New races with wider virulence indicate rapid evolution of Puccinia striiformis f. sp. tritici in the Southern Cone of America.

Wheat yellow (stripe) rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most devastating diseases of wheat worldwide. Pst populations are composed of multiple genetic groups, each carrying one or more races characterized by different avirulence/virulence combinations. Since the severe epidemics in 2017, yellow rust has become the most economically important wheat foliar disease in Uruguay. A set of 124 Pst isolates collected from wheat fields in Uruguay between 2017 and 2021 were characterized phenotypically and 27 of those isolates were subsequently investigated in-depth by additional molecular genotyping and race phenotyping analyses. Three genetic groups were identified, i.e., PstS7, PstS10 and PstS13, the latter being the most prevalent. Two races previously reported in Europe, Warrior (PstS7) and Benchmark (PstS10), were detected in four and two isolates, respectively. A third race known as Triticale2015 (PstS13), first detected in Europe in 2015 and in Argentina in 2017, was detected at several locations. Additional virulence to Yr3, Yr17, Yr25, Yr27 or Yr32 was detected in three new race variants within PstS13. The identification of these new races, which have not been reported outside South America, provides strong evidence of the local evolution of virulence in Pst during the recent epidemic years.

First report of Ug99 Wheat Stem Rust caused by Puccinia graminis f. sp. tritici in South Asia.

Since the emergence of Ug99 wheat stem rust in Uganda in 1998 (Pretorius et al. 2000), the threat of movement into South Asia has been a concern due to long-distance dispersal capacity of airborne spores (Brown and Hovmøller 2002; Singh et al. 2008; Meyer et al. 2017). Increased preparedness by comprehensive rust surveillance efforts and development and deployment of resistant cultivars in advance of an incursion into South Asia has been one of the success stories of the Borlaug Global Rust Initiative (Sharma et al. 2013). In November 2023, an off-season rust survey was conducted in Marpha, Gandaki and Bagmati provinces in Nepal. Rust was only observed at two sites, Dangdunge of Dolakha district and Mude of Sindhupalchok district, where spring wheat was grown as fodder crop outside the main cropping season. Rust infected wheat leaves (10-15 leaves per site) were air dried and sealed in envelopes that were shipped under permit to the Global Rust Reference Center, Denmark. Bulk samples of stem rust, Puccinia graminis f.sp. tritici (Pgt), were recovered from both envelopes, and single pustule isolates were raised and multiplied on Morocco and McNair. Meanwhile, specimens of dry leaves were subjected to SSR genotyping according to standard procedures (Patpour et al. 2022). One distinct multi-locus Pgt genotype was observed, identical to and representing 99% of Ug99 isolates within Clade I collected in East Africa between 2012-2022. A Pgt single pustule isolate from each of the sampling sites were inoculated onto 20 internationally agreed stem rust differential lines using standard procedures, and 14 supplementary lines providing additional resolution of pathogen virulence (Patpour et al. 2022). The pathotyping was repeated in two independent experiments, which resulted in the infection type pattern of Pgt race TTKTT (Supplementary Table 1). Additional independent SSR genotype assays of recovered isolates confirmed the prevalent genotype of Clade I (Patpour et al. 2022; Szabo et al. 2022). This first detection of Ug99 race TTKTT in South Asia emphasizes the need for continued coordinated international surveillance efforts and utilization of diverse sources of resistance to control stem rust in wheat. New surveillance efforts in Nepal during February-March 2024 did not reveal additional cases of wheat stem rust. However, more detailed and sustained rust surveillance efforts, assessment of the vulnerability of current wheat crops to Ug99 and other races of stem-, stripe/yellow- and leaf rust, as well as intensified breeding for rust resistance throughout the region is strongly recommended to meet current and future plant health risks.

Wheat stripe rust resistance locus YR63 is a hot spot for evolution of defence genes - a pangenome discovery.

BACKGROUND: Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), poses a threat to global wheat production. Deployment of widely effective resistance genes underpins management of this ongoing threat. This study focused on the mapping of stripe rust resistance gene YR63 from a Portuguese hexaploid wheat landrace AUS27955 of the Watkins Collection. RESULTS: YR63 exhibits resistance to a broad spectrum of Pst races from Australia, Africa, Asia, Europe, Middle East and South America. It was mapped to the short arm of chromosome 7B, between two single nucleotide polymorphic (SNP) markers sunCS_YR63 and sunCS_67, positioned at 0.8 and 3.7 Mb, respectively, in the Chinese Spring genome assembly v2.1. We characterised YR63 locus using an integrated approach engaging targeted genotyping-by-sequencing (tGBS), mutagenesis, resistance gene enrichment and sequencing (MutRenSeq), RNA sequencing (RNASeq) and comparative genomic analysis with tetraploid (Zavitan and Svevo) and hexaploid (Chinese Spring) wheat genome references and 10+ hexaploid wheat genomes. YR63 is positioned at a hot spot enriched with multiple nucleotide-binding and leucine rich repeat (NLR) and kinase domain encoding genes, known widely for defence against pests and diseases in plants and animals. Detection of YR63 within these gene clusters is not possible through short-read sequencing due to high homology between members. However, using the sequence of a NLR member we were successful in detecting a closely linked SNP marker for YR63 and validated on a panel of Australian bread wheat, durum and triticale cultivars. CONCLUSIONS: This study highlights YR63 as a valuable source for resistance against Pst in Australia and elsewhere. The closely linked SNP marker will facilitate rapid introgression of YR63 into elite cultivars through marker-assisted selection. The bottleneck of this study reinforces the necessity for a long-read sequencing such as PacBio or Oxford Nanopore based techniques for accurate detection of the underlying resistance gene when it is part of a large gene cluster.

Sr65: a widely effective gene for stem rust resistance in wheat.

KEY MESSAGE: Sr65 in chromosome 1A of Indian wheat landrace Hango-2 is a potentially useful all-stage resistance gene that currently protects wheat from stem rust in Australia, India, Africa and Europe. Stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), threatened global wheat production with the appearance of widely virulent races that included TTKSK and TTRTF. Indian landrace Hango-2 showed resistance to Pgt races in India and Australia. Screening of a Hango-2/Avocet 'S' (AvS) recombinant inbred line population identified two stem rust resistance genes, a novel gene (temporarily named as SrH2) from Hango-2 and Sr26 from AvS. A mapping population segregating for SrH2 alone was developed from two recombinant lines. SrH2 was mapped on the short arm of chromosome 1A, where it was flanked by KASP markers KASP_7944 (proximal) and KASP_12147 (distal). SrH2 was delimited to an interval of 1.8-2.3 Mb on chromosome arm 1AS. The failure to detect candidate genes through MutRenSeq and comparative genomic analysis with the pan-genome dataset indicated the necessity to generate a Hango-2 specific assembly for detecting the gene sequence linked with SrH2 resistance. MutRenSeq however enabled identification of SrH2-linked KASP marker sunCS_265. Markers KASP_12147 and sunCS_265 showed 92% and 85% polymorphism among an Australian cereal cultivar diversity panel and can be used for marker-assisted selection of SrH2 in breeding programs. The effectiveness of SrH2 against Pgt races from Europe, Africa, India, and Australia makes it a valuable resource for breeding stem rust-resistant wheat cultivars. Since no wheat-derived gene was previously located in chromosome arm 1AS, SrH2 represents a new locus and named as SR65.

Haplotype variants of Sr46 in Aegilops tauschii, the diploid D genome progenitor of wheat.

KEY MESSAGE: Stem rust resistance genes, SrRL5271 and Sr672.1 as well as SrCPI110651, from Aegilops tauschii, the diploid D genome progenitor of wheat, are sequence variants of Sr46 differing by 1-2 nucleotides leading to non-synonymous amino acid substitutions. The Aegilops tauschii (wheat D-genome progenitor) accessions RL 5271 and CPI110672 were identified as resistant to multiple races (including the Ug99) of the wheat stem rust pathogen Puccinia graminis f. sp. tritici (Pgt). This study was conducted to identify the stem rust resistance (Sr) gene(s) in both accessions. Genetic analysis of the resistance in RL 5271 identified a single dominant allele (SrRL5271) controlling resistance, whereas resistance segregated at two loci (SR672.1 and SR672.2) for a cross of CPI110672. Bulked segregant analysis placed SrRL5271 and Sr672.1 in a region on chromosome arm 2DS that encodes Sr46. Molecular marker screening, mapping and genomic sequence analysis demonstrated SrRL5271 and Sr672.1 are alleles of Sr46. The amino acid sequence of SrRL5271 and Sr672.1 is identical but differs from Sr46 (hereafter referred to as Sr46_h1 by following the gene nomenclature in wheat) by a single amino acid (N763K) and is thus designated Sr46_h2. Screening of a panel of Ae. tauschii accessions identified an additional allelic variant that differed from Sr46_h2 by a different amino acid (A648V) and was designated Sr46_h3. By contrast, the protein encoded by the susceptible allele of Ae. tauschii accession AL8/78 differed from these resistance proteins by 54 amino acid substitutions (94% nucleotide sequence gene identity). Cloning and complementation tests of the three resistance haplotypes confirmed their resistance to Pgt race 98-1,2,3,5,6 and partial resistance to Pgt race TTRTF in bread wheat. The three Sr46 haplotypes, with no virulent races detected yet, represent a valuable source for improving stem resistance in wheat.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

Distribution of Puccinia striiformis f. sp. tritici Races and Virulence in Wheat Growing Regions of Kenya from 1970 to 2014.

Stripe rust, caused by the fungal pathogen Puccinia striiformis f. sp. tritici, is a major threat to wheat (Triticum spp.) production worldwide. The objective of this study was to determine the virulence of P. striiformis f. sp. tritici races prevalent in the main wheat growing regions of Kenya, which includes Mt. Kenya, Eastern Kenya, and the Rift Valley (Central, Southern, and Northern Rift). Fifty P. striiformis f. sp. tritici isolates collected from 1970 to 1992 and from 2009 to 2014 were virulence phenotyped with stripe rust differential sets, and 45 isolates were genotyped with sequence characterized amplified region (SCAR) markers to differentiate the isolates and identify aggressive strains PstS1 and PstS2. Virulence corresponding to stripe rust resistance genes Yr1, Yr2, Yr3, Yr6, Yr7, Yr8, Yr9, Yr17, Yr25, and Yr27 and the seedling resistance in genotype Avocet S were detected. Ten races were detected in the P. striiformis f. sp. tritici samples obtained from 1970 to 1992, and three additional races were detected from 2009 to 2014, with a single race being detected in both periods. The SCAR markers detected both Pst1 and Pst2 strains in the collection. Increasing P. striiformis f. sp. tritici virulence was found in the Kenyan P. striiformis f. sp. tritici population, and different P. striiformis f. sp. tritici race groups were found to dominate different wheat growing regions. Moreover, recent P. striiformis f. sp. tritici races in East Africa indicated possible migration of some race groups into Kenya from other regions. This study is important in elucidating P. striiformis f. sp. tritici evolution and virulence diversity and useful in breeding wheat cultivars with effective resistance to stripe rust.

Incursions of divergent genotypes, evolution of virulence and host jumps shape a continental clonal population of the stripe rust pathogen Puccinia striiformis.

Long-distance migration and host adaptation by transboundary plant pathogens often brings detrimental effects to important agroecosystems. Efficient surveillance as a basis for responding to the dynamics of such pathogens is often hampered by a lack of information on incursion origin, evolutionary pathways and the genetic basis of rapidly evolving virulence across larger timescales. Here, we studied these genetic features by using historical isolates of the obligate biotrophic pathogen Puccinia striiformis f. sp. tritici (Pst), which causes one of the most widespread and devastating diseases, stripe (yellow) rust, of wheat. Through a combination of genotypic, phenotypic and genomic analyses, we assigned eight Pst isolates representing putative exotic Pst incursions into Australia to four previously defined genetic groups, PstS0, PstS1, PstS10 and PstS13. We showed that isolates of an additional incursion of P. striiformis, known locally as P. striiformis f. sp. pseudo-hordei, had a new and unique multilocus SSR genotype (MLG). We provide results of overall genomic variation of representative Pst isolates from each genetic group by comparative genomic analyses. We showed that isolates within the PstS1 and PstS13 genetic groups are most distinct at the whole-genome variant level from isolates belonging to genetic group PstS0, whereas the isolate from the PstS10 genetic group is intermediate. We further explored variable gene content, including putative effectors, representing both shared but also unique genetic changes that have occurred following introduction, some of which may additionally account for local adaptation of these isolates to triticale. Our genotypic and genomic data revealed new genetic insights into the evolution of diverse phenotypes of rust pathogens following incursion into a geographically isolated continental region.

MARPLE, a point-of-care, strain-level disease diagnostics and surveillance tool for complex fungal pathogens.

BACKGROUND: Effective disease management depends on timely and accurate diagnosis to guide control measures. The capacity to distinguish between individuals in a pathogen population with specific properties such as fungicide resistance, toxin production and virulence profiles is often essential to inform disease management approaches. The genomics revolution has led to technologies that can rapidly produce high-resolution genotypic information to define individual variants of a pathogen species. However, their application to complex fungal pathogens has remained limited due to the frequent inability to culture these pathogens in the absence of their host and their large genome sizes. RESULTS: Here, we describe the development of Mobile And Real-time PLant disEase (MARPLE) diagnostics, a portable, genomics-based, point-of-care approach specifically tailored to identify individual strains of complex fungal plant pathogens. We used targeted sequencing to overcome limitations associated with the size of fungal genomes and their often obligately biotrophic nature. Focusing on the wheat yellow rust pathogen, Puccinia striiformis f.sp. tritici (Pst), we demonstrate that our approach can be used to rapidly define individual strains, assign strains to distinct genetic lineages that have been shown to correlate tightly with their virulence profiles and monitor genes of importance. CONCLUSIONS: MARPLE diagnostics enables rapid identification of individual pathogen strains and has the potential to monitor those with specific properties such as fungicide resistance directly from field-collected infected plant tissue in situ. Generating results within 48 h of field sampling, this new strategy has far-reaching implications for tracking plant health threats.

Origin, migration routes and worldwide population genetic structure of the wheat yellow rust pathogen Puccinia striiformis f.sp. tritici.

Analyses of large-scale population structure of pathogens enable the identification of migration patterns, diversity reservoirs or longevity of populations, the understanding of current evolutionary trajectories and the anticipation of future ones. This is particularly important for long-distance migrating fungal pathogens such as Puccinia striiformis f.sp. tritici (PST), capable of rapid spread to new regions and crop varieties. Although a range of recent PST invasions at continental scales are well documented, the worldwide population structure and the center of origin of the pathogen were still unknown. In this study, we used multilocus microsatellite genotyping to infer worldwide population structure of PST and the origin of new invasions based on 409 isolates representative of distribution of the fungus on six continents. Bayesian and multivariate clustering methods partitioned the set of multilocus genotypes into six distinct genetic groups associated with their geographical origin. Analyses of linkage disequilibrium and genotypic diversity indicated a strong regional heterogeneity in levels of recombination, with clear signatures of recombination in the Himalayan (Nepal and Pakistan) and near-Himalayan regions (China) and a predominant clonal population structure in other regions. The higher genotypic diversity, recombinant population structure and high sexual reproduction ability in the Himalayan and neighboring regions suggests this area as the putative center of origin of PST. We used clustering methods and approximate Bayesian computation (ABC) to compare different competing scenarios describing ancestral relationship among ancestral populations and more recently founded populations. Our analyses confirmed the Middle East-East Africa as the most likely source of newly spreading, high-temperature-adapted strains; Europe as the source of South American, North American and Australian populations; and Mediterranean-Central Asian populations as the origin of South African populations. Although most geographic populations are not markedly affected by recent dispersal events, this study emphasizes the influence of human activities on recent long-distance spread of the pathogen.

The stripe rust fungal effector PEC6 suppresses pattern-triggered immunity in a host species-independent manner and interacts with adenosine kinases.

We identified a wheat stripe rust (Puccinia striiformis) effector candidate (PEC6) with pattern-triggered immunity (PTI) suppression function and its corresponding host target. PEC6 compromised PTI host species-independently. In Nicotiana benthamiana, it hampers reactive oxygen species (ROS) accumulation and callose deposition induced by Pseudomonas fluorescens. In Arabidopsis, plants expressing PEC6 were more susceptible to Pseudomonas syringae pv. tomato (Pto) DC3000 ΔAvrPto/ΔAvrPtoB. In wheat, PEC6-suppression of P. fluorescens-elicited PTI was revealed by the fact that it allowed activation of effector-triggered immunity by Pto DC3000. Knocking down of PEC6 expression by virus-mediated host-induced gene silencing decreased the number of rust pustules, uncovering PEC6 as an important pathogenicity factor. PEC6, overexpressed in plant cells without its signal peptide, was localized to the nucleus and cytoplasm. A yeast two-hybrid assay showed that PEC6 interacts with both wheat and Arabidopsis adenosine kinases (ADKs). Knocking down wheat ADK expression by virus-induced gene silencing reduced leaf growth and enhanced the number of rust pustules, indicating that ADK is important in plant development and defence. ADK plays essential roles in regulating metabolism, cytokinin interconversion and methyl transfer reactions, and our data propose a model where PEC6 may affect one of these processes by targeting ADK to favour fungal growth.

Kenyan Isolates of Puccinia graminis f. sp. tritici from 2008 to 2014: Virulence to SrTmp in the Ug99 Race Group and Implications for Breeding Programs.

Frequent emergence of new variants in the Puccinia graminis f. sp. tritici Ug99 race group in Kenya has made pathogen survey a priority. We analyzed 140 isolates from 78 P. graminis f. sp. tritici samples collected in Kenya between 2008 and 2014 and identified six races, including three not detected prior to 2013. Genotypic analysis of 20 isolates from 2013 and 2014 collections showed that the new races TTHST, TTKTK, and TTKTT belong to the Ug99 race group. International advanced breeding lines were evaluated against an isolate of TTKTT (Sr31, Sr24, and SrTmp virulence) at the seedling stage. From 169 advanced lines from Kenya, 23% of lines with resistance to races TTKSK and TTKST were susceptible to TTKTT and, from two North American regional nurseries, 44 and 91% of resistant lines were susceptible. Three lines with combined resistance genes were developed to facilitate pathogen monitoring and race identification. These results indicate the increasing virulence and variability in the Kenyan P. graminis f. sp. tritici population and reveal vulnerabilities of elite germplasm to new races.

Evaluation of Spray and Point Inoculation Methods for the Phenotyping of Puccinia striiformis on Wheat.

The fungus Puccinia striiformis causes yellow (stripe) rust on wheat worldwide. In the present article, new methods utilizing an engineered fluid (Novec 7100) as a carrier of urediniospores were compared with commonly used inoculation methods. In general, Novec 7100 facilitated a faster and more flexible application procedure for spray inoculation and it gave highly reproducible results for virulence phenotyping. Six point inoculation methods were compared to find the most suitable for assessment of pathogen aggressiveness. The use of Novec 7100 and dry dilution with Lycopodium spores gave an inoculation success rate of 100% in two independent trials, which was significantly higher and more consistent than for spore suspension in Soltrol 170, water, water + Tween 20, and Noble agar + Tween 20. Both Soltrol 170 and Novec 7100 allowed precise quantification of inoculum, which is important for the assessment of quantitative epidemiological parameters. New protocols for spray and point inoculation of P. striiformis on wheat are presented, along with the prospect for applying these in rust research and resistance breeding activities.

Emergence and Spread of New Races of Wheat Stem Rust Fungus: Continued Threat to Food Security and Prospects of Genetic Control.

Race Ug99 (TTKSK) of Puccinia graminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes-Sr55, Sr56, Sr57, and Sr58-have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large-scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best stem rust management strategy.

Phenotypic and Genotypic Characterization of Race TKTTF of Puccinia graminis f. sp. tritici that Caused a Wheat Stem Rust Epidemic in Southern Ethiopia in 2013-14.

A severe stem rust epidemic occurred in southern Ethiopia during November 2013 to January 2014, with yield losses close to 100% on the most widely grown wheat cultivar, 'Digalu'. Sixty-four stem rust samples collected from the regions were analyzed. A meteorological model for airborne spore dispersal was used to identify which regions were most likely to have been infected from postulated sites of initial infection. Based on the analyses of 106 single-pustule isolates derived from these samples, four races of Puccinia graminis f. sp. tritici were identified: TKTTF, TTKSK, RRTTF, and JRCQC. Race TKTTF was found to be the primary cause of the epidemic in the southeastern zones of Bale and Arsi. Isolates of race TKTTF were first identified in samples collected in early October 2013 from West Arsi. It was the sole or predominant race in 31 samples collected from Bale and Arsi zones after the stem rust epidemic was established. Race TTKSK was recovered from 15 samples from Bale and Arsi zones at low frequencies. Genotyping indicated that isolates of race TKTTF belongs to a genetic lineage that is different from the Ug99 race group and is composed of two distinct genetic types. Results from evaluation of selected germplasm indicated that some cultivars and breeding lines resistant to the Ug99 race group are susceptible to race TKTTF. Appearance of race TKTTF and the ensuing epidemic underlines the continuing threats and challenges posed by stem rust not only in East Africa but also to wider-scale wheat production.

Sexual structures and recombination of the wheat rust fungus Puccinia striiformis on Berberis vulgaris.

An isolate of the basidiomycete Puccinia striiformis, which causes yellow (stripe) rust on wheat, was selfed on the newly discovered alternate host, Berberis vulgaris. This allowed a study of the segregation of molecular markers and virulence in the progeny isolates, and of the development of fungal sexual structures and spore forms. Pycnia and aecia were obtained after inoculation of B. vulgaris with basidiospores resulting from germinating teliospores from infected wheat leaves. Subsequent inoculation of wheat with aeciospores from bulked aecia resulted in 16 progeny isolates of the S1 generation. Genotyping with 42 simple sequence repeat (SSR) markers confirmed a parental origin of progeny isolates. Of the 42 analyzed loci, 15 were heterozygous in the parental isolate and 14 revealed segregation in the progenies. This resulted in 11 new multilocus genotypes (MLGs), which confirmed segregation following sexual reproduction. Additionally, parental and progeny isolates were phenotyped using a genetic stock of wheat genotypes representing 21 resistance genes. All S1 progeny isolates had virulence for 14 out of 15 loci where the parental isolate was virulent. This was consistent with the hypothesis that virulence in plant pathogens is often recessive to avirulence, i.e., only expressed in a homozygous state. Furthermore, no segregation was observed for five out of six loci, for which the parental isolate had an avirulent phenotype. The results for one of the two segregating virulence/avirulence loci suggested that the parental isolate was heterozygous with Avr alleles resulting in different but clearly avirulent phenotypes. The other locus indicated that additional genes modifying the phenotypic expression of avirulence were involved.

Inferring the contribution of sexual reproduction, migration and off-season survival to the temporal maintenance of microbial populations: a case study on the wheat fungal pathogen Puccinia striiformis f.sp. tritici.

Understanding the mode of temporal maintenance of plant pathogens is an important domain of microbial ecology research. Due to the inconspicuous nature of microbes, their temporal maintenance cannot be studied directly through tracking individuals and their progeny. Here, we suggest a series of population genetic analyses on molecular marker variation in temporally spaced samples to infer about the relative contribution of sexual reproduction, off-season survival and migration to the temporal maintenance of pathogen populations. We used the proposed approach to investigate the temporal maintenance of wheat yellow rust pathogen, Puccinia striiformis f.sp. tritici (PST), in the Himalayan region of Pakistan. Multilocus microsatellite genotyping of PST isolates revealed high genotypic diversity and recombinant population structure across all locations, confirming the existence of sexual reproduction in this region. The genotypes were assigned to four genetic groups, revealing a clear differentiation between zones with and without Berberis spp., the alternate host of PST, with an additional subdivision within the Berberis zone. The lack of any differentiation between samples across two sampling years, and the very infrequent resampling of multilocus genotypes over years at a given location was consistent with limited over-year clonal survival, and a limited genetic drift. The off-season oversummering population in the Berberis zone, likely to be maintained locally, served as a source of migrants contributing to the temporal maintenance in the non-Berberis zone. Our study hence demonstrated the contribution of both sexual recombination and off-season oversummering survival to the temporal maintenance of the pathogen. These new insights into the population biology of PST highlight the general usefulness of the analytical approach proposed.

New Races of Puccinia striiformis Found in Europe Reveal Race Specificity of Long-Term Effective Adult Plant Resistance in Wheat.

Resistance to Puccinia striiformis was examined in nine wheat recombinant inbred lines (RILs) from a cross between 'Camp Rémy' (resistant parent) and 'Récital' (susceptible parent) using an isolate of a strain common to the northwestern European population before 2011 (old) and two additional isolates, one representing an aggressive and high-temperature-adapted strain (PstS2) and another representing a virulence phenotype new to Europe since 2011 (new). The RILs carried different combinations of quantitative trait loci (QTL) for resistance to P. striiformis. Under greenhouse conditions, the three isolates gave highly contrasting results for infection type, latent period, lesion length, and diseased leaf area. The PstS2 isolate revealed Yr genes and QTL which conferred complete resistance in adult plants. Six QTL had additive effects against the old isolate whereas the effects of these QTL were significantly lower for the new isolate. Furthermore, the new isolate revealed previously undetected resistance in the susceptible parent. Disease severity under field conditions agreed with greenhouse results, except for Camp Rémy being fully resistant to the new isolate and for two RILs being susceptible in the field. These results stress the need of maintaining high genetic diversity for disease resistance in wheat and of using pathogen isolates of diverse origin in studies of host resistance genetics.

Scald resistance in hybrid rye (Secale cereale): genomic prediction and GWAS.

Rye (Secale cereale L.) is an important cereal crop used for food, beverages, and feed, especially in North-Eastern Europe. While rye is generally more tolerant to biotic and abiotic stresses than other cereals, it still can be infected by several diseases, including scald caused by Rhynchosporium secalis. The aims of this study were to investigate the genetic architecture of scald resistance, to identify genetic markers associated with scald resistance, which could be used in breeding of hybrid rye and to develop a model for genomic prediction for scald resistance. Four datasets with records of scald resistance on a population of 251 hybrid winter rye lines grown in 2 years and at 3 locations were used for this study. Four genomic models were used to obtain variance components and heritabilities of scald resistance. All genomic models included additive genetic effects of the parental components of the hybrids and three of the models included additive-by-additive epistasis and/or dominance effects. All models showed moderate to high broad sense heritabilities in the range of 0.31 (SE 0.05) to 0.76 (0.02). The model without non-additive genetic effects and the model with dominance effects had moderate narrow sense heritabilities ranging from 0.24 (0.06) to 0.55 (0.08). None of the models detected significant non-additive genomic variances, likely due to a limited data size. A genome wide association study was conducted to identify markers associated with scald resistance in hybrid winter rye. In three datasets, the study identified a total of twelve markers as being significantly associated with scald resistance. Only one marker was associated with a major quantitative trait locus (QTL) influencing scald resistance. This marker explained 11-12% of the phenotypic variance in two locations. Evidence of genotype-by-environment interactions was found for scald resistance between one location and the other two locations, which suggested that scald resistance was influenced by different QTLs in different environments. Based on the results of the genomic prediction models and GWAS, scald resistance seems to be a quantitative trait controlled by many minor QTL and one major QTL, and to be influenced by genotype-by-environment interactions.

Global dispersal and diversity of rust fungi in the context of plant health.

Long-distance dispersal of plant pathogens at the continental scale may have strong implications on plant health, in particular when incursions result in spread of disease to new territories where the disease was previously absent or insignificant. These dispersions may be caused by airborne transmission of spores or accidental spread via human travel and trade. Recent surveillance efforts of cereal rust fungi have demonstrated that incursion of new strains with superior fitness into areas where the disease is already established may have similar implications on plant health. Since dispersal events are highly stochastic, irrespective of transmission mechanism, critical mitigation efforts include preparedness by coordinated pathogen surveillance activities, host crop diversification, and breeding for disease resistance with low vulnerability to sudden changes in the pathogen population.