Water-Tryptophan Interactions: Lone-pair⋠⋠⋠π or O-H⋠⋠⋠π? Molecular Dynamics Simulations of ß-Galactosidase Suggest that Both Modes Can Co-exist.

In proteins, the indole side chain of tryptophan can interact with water molecules either in-plane, forming hydrogen bonds, or out-of-plane, with the water molecule contacting the aromatic π face. The latter interaction can be either of the lone pair⋅⋅⋅π (lp⋅⋅⋅π) type or corresponds to the O-H⋅⋅⋅π binding mode, an ambiguity that X-ray structures usually do not resolve. Here, we report molecular dynamics (MD) simulations of a solvated ß-galactosidase monomer, which illustrate how a water molecule located at the π face of an indole side chain of tryptophan can adapt to the position of proximate residues and "select" its binding mode. In one such site, the water molecule is predicted to rapidly oscillate between the O-H⋅⋅⋅π and lp⋅⋅⋅π binding modes, thus gaining entropic advantage. Our MD simulations provide support for the role of lp⋅⋅⋅π interactions in the stabilization of protein structures.

Protein environment affects the water-tryptophan binding mode. MD, QM/MM, and NMR studies of engrailed homeodomain mutants.

Water molecules can interact with aromatic moieties using either their O-H bonds or their lone-pairs of electrons. In proteins, water-π interactions have been reported to occur with tryptophan and histidine residues, and dynamic exchange between O-Hπ hydrogen bonding and lone-pairπ interactions was suggested to take place, based on ab initio calculations. Here we used classical and QM/MM molecular dynamics simulations, complemented with an NMR study, to examine a specific water-indole interaction observed in the engrailed homeodomain and in its mutants. Our simulations indicate that the binding mode between water and indole can adapt to the potential created by the surrounding amino acids (and by the residues at the DNA surface in protein-DNA complexes), and support the model of dynamic switching between the O-Hπ hydrogen bonding and lone-pairπ binding modes.

Anion-π Interactions in Flavoproteins Involve a Substantial Charge-Transfer Component.

Anion-π interactions have been shown to stabilize flavoproteins and to regulate the redox potential of the flavin cofactor. They are commonly attributed to electrostatic forces. Herein we show that anion-flavin interactions can have a substantial charge-transfer component. Our conclusion emanates from a multi-approach theoretical analysis and is backed by previously reported observations of absorption bands, originating from charge transfer between oxidized flavin and proximate cysteine thiolate groups. This partial covalency of anion-flavin contacts renders classical simulations of flavoproteins questionable.

Lone pair-π interactions in biological systems: occurrence, function, and physical origin.

Lone pair-π interactions are now recognized as a supramolecular bond whose existence in biological systems is documented by a growing number of examples. They are commonly attributed to electrostatic forces. This review attempts to highlight some recent discoveries evidencing the important role which lone pair-π interactions, and anion-π interactions in particular, play in stabilizing the structure and affecting the function of biomolecules. Special attention is paid to studies exploring the physical origin of these at first glance counterintuitive interactions between a lone pair of electrons of one residue and the π-cloud of another. Recent theoretical work went beyond the popular electrostatic model and inquired the extent to which orbital interactions have to be taken into account. In at least one biologically relevant case-that of anion-flavin interactions-a substantial charge-transfer component has been shown to operate.

Lone-pair-π interactions: analysis of the physical origin and biological implications.

Lone-pair-π (lp-π) interactions have been suggested to stabilize DNA and protein structures, and to participate in the formation of DNA-protein complexes. To elucidate their physical origin, we have carried out a theoretical multi-approach analysis of two biologically relevant model systems, water-indole and water-uracil complexes, which we compared with the structurally similar chloride-tetracyanobenzene (TCB) complex previously shown to contain a strong charge-transfer (CT) binding component. We demonstrate that the CT component in lp-π interactions between water and indole/uracil is significantly smaller than that stabilizing the Cl(-)-TCB reference system. The strong lp(Cl(-))-π(TCB) orbital interaction is characterized by a small energy gap and an efficient lp-π* overlap. In contrast, in lp-π interactions between water and indole or uracil, the corresponding energy gap is larger and the overlap less efficient. As a result, water-uracil and water-indole interactions are weak forces composed by smaller contributions from all energy components: electrostatics, polarization, dispersion, and charge transfer. In addition, indole exhibits a negative electrostatic potential at its π-face, making lp-π interactions less favorable than O-Hπ hydrogen bonding. Consequently, some of the water-tryptophan contacts observed in X-ray structures of proteins and previously interpreted as lp-π interactions [Luisi, et al., Proteins, 2004, 57, 1-8], might in fact arise from O-Hπ hydrogen bonding.

On the non-classical contribution in lone-pair-π interaction: IQA perspective.

In the present work the nature of lone-pair-π interactions between water molecules and a number of π-rings with different substituents/hetero-atoms in the light of quantum chemical topology approaches is studied. The Quantum Theory of Atoms in Molecules (QTAIM) and Interacting Quantum Atoms (IQA) were employed for distinguishing the role of heteroatoms and electron withdrawing substituents in the complex formation between water and π-rings. Our IQA study identified three classes of water-π complexes on the basis of the relative role of electrostatics (classical) and exchange-correlation (non-classical) factors in the interaction energy between the oxygen of water (the lone-pair donor) and the sp(2) atoms of the π-ring, i.e. the primary lp-π interaction. Considering both the primary and secondary (the rest of interatomic interactions except Owater-π-ring atoms) interactions demonstrates that the exchange-correlation is the dominant contributor to the binding energy. This proves a non-negligible contribution of non-classical factors in the stabilization of the lone-pair-π complexes. However, in spite of a relatively large contribution of the exchange-correlation, this part of the interaction energy is virtually counterbalanced by the deformation energy, i.e. the increase in atomic kinetic energy upon complexation. This finding clarifies why water-π interactions can be modelled by simple electrostatics without the need to invoke quantum effects.

Quantum chemical topology study of the water-platinum(II) interaction.

The "inverse hydration" of neutral complexes of Pt(II) by an axial water molecule, whose one OH-bond is oriented toward Pt, has been the subject of recent works, theoretical as well as experimental. To study the influence of the ligands on this non-conventional H-bond, we extend here our previous energy calculations, using the second-order Moeller-Plesset perturbation theory (MP2) method together with the Dolg-Pélissier pseudopotential for platinum, to various neutral complexes including the well-known chemotherapeutic agent "cisplatin". The stabilization energy, depending on the nature and the configuration of platinum ligands, is dominated by the same important dispersive component, for all the investigated complexes. For a further characterization of this particular H-bond, we used the atoms in molecules theory (AIM) and the topological analysis of the electron localization function (ELF). The charge transfer occurring from the complex to the water molecule and the Laplacian of the density at the bond critical point between water and Pt are identified as interesting AIM descriptors of this non-conventional H-bond. Beyond this AIM analysis, we show that the polarization of the ELF bonding O-H basin involved in the non-conventional H-bond is enhanced during the approach of the water molecule to the Pt complexes. When the water medium, treated in an implicit solvation model, is taken into account, the interaction energies become independent on the nature and configuration of platinum ligands. However, the topological descriptors remain qualitatively unchanged.

Evaluation of dissociation constants from competition binding experiments based on the relative binding ratio.

Methods probing protein-DNA associations include direct binding titrations and competition binding experiments. For the latter, we present here a simple procedure allowing the quantitative evaluation of dissociation constants. We show that the ratio between the fraction of a DNA probe bound to protein in the absence of competitor and that in the presence of competitor is, at large competitor concentrations, a linear function of the competitor concentration, and we derive equations allowing the dissociation constant for the protein-competitor complex to be evaluated from the slope. We show further that a self-competition experiment, where the DNA probe and competitor are chemically the same species, can be used as a complement to a direct titration to determine the fraction of protein that is correctly folded for specific DNA binding. Thus, such a combination of direct and self-competition titration can be used as a check of the conformational purity of DNA binding proteins.

Cisplatin adducts on a GGG sequence within a DNA duplex studied by NMR spectroscopy and molecular dynamics simulations.

The antitumor drug cisplatin(cis-[PtCl2(NH3)2]) reacts with cellular DNA to form GG intrastrand adducts between adjacent guanines as predominant lesions. GGG sites have been shown to be hotspots of platination. To study the structural perturbation induced by binding of cisplatin to two adjacent guanines of a GGG trinucleotide,we examined here the decanucleotide duplex d[(G1C2C3G*4 G*5 G6T7-C8G9C10).d(G11C12G13A14C15C16C17G18-G19C20)] (dsCG*G*G) intrastrand cross-linked at the G* guanines by cis-{Pt(NH3)2}2+ using NMR spectroscopy and molecular dynamics (MD) simulations.The NMR spectra of dsCG*G*G were found to be similar to those of previously characterized DNA duplexes cross-linked by cisplatin at apyG*G*X site (py=pyrimidine; X=C,T, A). This similarity of NMR spectra indicates that the base at the 3'-side of the G*G*-Pt cross-link does not affect the structure to a large extent. An unprecedented reversible isomerization between the duplex dsCG*G*G (bearing a G*4 G*5 -Pt chelate) and duplex dsGG*G*T (bearing a G*5 G*6 -Pt chelate)was observed, which yielded a 40:60 equilibrium between the two intrastrand GG-Pt cross-links. No formation of interstrand cross-links was observed.NMR spectroscopic data of dsCG*G*G indicated that the deoxyribose of the 5'-G* adopts an N-type conformation, and the cytidines C3, C15,and C16 have average phase angles intermediate between S and N. The NMR spectroscopic chemical shifts of dsGG*G*T showed some fundamental differences to those of pyG*G*-platinum adducts but were in agreement with the NMR spectra reported previously for the DNA duplexes crosslinked at an AG*G*C sequence by cisplatin or oxaliplatin. The presence of apurine instead of a pyrimidine at the 5'-side of the G*G* cross-link seems therefore to affect the structure of the XG* step significantly.

Synthetic route to dinuclear platinum(II) complexes [{trans-PtCl(NH3)2}2(mu-L)]2+ (L = aliphatic or heterocyclic diamine) as potential antitumor agents, exploiting the mutual activation of hydroxido ligands and ammonium groups.

A simple and efficient method for the synthesis of potentially antitumor-active dinuclear platinum complexes of the general formula [{trans-PtCl(NH3)2}2(mu-L)]((n+2)+) (L = aliphatic or heterocyclic diamine; n = charge of L) is presented. The procedure is based on the mutual in situ activation of trans-[PtCl(OH)(NH3)2] and the linker L in the form of a diammonium salt. This synthetic pathway yielded the Farrell compound [{trans-PtCl(NH3)2}2{mu-NH2(CH2)6NH2}]Cl2 (BBR3005) in quantitative yield. Using the same procedure, we prepared the new pyrazolate-bridged compound [{trans-PtCl(NH3)2}2(mu-pz)]Cl, determined its X-ray structure, and tested its cytotoxicity against three wild-type and one cisplatin-resistant cell lines.

LEF-1 recognition of platinated GG sequences within double-stranded DNA. Influence of flanking bases.

The lymphoid enhancer-binding factor 1 (LEF-1) recognizes a double-stranded 9 base-pairs (bp) long motif in DNA which is significantly bent upon binding. This bend is centered at two destacked adenines whose geometry closely resembles that of two adjacent guanines crosslinked by the antitumor drug cisplatin. It has been proposed that cisplatin-GG crosslinks could hijack high mobility group (HMG) box containing transcription factors such as LEF-1. In order to examine such a possibility, we used electrophoretic mobility shift assays to determine the affinity of the HMG box of LEF-1 for a series of 25 oligonucleotides containing a central GG sequence, free or site-specifically modified by cisplatin. The binding affinity of the GG-platinated oligonucleotides was 3-6-fold higher than that determined for the corresponding unplatinated oligonucleotides, however, the binding to all cisplatin-modified oligonucleotides was at least 1 order of magnitude weaker than that to the 25 bp oligonucleotide containing the recognition 9 bp motif. The binding affinity was dependent on the nature of bases flanking the cisplatin-crosslinked G(*)G(*) dinucleotide, the AG(*)G(*)T sequence displaying the strongest affinity and CG(*)G(*)T showing the strongest binding enhancement upon platination. In contrast, modification of the AGGT sequence with the third-generation platinum antitumor drug oxaliplatin did not enhance the affinity significantly. These results suggest that the cisplatin-caused bending of DNA does produce a target for LEF-1 binding, however, the cisplatinated DNA does not appear to be a strong competitor for the LEF-1 recognition sequence.

Recognition complex between the HMG domain of LEF-1 and its cognate DNA studied by molecular dynamics simulations with explicit solvation.

Molecular dynamics simulations of the complex formed between the HMG box of the lymphoid enhancer-binding factor (LEF-1) and its cognate DNA duplex were carried out with explicit inclusion of water. The simulation started with an NMR-based model (pdb code 2LEF) and the dynamics was pursued for 10 nanoseconds without constraints. It revealed that water intervenes in many ionic/polar interactions, establishing in particular local equilibria between direct and water-mediated hydrogen bonds, and thus increasing the entropy of the complex. Quite unexpectedly, the simulation indicated that a binding pocket for a specific water molecule may be reversibly formed at the apex of the bend induced in the DNA helix by LEF-1 binding, where a methionine side chain intercalates between two destacked adenines. We observed that the specific water molecule can temporarily replace the intercalated S-CH(3) group, acting as a sort of "extension" of the side chain. The residence time of this water molecule was about 3.5 ns. Simulations of the cognate DNA alone showed that this sequence has no intrinsic tendency to bend; therefore, the bending occurs solely as a consequence of the recognition, following the "induced-fit" mechanism.

Discrimination between BI and BII conformational substates of B-DNA based on sugar-base interproton distances.

Molecular dynamics (MD) simulations of four water-solvated DNA duplexes were used to generate a database of approximately 27000 dinucleotide conformations. Analyzing this database, we investigated the relationship between so-called BI-BII transitions and short-range interproton distances. Four H-H distances were found particularly sensitive to BI-BII transitions: internucleotide H1'(n)-H68(n+1), H2'(n)-H68(n+1), and H2"(n)-H68(n+1), and intranucleotide H2"(n)-H68(n). Determination of these distances using classical NOESY spectroscopy can thus provide valuable indications on the existence of BII substates, complementing the existing method based on (31)P chemical shifts and (31)P-(1)H spin-spin coupling constants.

GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides.

The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5)(') = 18 +/- 2 and k(3)(') = 15 +/- 1 M(-)(1) s(-)(1)), roughly twice as fast as the AG guanine of II (k(3)(') = 9 +/- 1 M(-)(1) s(-)(1)). Platination of the AG adenine of II was also observed to a minor extent (k(5)(') = 1.5 +/- 0.3 M(-)(1) s(-)(1)), whereas no other adenine of I or II was platinated to a detectable extent. The overall platination rate of I is approximately three times larger than that of II. The 3'-monoadduct of I undergoes chelation to the GG intrastrand adduct with a rate 10.5 times larger than the 5'-monoadduct (k(3)(')(c) = (1.9 +/- 0.1) x 10(-)(3) s(-)(1) and k(5)(')(c) = (0.18 +/- 0.05) x 10(-)(3) s(-)(1)). For II, the chelation rate constants of the guanine- and adenine-bound monoadducts are k(5)(')(c) = 0.3 +/- 0.1 and k(3)(')(c) = 0.08 +/- 0.01 s(-)(1), respectively. These results are discussed in relation to the platination kinetics determined for other model systems.

Kinetic Analysis of the Reactions between GG-Containing Oligonucleotides and Platinum Complexes. 1. Reactions of Single-Stranded Oligonucleotides with cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) and [Pt(NH(3))(3)(H(2)O)](2+).

Using concentration measurements based on high performance liquid chromatography, we have investigated the kinetics of reaction between single-stranded oligonucleotides containing a d(GpG) sequence, i.e., d(GG), d(TGG), d(TTGG), and d(CTGGCTCA), and the platinum complexes cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) (1) and [Pt(NH(3))(3)(H(2)O)](2+) (2). The rate constants for the substitution of one aqua ligand of platinum in 1 or 2 by each guanine of the oligonucleotides were individually measured, as well as, for 1, those for the subsequent conversion of the monoadducts to the diadduct. For the platination of d(GG) and d(TGG), the rate constants are similar for the 5'- and 3'-guanines. The longer oligonucleotides d(TTGG) and d(CTGGCTCA) are platinated slightly faster on the 5'-G than on the 3'-G. 2 shows a similar slight preference for the 5'-guanine, but it reacts by a factor of 4-10 more slowly than 1. For both complexes, the platination rate constants increase with increasing oligonucleotide length. Platination of the 5'-G by 1 is 1 order of magnitude faster on d(CTGGCTCA) than on d(GG). Concerning the chelation step giving the GG diadduct of 1, the longer the oligonucleotide, the larger is the ratio between the rates of the cyclization of the 3'- and 5'-monoadducts k(3)(')(c) and k(5)(')(c): k(3)(')(c)/k(5)(')(c) equals 1.4 for d(GG) and 3.3 for d(CTGGCTCA).

Model of the Second Most Abundant Cisplatin-DNA Cross-Link: X-ray Crystal Structure and Conformational Analysis of cis-[(NH(3))(2)Pt(9-MeA-N7)(9-EtGH-N7)](NO(3)).2H(2)O (9-MeA = 9-Methyladenine; 9-EtGH = 9-Ethylguanine).

A model compound of the second most abundant DNA adduct of the antitumor agent cisplatin has been synthesized and structurally and spectroscopically characterized and its conformational behavior examined: cis-[(NH(3))(2)Pt(9-MeA-N7)(9-EtGH-N7)](NO(3))(2).2H(2)O (9-MeA = 9-methyladenine; 9-EtGH = 9-ethylguanine) crystallizes in the monoclinic system, space group P2(1)/n (No. 14) with a = 7.931(2), b = 11.035(3), c = 26.757(6) Å, beta = 94.94(2) degrees, and Z = 4. The two purine bases adopt a head-to-head orientation, with NH(2) of 9-MeA and CO of 9-EtGH being at the same side of the Pt coordination plane. A theoretical conformational analysis of the complex cis-[(NH(3))(2)Pt(Ade)(Gua)](2+) (Ade = adenine; Gua = guanine) based on molecular mechanics calculations of the nonbonded energy has revealed four minimum-energy zones similar to those derived previously for cis-[(NH(3))(2)Pt(Gua)(2)](2+) (Kozelka; et al. Eur. J. Biochem. 1992, 205, 895). This conformational analysis has allowed, together with the calculation of chemical shifts due to ring effects, the attribution of the two conformers observed for cis-[(NH(3))(2)Pt{d(ApG)}](+) by Dijt et al. (Eur. J. Biochem. 1989, 179, 344) to the two head-to-head conformational zones. The orientation of the two nucleobases in the crystal structure of cis-[(NH(3))(2)Pt(9-MeA)(9-EtGH)](2+) corresponds, according to our analysis, roughly to that preferentially assumed by the minor rotamer of cis-[(NH(3))(2)Pt{d(ApG)}](+).

Kinetic study of azole-bridged dinuclear platinum(II) complexes reacting with a hairpin-stabilized double-stranded oligonucleotide.

The cytotoxic dinuclear platinum(II) complexes [[cis-Pt(NH(3))(2)](2)(mu-OH)(mu-pz)](NO(3))(2) (pz=pyrazolate) (1) and [[cis-Pt(NH(3))(2)](2)(mu-OH)(mu-1,2,3-ta-N1,N2)](NO(3))(2) (1,2,3-ta=1,2,3-triazolate) (2), were allowed to react with the hairpin-stabilized double-stranded oligonucleotide d(TATGGCATT(4)ATGCCATA), to determine the amounts of intrastrand and interstrand DNA adducts. The reaction kinetics was investigated by reversed-phase HPLC, and the resulting products were analyzed using mass spectroscopy combined with enzymatic digestion, and Maxam-Gilbert sequencing. The reaction of 1 results in the formation of the 1,2-intrastrand d(GG) adduct as the major final product. The two most abundant products of 2 were identified as isomeric 1,2-intrastrand d(GG) adducts differing probably in platinum coordination to the triazole ring. No GG-interstrand crosslinks were detected with either compound. d(GGC)-d(GCC) sequences of DNA do thus not appear to represent significant targets for forming interstrand crosslinks with either 1 or 2.

Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound.

Platinum-DNA interstrand crosslinks: molecular determinants of bending and unwinding of the double helix.

Platinum diamine complexes are able to crosslink the guanines of d(GC)(2) dinucleotides within double-stranded DNA. The interstrand crosslink thus formed causes a bend of the double helix toward the minor groove and the helical sense changes locally to left-handed, resulting in a considerable unwinding. The bend and unwinding angles have been shown to depend on the platinum ligands. Here, we have used molecular dynamics simulations to investigate the DNA 20-mer d(C(1)T(2)C(3)T(4)C(5)C(6)T(7)T(8)G*(9)C(10)T(11)C(12)T(13)C(14)C(15)T(16)T(17)C(18)T(19)C(20))-d(G(21)A(22)G(23)A(24)A(25)G(26)G(27)A(28)G(29)A(30)G*(31)C(32)A(33)A(34)G(35)G(36)A(37)G(38)A(39)G(40)) with the G* guanines crosslinked by cis-Pt(NH(3))(2)(2+), Pt(R,R-DACH)(2+), or Pt(S,S-DACH)(2+). Previous investigations on cisplatin interstrand adducts indicated that the structure is similar in solid state and in solution; thus, we used the reported X-ray structure of a cisplatin adduct as a starting model. Replacing in the MD-relaxed model for the DNA duplex crosslinked with cis-Pt(NH(3))(2)(2+) the two NH(3) platinum ligands by R,R-DACH or S,S-DACH led to clashes between the DACH residue and the deoxyribose of C(12). Confrontation of MD-derived models with gel shift measurements suggested that these clashes are avoided differently in the adducts of Pt(R,R-DACH)(2+)versus Pt(S,S-DACH)(2+). The R,R-isomer avoids the clash by untwisting the T(11)/A(30)-C(12)/G(29) step, thus increasing the global unwinding. In contrast, the S,S-isomer modifies the shift and slide parameters of this step, which dislocates the helical axis and enhances the bend angle. The clash that leads to the differentiation of the structures as a function of the diamine ligand is related to a hydrogen bond between the platinum complex and the T(11) base and could be characteristic of interstrand crosslinks at d(pyG*Cpy)-d(puG*Cpu) sequences.