RESUMO
The cornea has the densest sensory innervation of the body, originating primarily from neurons in the trigeminal ganglion. The basic principles of cornea nerve patterning have been established many years ago using classic neuroanatomical methods, such as immunocytochemistry and electrophysiology. Our understanding of the morphology and distribution of the sensory nerves in the skin has considerably progressed over the past few years through the generation and analysis of a variety of genetically modified mouse lines. Surprisingly, these lines were not used to study corneal axons. Here, we have screened a collection of transgenic and knockin mice (of both sexes) to select lines allowing the visualization and genetic manipulation of corneal nerves. We identified multiple lines, including some in which different types of corneal axons can be simultaneously observed with fluorescent proteins expressed in a combinatorial manner. We also provide the first description of the morphology and arborization of single corneal axons and identify three main types of branching pattern. We applied this genetic strategy to the analysis of corneal nerve development and plasticity. We provide direct evidence for a progressive reduction of the density of corneal innervation during aging. We also show that the semaphorin receptor neuropilin-1 acts cell-autonomously to control the development of corneal axons and that early axon guidance defects have long-term consequences on corneal innervation.SIGNIFICANCE STATEMENT We have screened a collection of transgenic and knockin mice and identify lines allowing the visualization and genetic manipulation of corneal nerves. We provide the first description of the arborization pattern of single corneal axons. We also present applications of this genetic strategy to the analysis of corneal nerve development and remodeling during aging.
Assuntos
Córnea/inervação , Plasticidade Neuronal/genética , Envelhecimento/fisiologia , Animais , Axônios/fisiologia , Linhagem Celular , Córnea/crescimento & desenvolvimento , Feminino , Técnicas de Introdução de Genes , Masculino , Camundongos , Camundongos Transgênicos , Neuropilina-1/genética , Tamoxifeno/farmacologiaRESUMO
Integrons are genetic elements that can acquire and rearrange gene cassettes. The blaBEL-1 gene encodes an extended-spectrum ß-lactamase, BEL-1, that is present at the second position of the variable region of class 1 integrons identified in Pseudomonas aeruginosa The mobility of the bel-1 gene cassette was analyzed under physiological conditions and with the integrase gene being overexpressed. Cassette mobility in Escherichia coli was detected by excision/integration into the recipient integron In3 on the conjugative plasmid R388 with the overproduced integrase. Despite several antibiotic pressures, the bel-1 cassette remained at the second position in the integron, highlighting its stability in P. aeruginosa Overexpression of the integrase gene in E. coli induced bel-1 cassette recombination. However, cassettes containing two genes (blaBEL-1 and smr2 or blaBEL-1 and aacA4) were excised, suggesting that the bel-1 cassette attC site was defective. We show that bel-1 is a stable gene cassette under physiological growth conditions, irrespective of the selective antibiotic pressure, that may be mobilized upon overexpression of the integrase gene.
Assuntos
Integrases/genética , Pseudomonas aeruginosa/enzimologia , Pseudomonas aeruginosa/genética , beta-Lactamases/genética , Antibacterianos/farmacologia , DNA Bacteriano/genética , Escherichia coli/efeitos dos fármacos , Escherichia coli/enzimologia , Escherichia coli/genética , Integrons/genética , Pseudomonas aeruginosa/efeitos dos fármacos , Recombinação Genética/genéticaRESUMO
Profile, regulatory, and investigative sampling were completed in six utilities to study the impact of partial and full lead service line replacements (LSLRs) on water lead levels (WLLs) and consumer's exposure. As compared to households with no replacement, lead release after partial LSLR (PLSLR) was generally greater in the short term (3-50 days), and comparable or lower in the medium (<2 years) and long-term (>2 years). This was mainly explained by insufficient time elapsed to stabilize scales after disturbances to the service line. One utility showed sustained lead release over 18 months after PLSLR. Moreover, the reduction in WLLs was small when analyzing results for the same households. As a comparison, full LSLR decreased WLLs drastically and immediately. The occurrence of low (0-5 µg/L) to high (≥50 µg/L) WLLs in the profiles varied between households and reflected the variability of exposure among households in the same system. Using this probability of occurrence, the distribution of WLLs of exposure was estimated for households with or without a PLSLR, and used to model young children blood lead levels (BLLs) for both groups of households. The range of modeled BLLs decreased slightly for households with PLSLR, but still overlapped the range estimated for households with no replacement. This analysis suggests that, in a system, PLSLRs do not reduce young children blood lead levels except in a fraction of households.
Assuntos
Água Potável , Publicações , Poluentes Químicos da Água , Criança , Pré-Escolar , Exposição Ambiental , Humanos , Chumbo , ProbabilidadeRESUMO
Thirty-three households were monitored in a full-scale water distribution system, to investigate the impact of recent (<2 yr) or old partial lead service line replacements (PLSLRs). Total and particulate lead concentrations were measured using repeat sampling over a period of 1-20 months. Point-of-entry filters were installed to capture sporadic release of particulate lead from the lead service lines (LSLs). Mean concentrations increased immediately after PLSLRs and erratic particulate lead spikes were observed over the 18 month post-PLSLR monitoring period. The mass of lead released during this time frame indicates the occurrence of galvanic corrosion and scale destabilization. System-wide, lead concentrations were however lower in households with PLSLRs as compared to those with no replacement, especially for old PLSLRs. Nonetheless, 61% of PLSLR samples still exceeded 10 µg/L, reflecting the importance of implementing full LSL replacement and efficient risk communication. Acute concentrations measured immediately after PLSLRs demonstrate the need for appropriate flushing procedures to prevent lead poisoning.
Assuntos
Água Potável , Intoxicação por Chumbo/prevenção & controle , Chumbo/análise , Engenharia Sanitária , Água , Poluentes Químicos da Água , Abastecimento de ÁguaRESUMO
BACKGROUND: To evaluate quantitative and qualitative changes in sub-basal corneal nerves (SBN) via in vivo confocal microscopy in patients with Sjögren syndrome dry eye (SSDE) treated with topical cyclosporine A (CsA). DESIGN: Prospective, observational, non-randomized study. PARTICIPANTS: Thirty eyes of 30 patients with SSDE refractory to conventional treatment treated with CsA 0.05% twice daily for 6 months. Fifteen eyes of 15 healthy, age and gender matched, volunteers constituted the control group at baseline. METHODS: A clinical evaluation of dry eye, corneal sensation using Cochet-Bonnet esthesiometry and in vivo confocal microscopy analysis of the central cornea were performed prospectively at baseline for all patients, and after 6 months of treatment with CsA. MAIN OUTCOME MEASURES: Density, number, reflectivity and tortuosity of SBN, dendritic cell (DC) density, esthesiometry, and dry eye signs and symptoms. RESULTS: Topical CsA 0.05% improved clinical signs and symptoms, and increased corneal sensitivity. Following treatment, SBN density was significantly increased (P < 0.0001) associated with a decreased in DC density (P < 0.0001). The increase in SBN density after treatment was positively correlated with baseline SBN density (R2 = 0.33; P = 0.0008) and negatively correlated with baseline Ocular Surface Disease Index (R2 = 0.28; P = 0.002), Oxford score (R2 = 0.31; P = 0.002), and DC density (R2 = 0.37; P = 0.0003). CONCLUSIONS: Topical CsA led to an increase in corneal SBN density, improving clinical signs and symptoms of SSDE. Our results also suggest an improved response to treatment in patients with less initial nerve damage.
Assuntos
Córnea/inervação , Ciclosporina/administração & dosagem , Fibras Nervosas/patologia , Nervo Oftálmico/patologia , Sensação/efeitos dos fármacos , Síndrome de Sjogren/tratamento farmacológico , Administração Tópica , Contagem de Células , Relação Dose-Resposta a Droga , Seguimentos , Humanos , Imunossupressores/administração & dosagem , Microscopia Confocal , Nervo Oftálmico/fisiopatologia , Estudos Prospectivos , Síndrome de Sjogren/diagnóstico , Síndrome de Sjogren/fisiopatologiaRESUMO
PURPOSE: To assess the effects of 360-degree laser retinopexy on human corneal subbasal nerve plexus and to investigate correlations among corneal subbasal nerve plexus density, corneal epithelial thickness, and corneal sensitivity. DESIGN: Prospective, observational, nonrandomized study. PARTICIPANTS: A total of 15 eyes of 15 patients who underwent pars plana vitrectomy (PPV) with 360-degree laser retinopexy for retinal detachment (RD) and 15 eyes of 15 patients who underwent PPV for macular hole (MH) without laser treatment. METHODS: Corneal sensation, corneal epithelial thickness, and corneal subbasal nerve plexus density were assessed before surgery and 6 months after surgery via in vivo confocal microscopy, anterior segment optical coherence tomography (AS-OCT), and Cochet-Bonnet esthesiometry (Luneau Ophthalmologie, Paris, France). MAIN OUTCOME MEASURES: Corneal subbasal nerve plexus density, corneal epithelium thickness, and central corneal sensitivity. RESULTS: Compared with baselines values, the mean subbasal nerve density (P < 0.001), mean corneal epithelium thickness (P = 0.006), and mean corneal sensitivity (P < 0.001) in the RD group were significantly decreased 6 months after surgery by 74.3%, 4.7%, and 56.6%, respectively. Conversely, in the MH group there were no significant differences in the mean subbasal nerve density (P = 0.34), mean corneal epithelial thickness (P = 0.19), and mean corneal sensitivity (P = 0.42) between preoperative and 6-month postoperative values (0.7%, 0.4%, and 0.8%, respectively). The postoperative decrease in corneal subbasal nerve density after laser retinopexy was associated with a decrease in corneal epithelium thickness (r(2) = 0.42; P = 0.006) and a decrease in corneal sensitivity (r(2) = 0.48; P = 0.004). The postoperative decrease in corneal sensitivity poorly correlated with the decrease in corneal epithelial thickness (r(2) = 0.24; P = 0.045). Postoperative corneal nerve density decreased as total laser energy increased (r(2) = 0.51; P = 0.002). CONCLUSIONS: Subbasal corneal nerve plexus density decreases after 360-degree laser retinopexy and is accompanied by epithelium thinning and decreased corneal sensation. Surgeons should eschew heavy confluent retinal laser treatment, and corneal sensitivity should be assessed postoperatively to determine whether significant anesthesia has occurred. In such instances, prophylactic measures may be warranted against the development of neurotrophic ulcers.
Assuntos
Córnea/inervação , Córnea/fisiopatologia , Crioterapia/efeitos adversos , Epitélio Corneano/patologia , Fibras Nervosas/patologia , Doenças do Nervo Trigêmeo/fisiopatologia , Idoso , Idoso de 80 Anos ou mais , Tamponamento Interno , Feminino , Fluorocarbonos/administração & dosagem , Humanos , Terapia a Laser/métodos , Masculino , Microscopia Confocal , Pessoa de Meia-Idade , Estudos Prospectivos , Descolamento Retiniano/cirurgia , Perfurações Retinianas/cirurgia , Hexafluoreto de Enxofre/administração & dosagem , Tomografia de Coerência Óptica , Doenças do Nervo Trigêmeo/etiologia , VitrectomiaRESUMO
PURPOSE: To define the optical coherence tomography (OCT) corneal changes predisposing to acute corneal hydrops among patients with advanced keratoconus. DESIGN: Retrospective cohort study. PARTICIPANTS: A total of 191 advanced keratoconic eyes from 191 patients with advanced keratoconus cases were studied. METHODS: Data collected from patients with advanced keratoconus cases were studied during a minimum period of 24 months of follow-up. High-resolution Fourier-domain corneal OCT (5 µm of axial resolution) and corneal topography were performed every 4 months during the follow-up. Several anatomic features at the keratoconus cone were analyzed with OCT, including epithelial and stromal thicknesses, the aspect of Bowman's layer, the presence of Vogt's striae, and stromal opacities. A comparative analysis between anatomic corneal features in eyes that developed corneal hydrops and those that did not develop this complication during the follow-up was performed. MAIN OUTCOME MEASURES: Evaluation of anatomic corneal changes at risk of developing a corneal hydrops on the basis of OCT findings. RESULTS: Eleven cases of corneal hydrops (5.8%) occurred in our series during a mean follow-up of 30 months (24-36 months). All of these patients were male and younger (23.7±5.9 years) than patients with no acute keratoconus (32.7±11.3 years). Increased epithelial thickening with stromal thinning at the conus and the presence of anterior hyperreflectives at the Bowman's layer level were significantly associated with corneal hydrops, whereas the presence of corneal scarring was a preventive factor. At the healing stage, a pan-stromal scar occurs, with a significant stromal thickening and cornea flattening. CONCLUSIONS: Increased epithelial thickening, stromal thinning at the keratoconus cone, anterior hyperreflectives at the Bowman's layer level, and the absence of stromal scarring are associated with a high risk of developing corneal hydrops. These aspects should be taken into account by the clinician in the evaluation of keratoconus eyes and in the planning of corneal keratoplasty.
Assuntos
Edema da Córnea/diagnóstico , Substância Própria/patologia , Epitélio Corneano/patologia , Ceratocone/diagnóstico , Tomografia de Coerência Óptica , Doença Aguda , Adolescente , Adulto , Topografia da Córnea , Feminino , Seguimentos , Análise de Fourier , Humanos , Ceratocone/classificação , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Adulto JovemRESUMO
BACKGROUND: Keratoplasty may induce major spherical refractive error related to abnormal corneal radius of curvature (CRC). METHODS: Two hundred and thirty-eight consecutive eyes of 238 patients with clear graft and at least one postoperative Orbscan examination performed after suture removal (average follow-up time, 86 months) were retrospectively analyzed. Anterior lamellar keratoplasties (ALK group, n = 119) and penetrating keratoplasties (PK group, n = 119) were matched for preoperative diagnosis and lens status. RESULTS: The average postoperative, suture-out, Orbscan 3-mm CRC was 7.17 mm with a wide 95 % confidence interval [6.26 mm; 8.37 mm]. It was 7.05 mm in the ALK group and 7.31 mm in the PK group (p < 0.01). In the ALK group, this figure was 7.00 mm for oversized grafts and 7.67 mm for non-oversized grafts (p < 0.001). CRC values were significantly lower for eyes with keratoconus (7.00 mm) or stromal scar after infectious keratitis (7.06 mm) compared with stromal scar after trauma (7.74 mm) or stromal dystrophies (8.17 mm). Values were significantly lower for big-bubble ALKs (6.92 mm) and manual dissection-ALKs (7.14 mm) compared with PKs (7.31 mm) and microkeratome-assisted ALKs (7.45 mm). The average Orbscan 3-mm SimK cylinder, irregularity, and refractive power symmetry index were, respectively, 4.7 D/4.8 D/1.9 D for ALKs and 5.2 D/4.8 D/1.8 D for PKs (p = 0.99). CONCLUSIONS: The CRC is lower after ALK compared with PK, and features important variability. In eyes with ALK, non-oversized grafts result in postoperative CRC close to normal values and corneal diseases associated with stromal thinning and DALK result in lower postoperative CRC.
Assuntos
Córnea/patologia , Doenças da Córnea/cirurgia , Topografia da Córnea , Transplante de Córnea , Ceratoplastia Penetrante , Refração Ocular/fisiologia , Humanos , Tamanho do Órgão , Estudos Retrospectivos , Doadores de Tecidos , Preservação de TecidoRESUMO
OBJECTIVE: To study corneal morphologic changes in a large keratoconic population and to establish a structural optical coherence tomography (OCT) classification. DESIGN: Cross-sectional, observational study. PARTICIPANTS: A total of 218 keratoconic eyes from 218 patients and 34 eyes from 34 normal subjects. METHODS: A Fourier-domain OCT system with 5-µm axial resolution was used. For each patient, 3 high-resolution scans were made across the keratoconus cone. All scans were analyzed by keratoconus specialists who were not given access to patients' clinical and topographic data, and who established an OCT classification. The reproducibility of the classification and its correlation with clinical and paraclinical characteristics of patients with keratoconus were evaluated. The OCT examinations were performed every 4 months to follow up structural corneal changes. MAIN OUTCOME MEASURES: Evaluation of the structural corneal changes occurring in keratoconus cases with various stages of severity based on OCT findings. RESULTS: Fourier-domain OCT classification containing 5 distinct keratoconus stages is proposed. Stage 1 demonstrates thinning of apparently normal epithelial and stromal layers at the conus. Stage 2 demonstrates hyperreflective anomalies occurring at the Bowman's layer level with epithelial thickening at the conus. Stage 3 demonstrates posterior displacement of the hyperreflective structures occurring at the Bowman's layer level with increased epithelial thickening and stromal thinning. Stage 4 demonstrates pan-stromal scar. Stage 5 demonstrates hydrops; 5a, acute onset: Descemet's membrane rupture and dilaceration of collagen lamellae with large fluid-filled intrastromal cysts; 5b, healing stage: pan-stromal scarring with a remaining aspect of Descemet's membrane rupture. The reproducibility of the classification was very high between the corneal specialist observers. Clinical and paraclinical characteristics of keratoconus, including visual acuity, corneal epithelium and stromal thickness changes, corneal topography, biomechanical corneal characteristics, and microstructural changes observed on confocal microscopy, were concordant with our OCT grading. CONCLUSIONS: Optical coherence tomography provides an accurate assessment of structural changes occurring in keratoconus eyes. These changes were correlated with clinical and paraclinical characteristics of patients. The established classification not only allows structural follow-up of patients with keratoconus but also provides insight into the pathogenesis of keratoconus and treatment strategies for future research.
Assuntos
Córnea/patologia , Ceratocone/classificação , Ceratocone/diagnóstico , Tomografia de Coerência Óptica/métodos , Adolescente , Adulto , Idoso , Fenômenos Biomecânicos , Paquimetria Corneana , Substância Própria/patologia , Topografia da Córnea , Estudos Transversais , Epitélio Corneano/patologia , Feminino , Análise de Fourier , Humanos , Masculino , Microscopia Confocal , Pessoa de Meia-Idade , Estudos Prospectivos , Reprodutibilidade dos Testes , Acuidade Visual/fisiologia , Adulto JovemRESUMO
BACKGROUND: To evaluate the incidence, evolution, clinical characteristics, possible risk factors or preventive factors, and visual outcomes of epiretinal membrane (ERM) recurrence. METHODS: Retrospective study of 440 consecutive patients (440 eyes) who underwent pars plana vitrectomy for ERM. The internal limiting membrane (ILM) was peeled in 266 cases, with the help of indocyanine green in 27 cases and brilliant blue in 45 cases. Cases of symptomatic ERM recurrence were reoperated. RESULTS: The incidence of ERM recurrence was 5% (22/440), and 2% of the patients were reoperated (9/440). Epiretinal membrane recurrence was symptomatic in 9 cases (41%) and asymptomatic in 13 cases (59%). ILM peeling was the only factor preventing ERM recurrence (adjusted odds ratio = 0.33, P = 0.026). The use of staining dyes did not prevent recurrence (adjusted odds ratio = 0.35, P = 0.338). In the case of ERM reproliferation, the absence of ILM peeling, the existence of ERM on the fellow eye, and poor visual acuity before surgery seemed to be associated with a high risk of symptomatic recurrence and reoperation. The mean duration for follow-up was 3.5 ± 1.7 years. CONCLUSION: ILM peeling not only reduces the likelihood of reproliferation of ERM but also seems to improve the visual prognosis of recurrent ERMs. The use of dyes did not reduce the rate of recurrence compared with when ILM was peeled without dyes.
Assuntos
Membrana Epirretiniana/diagnóstico , Membrana Epirretiniana/prevenção & controle , Idoso , Corantes , Membrana Epirretiniana/etiologia , Feminino , Humanos , Incidência , Verde de Indocianina , Masculino , Pessoa de Meia-Idade , Recidiva , Reoperação , Estudos Retrospectivos , Fatores de Risco , Corantes de Rosanilina , Tomografia de Coerência Óptica , Acuidade Visual/fisiologia , VitrectomiaRESUMO
Cataract surgery improves vision by restoring eye transparency and also by correcting previous refractive defects. Surgery has only to be done when the patient's quality of life is significantly impaired by vision troubles. Among patients with cognitive and behaviour troubles (i.e Alzheimer disease), surgery may improve cognitive scores, and autonomy. Multifocal intraocular lenses are sometimes indicated for correcting presbyopia. However, impairment of contrast sensitivity is constant, among adverse effects causing sometimes dissatisfaction. Therefore "monovision", with monofocal intraocular lenses may be proposed, in order to manage the loss of accommodation constant after cataract surgey. Patient's satisfaction level is high when the dominant eye is dedicated to far vision, and the other eye to near vision. Combining femtosecond laser technology and cataract surgery may in the future improve reproductibility and surgical outcomes, but is not currently responsible for obvious therapeutic benefits.
Assuntos
Extração de Catarata/tendências , Catarata/terapia , Extração de Catarata/métodos , Extração de Catarata/estatística & dados numéricos , Humanos , Implante de Lente Intraocular/instrumentação , Implante de Lente Intraocular/métodos , Lentes Intraoculares , Modelos Biológicos , Desenho de Prótese , Melhoria de Qualidade , Visão Ocular/fisiologiaRESUMO
INTRODUCTION: Keratoconus has a significant impact on patients' quality of life (QoL), from diagnosis to the advanced stages of the disease. The aim of this research was to identify domains of QoL affected by this disease and its treatment. METHODS: Phone interviews were conducted using a semi-structured interview guide, with patients with keratoconus stratified according to their current treatment. A board of keratoconus experts helped identify the guide's main themes. RESULTS: Thirty-five patients (rigid contact lenses, n = 9; cross-linking, n = 9; corneal ring implants, n = 8; and corneal transplantation, n = 9) were interviewed by qualitative researchers. Phone interviews revealed several QoL domains affected by the disease and its treatments: "psychological", "social life", "professional life", "financial costs" and "student life". All domains were impacted, independently of the treatment history. Few differences were found between treatment regimens and keratoconus stages. Qualitative analysis enabled the development of a conceptual framework based on Wilson and Cleary's model for patient outcomes common to all patients. This conceptual model describes the relationship between patients' characteristics, their symptoms, their environment, their functional visual impairment and the impact on their QoL. CONCLUSIONS: These qualitative findings supported the generation of a questionnaire to evaluate the impact of keratoconus and its treatment on patients' QoL. Cognitive debriefings confirmed its content validity. The questionnaire is applicable for all stages of keratoconus and treatments and may help tracking change over time in regular clinical settings. Psychometric validation is yet to be performed before its use in research and clinical practices.
RESUMO
The aim of this study was to determine the penetration of doripenem administered intravenously into the rabbit aqueous and vitreous humors. Nineteen New Zealand White rabbits received a 20-mg dose of doripenem intravenously over 60 min. Specimens of aqueous humor, vitreous humor, and blood were obtained 30 min (n = 5), 1 h (n = 5), 2 h (n = 5), and 3 h (n = 4) after the beginning of the infusion and analyzed by high-performance liquid chromatography (HPLC). A pharmacokinetic (PK) model was developed to fit the experimental data. Doripenem concentrations in aqueous humor were lower than those in plasma ultrafiltrates at all sampling times, with an average aqueous humor-to-plasma ultrafiltrate area under the concentration-time curve ratio estimated as 8.3%. A pharmacokinetic model with peripheral elimination described the data adequately and was tentatively used to predict concentration-versus-time profiles and pharmacokinetic-pharmacodynamic (PK-PD) target attainment in patients under various dosing regimens. In conclusion, systematically administered doripenem does not seem to be a promising approach for the treatment of intraocular infections, especially since it could not be detected in the vitreous humor. However, this study has provided an opportunity to develop a new PK modeling approach to characterize the intraocular distribution of doripenem administered intravenously to rabbits, with tentative extrapolation to humans.
Assuntos
Carbapenêmicos/administração & dosagem , Carbapenêmicos/farmacocinética , Infusões Intravenosas/métodos , Animais , Humor Aquoso/metabolismo , Carbapenêmicos/sangue , Doripenem , Humanos , Coelhos , Corpo Vítreo/metabolismoRESUMO
OBJECTIVE: To compare deep anterior lamellar keratoplasty (DALK) with penetrating keratoplasty (PK) in eyes with corneal diseases not involving the corneal endothelium (keratoconus, scars after infectious keratitis, stromal dystrophies, and trauma). DESIGN: Retrospective, comparative case series. PARTICIPANTS: One hundred forty-two consecutive DALK (DALK group; big-bubble technique or manual lamellar dissection using a slitlamp) and 142 matched PK (PK group). METHODS: Three models were used to describe the postoperative outcomes of the endothelial cell density. A joint regression model was used to predict long-term graft survival. Visual acuity, ultrasound pachymetry, specular microscopy, and optical coherence tomography (OCT) findings were recorded. MAIN OUTCOME MEASURES: Postoperative endothelial cell loss and long-term predicted graft survival. RESULTS: The average 5-year postoperative endothelial cell loss was -22.3% in the DALK group and -50.1% in the PK group (P<0.0001). The early- and late-phase annual rates of endothelial cell loss were -8.3% and -3.9% per year, respectively, in the DALK group and -15.2% and -7.8% per year in the PK group (P<0.001; biphasic linear model). The median predicted graft survival was 49.0 years in the DALK group and 17.3 years in the PK group (P<0.0001). The average visual acuity was lower in the manual dissection subgroup compared with the PK group (average difference, 1.0 to 1.8 line) and with the big-bubble subgroup (average difference, 2.2 to 2.5 lines). The average central corneal thickness at 12 months was 536 µm in the PK group, 523 µm in the big-bubble subgroup, and 562 µm in the manual dissection subgroup (P<0.001). The average thickness of the residual recipient stroma measured by OCT was 87±26 µm in the manual dissection subgroup. No correlation was found between this figure and logarithm of the minimal angle of resolution at any postoperative time point (P>0.05). CONCLUSIONS: Long-term, model-predicted graft survival and endothelial densities are higher after DALK than after PK. The big-bubble technique gives better results than manual dissection and PK. Compared with PK, manual dissection provides higher survival of both the corneal endothelium and graft, but lower visual acuity.
Assuntos
Doenças da Córnea/cirurgia , Transplante de Córnea , Ceratoplastia Penetrante , Adulto , Idoso , Astigmatismo/fisiopatologia , Contagem de Células , Doenças da Córnea/fisiopatologia , Perda de Células Endoteliais da Córnea/fisiopatologia , Endotélio Corneano/patologia , Feminino , Seguimentos , Sobrevivência de Enxerto/fisiologia , Humanos , Masculino , Microscopia Acústica , Estudos Retrospectivos , Tomografia de Coerência Óptica , Resultado do Tratamento , Acuidade Visual/fisiologiaRESUMO
PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.
Assuntos
Doenças da Córnea/diagnóstico , DNA Fúngico/análise , Infecções Oculares Fúngicas/diagnóstico , Micoses/diagnóstico , Reação em Cadeia da Polimerase em Tempo Real , Doenças da Córnea/microbiologia , Primers do DNA/química , Infecções Oculares Fúngicas/microbiologia , Fungos/genética , Fungos/isolamento & purificação , Humanos , Micoses/microbiologia , Sensibilidade e EspecificidadeRESUMO
AIM: To describe the incidence, clinical features, and evolution of paracentral retinal holes occurring after macular surgery. METHODS: A retrospective non-randomized study of 909 patients operated on for either a macular hole (MH, n = 400 patients) or an epiretinal membrane (ERM, n = 509 patients) between 2004 and 2009. Six patients (0.6%) developed a paracentral macular hole after surgery. Their clinical, auto-fluorescence, and optical coherence tomography (OCT) characteristics as well as their visual outcomes were studied. RESULTS: The mean age of patients was 70 years. Paracentral holes occurred approximately 5 weeks after surgery (with a range of 2-12 weeks). All patients were asymptomatic. Five patients underwent ILM peeling during initial surgery. Paracentral retinal holes were located superiorly to the fovea in three cases and temporally in the other three cases. Mean pre-operative BCVA was 20/200 and mean post-operative BCVA was 20/40. The eye where the eccentric MHs were closest to the fovea (inferior to 1 optic disc area) had the poorest final visual acuity. Autofluorescence imaging showed a bright fluorescence in paramacular holes. On OCT images, they were shown to be flat full-thickness holes. No treatment was attempted. No rhegmatogenous complications or choroidal neovascularization occurred in any of the patients. Mean follow-up was 2 years. CONCLUSIONS: In summary, paracentral MHs are uncommon complications which can occur at the site where ILM peeling has been initiated or completed. Except for the closest holes to fovea, they have good visual prognosis and do not require any treatment underlining the importance of initiating the ILM peeling as far as possible from the fovea.
Assuntos
Membrana Epirretiniana/cirurgia , Complicações Pós-Operatórias , Perfurações Retinianas/diagnóstico , Perfurações Retinianas/cirurgia , Vitrectomia , Idoso , Idoso de 80 Anos ou mais , Membrana Basal/cirurgia , Benzenossulfonatos , Corantes , Angiofluoresceinografia , Humanos , Incidência , Verde de Indocianina , Pessoa de Meia-Idade , Estudos Retrospectivos , Tomografia de Coerência Óptica , Acuidade Visual/fisiologiaRESUMO
PURPOSE: The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV). RESULTS: When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001). CONCLUSIONS: For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.
Assuntos
Anticorpos Antiprotozoários/sangue , Anticorpos Antivirais/sangue , Infecções Oculares Virais/diagnóstico , Infecções por Herpesviridae/diagnóstico , Reação em Cadeia da Polimerase em Tempo Real , Toxoplasmose Ocular/diagnóstico , Uveíte Posterior/diagnóstico , Adulto , Idoso , Humor Aquoso/imunologia , Humor Aquoso/parasitologia , Humor Aquoso/virologia , DNA de Protozoário/análise , DNA Viral/análise , Ensaio de Imunoadsorção Enzimática , Infecções Oculares Virais/imunologia , Infecções Oculares Virais/virologia , Reações Falso-Positivas , Feminino , Herpesviridae/genética , Herpesviridae/imunologia , Herpesviridae/isolamento & purificação , Infecções por Herpesviridae/imunologia , Infecções por Herpesviridae/virologia , Humanos , Masculino , Pessoa de Meia-Idade , Valor Preditivo dos Testes , Estudos Retrospectivos , Sensibilidade e Especificidade , Toxoplasma/genética , Toxoplasma/imunologia , Toxoplasma/isolamento & purificação , Toxoplasmose Ocular/imunologia , Toxoplasmose Ocular/parasitologia , Uveíte Posterior/imunologia , Uveíte Posterior/parasitologia , Uveíte Posterior/virologia , Corpo Vítreo/imunologia , Corpo Vítreo/parasitologia , Corpo Vítreo/virologiaRESUMO
PURPOSE: To compare the safety and functional outcomes of 25-gauge and 23-gauge (G) micro-incision vitrectomy surgery (MIVS) instrumentation with the standard 20-G vitrectomy system in the treatment of epiretinal membranes (ERM). METHODS: A retrospective comparative study of 553 consecutive cases with epiretinal membrane who underwent pars plana vitrectomy. Twenty-gauge, 25-gauge and 23-gauge vitrectomy was performed respectively in 347, 91, and 115 eyes. Surgery duration, visual acuity improvement, intraocular pressure variation, intraoperative and postoperative complications were analyzed. RESULTS: The mean surgical time in the 23-G group and in the 25-G group was shorter than in the 20-G group (P < 0.001). Visual improvement was higher 8 days postoperatively in the 25-G group than in the 20-G and 23-G groups (P = 0.035), but not at 6 weeks postoperatively (P = 0.186). In the 20-G group, the IOP increased significantly on the first day postoperatively (P < 0.001), while in the 23-G group, the IOP decreased on the first day postoperatively (P = 0.073). In the 25-G group, the IOP did not change significantly (P = 0.807). The incidence of complications was not statistically significant between the three groups. Retinal breaks were significantly related to the induction of posterior vitreous detachment, independent of the system gauge. CONCLUSION: In ERM surgery, 23-G and 25-G (MIVS) systems are as safe and effective as the 20-G system, and significantly reduce surgical time. Although the 25-G system provides an earlier visual improvement, the 23- and 25- gauge systems are comparable, and the selection will depend on the surgeon's preference.
Assuntos
Membrana Epirretiniana/cirurgia , Microcirurgia/métodos , Vitrectomia/métodos , Idoso , Membrana Epirretiniana/fisiopatologia , Feminino , Humanos , Pressão Intraocular/fisiologia , Complicações Intraoperatórias , Masculino , Microcirurgia/instrumentação , Complicações Pós-Operatórias , Estudos Retrospectivos , Resultado do Tratamento , Acuidade Visual/fisiologia , Vitrectomia/instrumentaçãoRESUMO
PURPOSE: To assess epithelial corneal remodeling by anterior segment optical coherence tomography (AS-OCT) after intracorneal ring segments (ICRS) implantation in keratoconic eyes. METHODS: This prospective observational study included patients with keratoconus receiving ICRS of different arc lengths according to their tomographic pattern. AS-OCT and corneal topography (Scheimpflug camera) were performed before and 1, 3, and 6 months after surgery. Corneal pachymetry mapping was performed and total corneal and epithelial thicknesses (3-mm central and 16 points on 6-mm zone) were measured over the pupil center using AS-OCT. Topographic parameters were also assessed. RESULTS: A total of 68 keratoconic eyes were analyzed (Amsler-Krumeich stages 1 to 4) in four groups of 17 eyes: 210° ICRS, 320° ICRS, double 160° ICRS, and single 160° ICRS. Corneal pachymetry mapping revealed that epithelial thickness increased significantly in the internal zones juxtaposed to the ICRS without smoothing during the postoperative period (P < .05). Mean maximum epithelial thickness increased from 67 ± 6 to 79 ± 7 µm for 210° ICRS, 66 ± 9 to 82 ± 4 µm for 320° ICRS, 63 ± 6 to 78 ± 7 µm for double 160° ICRS, and 62 ± 5 to 77 ± 5 µm for single 160° ICRS (P < .0001). Significant epithelial thickening at the apex of the cone was observed in all groups (P < .05). CONCLUSIONS: Significant epithelial thickening occurs after ICRS implantation adjacent to the ICRS to compensate for the ridge created with a thickening of epithelium over the cone due to regularization of the stromal surface. [J Refract Surg. 2021;37(6):404-413.].