTION: Despite the clinical implementation, there remain significant gaps in our knowledge regarding the impact of race/ethnicity or common medical comorbidity on plasma Alzheimer's disease (AD) biomarkers. METHODS: Plasma biomarkers of amyloid beta (Aß)40, Aß42 , total tau, and neurofilament light chain (NfL) were measured across cognitively normal Mexican Americans (n = 445) and non-Hispanic Whites (n = 520). RESULTS: Dyslipidemia was associated with elevated Aß40 (P = .01) and Aß42 (P = .001) while hypertension was associated with elevated Aß40 (P = .003), Aß42 (P < .001), and total tau (P = .002) levels. Diabetes was associated with higher Aß40 (P < .001), Aß42 (P < .001), total tau (P < .001), and NfL (P < .001) levels. Chronic kidney disease (CKD) was associated with elevations in Aß40 (P < .001), Aß42 (P < .001), total tau (P < .001), and NfL (P < .001) levels. Mexican Americans had significantly lower Aß40 (P < .001) and higher total tau (P = .005) levels. DISCUSSION: Plasma AD biomarkers vary significantly in association with common medical comorbidities as well as ethnicity. These findings are important for those using these biomarkers in clinical practice and clinical trials.

Ruthenium Complexes with Protic Ligands: Influence of the Position of OH Groups and π Expansion on Luminescence and Photocytotoxicity.

Protic ruthenium complexes using the dihydroxybipyridine (dhbp) ligand combined with a spectator ligand (N,N = bpy, phen, dop, Bphen) have been studied for their potential activity vs. cancer cells and their photophysical luminescent properties. These complexes vary in the extent of π expansion and the use of proximal (6,6'-dhbp) or distal (4,4'-dhbp) hydroxy groups. Eight complexes are studied herein as the acidic (OH bearing) form, [(N,N)2Ru(n,n'-dhbp)]Cl2, or as the doubly deprotonated (O- bearing) form. Thus, the presence of these two protonation states gives 16 complexes that have been isolated and studied. Complex 7A, [(dop)2Ru(4,4'-dhbp)]Cl2, has been recently synthesized and characterized spectroscopically and by X-ray crystallography. The deprotonated forms of three complexes are also reported herein for the first time. The other complexes studied have been synthesized previously. Three complexes are light-activated and exhibit photocytotoxicity. The log(Do/w) values of the complexes are used herein to correlate photocytotoxicity with improved cellular uptake. For Ru complexes 1-4 bearing the 6,6'-dhbp ligand, photoluminescence studies (all in deaerated acetonitrile) have revealed that steric strain leads to photodissociation which tends to reduce photoluminescent lifetimes and quantum yields in both protonation states. For Ru complexes 5-8 bearing the 4,4'-dhbp ligand, the deprotonated Ru complexes (5B-8B) have low photoluminescent lifetimes and quantum yields due to quenching that is proposed to involve the 3LLCT excited state and charge transfer from the [O2-bpy]2- ligand to the N,N spectator ligand. The protonated OH bearing 4,4'-dhbp Ru complexes (5A-8A) have long luminescence lifetimes which increase with increasing π expansion on the N,N spectator ligand. The Bphen complex, 8A, has the longest lifetime of the series at 3.45 µs and a photoluminescence quantum yield of 18.7%. This Ru complex also exhibits the best photocytotoxicity of the series. A long luminescence lifetime is correlated with greater singlet oxygen quantum yields because the triplet excited state is presumably long-lived enough to interact with 3O2 to yield 1O2.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Cost-effectiveness of domiciliary non-invasive ventilation in patients with chronic obstructive pulmonary disease.

BACKGROUND: Chronic obstructive pulmonary disease (COPD) is a chronic disease associated with recurring exacerbations, which influence morbidity and mortality for the patient, while placing significant resource burdens on healthcare systems. Non-invasive ventilation (NIV) in a domiciliary setting can help prevent admissions, but the economic evidence to support NIV use is limited. METHODS: A Markov model-based cost-utility analysis from the UK National Health Service perspective compared the cost-effectiveness of domiciliary NIV with usual care for two end-stage COPD populations; a stable COPD population commencing treatment with no recent hospital admission; and a posthospital population starting treatment following admission to hospital for an exacerbation. Hospitalisation rates in patients receiving domiciliary NIV compared with usual care were derived from randomised controlled studies in a recent systematic review. Other model parameters were updated with recent evidence. RESULTS: At the threshold of £20 000 per quality-adjusted life-year (QALY) domiciliary NIV is 99.9% likely cost-effective in a posthospital population, but unlikely (4%) to be cost-effective in stable populations. The incremental cost-effective ratio (ICER) was £11 318/QALY gained in the posthospital population and £27 380/QALY gained in the stable population. Cost-effectiveness estimates were sensitive to longer-term readmission and mortality risks, and duration of benefit from NIV. Indeed, for stable Global Initiative for Chronic Obstructive Lung Disease (GOLD) for stage 4 patients, or with higher mortality and exacerbation risks, ICERs were close to the £20 000/QALY threshold. CONCLUSION: Domiciliary NIV is likely cost-effective for posthospitalised patients, with uncertainty around the cost-effectiveness of domiciliary NIV in stable patients with COPD on which further research should focus.

A tale of two plasmids: contributions of plasmid associated phenotypes to epidemiological success among Shigella.

Dissemination of antimicrobial resistance (AMR) genes by horizontal gene transfer (HGT) mediated through plasmids is a major global concern. Genomic epidemiology studies have shown varying success of different AMR plasmids during outbreaks, but the underlying reasons for these differences are unclear. Here, we investigated two Shigella plasmids (pKSR100 and pAPR100) that circulated in the same transmission network but had starkly contrasting epidemiological outcomes to identify plasmid features that may have contributed to the differences. We used plasmid comparative genomics to reveal divergence between the two plasmids in genes encoding AMR, SOS response alleviation and conjugation. Experimental analyses revealed that these genomic differences corresponded with reduced conjugation efficiencies for the epidemiologically successful pKSR100, but more extensive AMR, reduced fitness costs, and a reduced SOS response in the presence of antimicrobials, compared with the less successful pAPR100. The discrepant phenotypes between the two plasmids are consistent with the hypothesis that plasmid-associated phenotypes contribute to determining the epidemiological outcome of AMR HGT and suggest that phenotypes relevant in responding to antimicrobial pressure and fitness impact may be more important than those around conjugation in this setting. Plasmid phenotypes could thus be valuable tools in conjunction with genomic epidemiology for predicting AMR dissemination.

The Link between APOE4 Presence and Neuropsychological Test Performance among Mexican Americans and Non-Hispanic Whites of the Multiethnic Health & Aging Brain Study - Health Disparities Cohort.

INTRODUCTION: The APOEε4 allele is the single strongest genetic risk for late-onset Alzheimer's disease (AD). Prior work demonstrates that not only the APOEε4 allele varies by race/ethnicity but also the risk for AD and cognitive impairment conveyed by the APOEε4 allele varies by the racial/ethnic group as well as genetic ancestry. Here, we sought to examine the link between the APOEε4 and neuropsychological functioning among Mexican Americans (MAs). METHODS: Data were examined from 1,633 (852 MAs and 781 non-Hispanic Whites [NHWs]) participants of the Health & Aging Brain Study - Health Disparities (HABS-HD) and were enrolled with all requisite data to be included into the current analyses. RESULTS: The frequency of both ε4 and ε2 alleles was significantly lower among MAs as compared to NHWs. Among MAs, APOEε4 allele presence was associated specifically with poorer immediate and delayed memory (Wechsler Memory Scale - Third Edition [WMS-III] Logical Memory and Spanish-English Verbal Learning Test [SEVLT]). Among NHWs, APOEε4 allele presence was associated with poorer immediate and delayed memory as well as worse executive functioning (Trials B) and verbal fluency (Animal naming). DISCUSSION/CONCLUSION: The APOEε4 allele was associated with poorer cognition across multiple domains among NHWs; however, allele presence was specifically associated with poorer memory performance among MAs. When combined with prior work, the current findings demonstrate that the risk factors associated with cognitive dysfunction differ among MAs as compared to NHWs and require additional investigation.

Characterizing plasma NfL in a community-dwelling multi-ethnic cohort: Results from the HABLE study.

INTRODUCTION: No large-scale characterizations of neurofilament light chain (NfL) have been conducted in diverse populations. METHODS: Baseline data were analyzed among n = 890 Mexican Americans and n = 813 non-Hispanic Whites from the multi-ethnic Health & Aging Brain among Latino Elders (HABLE) study. Plasma NfL was measured on the Simoa platform. RESULTS: In unadjusted models, NfL was significantly associated with age (P < .001), hypertension (P  < .001), dyslipidemia (P = .02), and diabetes (P  < .001). Covarying for age and sex, NfL was associated with neurodegeneration (P  < .001) and global amyloid burden levels (P = .02) in a subset with available data. NfL levels were significantly associated with diagnostic groups (Normal Cognition [NC], mild cognitive impairment [MCI], Dementia; P  < .001); however, there was no cut-score that yielded acceptable diagnostic accuracy. NfL levels produced a sensitivity of 0.60 and specificity of 0.78 with negative predictive value of 89% for detecting amyloid positivity. DISCUSSION: Plasma NfL levels are significantly impacted by age and medical co-morbidities that are common among older adults, which complicate its utility as a diagnostic biomarker.