Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 12 de 12
Filtrar
1.
Phys Chem Chem Phys ; 23(2): 1392-1400, 2021 Jan 21.
Artigo em Inglês | MEDLINE | ID: mdl-33476353

RESUMO

Metal-stabilized radicals have been increasingly exploited in modern organic synthesis. Here, we theoretically designed a metalloradical complex Co-C˙Ph3 with the triplet characters through the transition metal cobalt (Co0) coordinating a triphenylmethyl radical. The potential catalytic role of this novel metalloradical in the CO2 reduction with H2/CH4 in the gas phase was explored via density functional theory (DFT) calculations. For the CO2 reduction reaction with H2, there are two possible pathways: one (path A) is the activation of CO2 by Co-C˙Ph3, followed by the hydrogenation of CO2. The other (path B) starts from the splitting of the H-H bond by Co-C˙Ph3, leading to the transition-metal hydride complex CoH-H, which can reduce CO2. DFT computations show that path B is more favorable than path A as their rate-determining free energy barriers are 18.3 and 27.2 kcal mol-1, respectively. However, for the reduction of CO2 by CH4 two different products, CH3COOH and HCOOCH3, can be generated following different reaction routes. Both routes begin with one CH4 molecule approaching the metalloradical Co-C˙Ph3 to form the intermediate CoH-CH3. This intermediate can evolve following two different pathways, depending on whether the H bonded to Co is transferred to the O (pathway PO) or the C (pathway PC) of CO2. Comparing their rate-determining steps, we identified that the PO route is more favorable for the reduction of CO2 by CH4 to CH3COOH with the reaction barrier 24.5 kcal mol-1. Thus, the present Co0-based metalloradical system represents a viable catalytic protocol that can contribute to the effective utilization of small molecules (H2 and CH4) to reduce CO2, and provides an alternative strategy for the exploration of CO2 conversion.

2.
Mol Genet Genomic Med ; 12(3): e2401, 2024 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-38444278

RESUMO

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.


Assuntos
Artrogripose , Túnica Conjuntiva , Contratura , Pterígio , Humanos , Masculino , Artrogripose/genética , Túnica Conjuntiva/anormalidades , Contratura/genética , Família
3.
Exp Ther Med ; 27(6): 270, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38756899

RESUMO

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

4.
Am J Transl Res ; 14(9): 6303-6312, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36247276

RESUMO

BACKGROUND: HMO (Hereditary Multiple Osteochondroma), an uncommon autosomal dominant disorder, is characterized by the development of multiple osteochondromas, which are nonmalignant cartilage-capped bone tumors growing outwards from long bone metaphyses. METHODS: The present work retrospectively analyzed seven children with HMO who were enrolled for routine clinical diagnosis and treatment, including X-ray examination. Subsequent genetic detection was carried out using whole exome sequencing (WES). In addition, this work applied Sanger sequencing to be the validation approach. Moreover, this work also examined amino acid (AA) evolutionary conservatism under the influence of certain missense variants. RESULTS: The clinical indications of all seven patients and their family members were thoroughly indexed. WES identified diagnostic variants in the EXT1 or EXT2 gene in these patients. In these variants, four were reported for the first time, namely EXT1: c.1285-2A>T, EXT2: c.1139delT, EXT1: c.203G>A, and EXT1: c.1645_1673del. Familial validation revealed that three of the variants were hereditary, while the other four were de novo, which was consistent with the phenotype in each case. CONCLUSION: Our results expanded HMO variation spectrum, and laid certain foundations for the precise counseling of those affected families.

5.
Clin Chim Acta ; 528: 6-12, 2022 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-35065050

RESUMO

BACKGROUND AND AIMS: Cleidocranial dysplasia (CCD) represents a rare autosomal dominant skeletal dysplasia caused by mutations that induce haploinsufficiency in RUNX2, the important transcription factor of osteoblasts related to bone/cartilage development and maintenance. Clavicular hypoplasia, which involves aberrant tooth/craniofacial bone/skeletal formation, is a feature of classic CCD. RUNX2 mutations can be found in approximately 60-70% of patients with CCD, and around ∼10% of these mutations are microdeletions. The present paper describes the radiological and clinical characteristics of a 5-year-old girl who showed representative CCD features, including extra teeth, aplasia of clavicles, sloping shoulders, marked calvarial hypomineralization, and osteoporosis. MATERIALS AND METHODS: We obtained genomic DNA of her family members and performed whole-genome sequencing (WGS) for samples collected from the proband. Quantitative fluorescent PCR (QF-PCR) and specific PCR plus electrophoresis were then performed as validation assays for all participants. In vitro analysis was performed. Luciferase assay for Runx2 transcription activity and evaluation of mRNA levels of Runx2 downstream osteogenic markers were conducted. RESULTS: WGS identified a 11.38-kb microdeletion in RUNX2 comprising 8-9 exons, which was validated by QF-PCR and specific PCR plus electrophoresis. In vitro experiments confirmed the pathogenicity of this variation. CONCLUSION: The present study identified a 11.38-kb microdeletion in RUNX2 that causes CCD. The deletion in the PST domain of RUNX2 reduces its transcription activity and reduces osteogenic marker levels, eventually decreasing the differentiation of osteoblasts. These findings clarify the role of the CCD-related mechanism in the development of CCD and suggest that it is important to consider copy number variation for the suspected familial patients early.


Assuntos
Displasia Cleidocraniana , Sequência de Bases , Pré-Escolar , Displasia Cleidocraniana/genética , Subunidade alfa 1 de Fator de Ligação ao Core/genética , Variações do Número de Cópias de DNA , Éxons , Feminino , Humanos
6.
J Phys Chem Lett ; 12(31): 7545-7552, 2021 Aug 12.
Artigo em Inglês | MEDLINE | ID: mdl-34347488

RESUMO

There has been growing interest in the CO2 capture and reduction by transition-metal-free catalysts. Here we performed a proof-of-concept study using an ab initio valence bond method called the block-localized wave function (BLW) method. The integrated BLW and density function theory (DFT) computations demonstrated that heterobimetallic Ae+/Al(I) (Ae represents alkaline earth metals Mg and Ca) Lewis acid/base combinations without transition metals can facilely capture and activate CO2. There are two remarkable findings in this study. The first concerns the ionic nature of the metal-metal bonds. The experimentally synthesized low valent aluminum compound with a bidentate ß-diketiminate (BDI) ligand, or (BDI)Al(I) in brief, is a Lewis base due to the lone pair on the aluminum cation though overall Al(I) is positively charged. Al(I) can form ionic metal-metal bonds with the alkaline earth metals of the positively charged Lewis acids (BDI)Ae+. This type of ionic metal-metal bonds is counterintuitive and antielectrostatic as both metals carry positive charges. The second finding is the CO2 activation mechanism. (BDI)Al(I) can effectively bind and activate CO2 by transferring one electron to CO2, and the resulting complex can be best expressed as [(BDI)Al(I)]+[CO2]-. The participation of (BDI)Ae+ further enhances the capture and activation of CO2 by (BDI)Al(I).

7.
Front Genet ; 12: 763467, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34938316

RESUMO

Background: Congenital insensitivity to pain with anhidrosis (CIPA), a rare autosomal recessive sensory neuropathy, was caused mainly by biallelic mutations in the NTRK1 gene. The pathogenesis of CIPA still needs further elucidation. Methods: Here, we recruited a CIPA case and introduced whole-exome sequencing (WES) to identify the causative variation. Subsequently, an in silico molecular dynamic (MD) analysis was performed to explore the intramolecular impact of the novel missense variant. Meanwhile, in vitro functional study on the novel variant from a metabolomic perspective was conducted via the liquid chromatography-mass spectrometry (LC-MS) approach, of which the result was verified by quantitative real-time PCR (qRT-PCR). Results: A novel compound heterozygous variation in NTRK1 gene was detected, consisting of the c.851-33T > A and c.2242C > T (p.Arg748Trp) variants. MD result suggested that p.Arg748Trp could affect the intramolecular structure stability. The results of the LC-MS and metabolic pathway clustering indicated that the NTRK1Arg748Trp variant would significantly affect the purine metabolism in vitro. Further analysis showed that it induced the elevation of NT5C2 mRNA level. Conclusion: The findings in this study extended the variation spectrum of NTRK1, provided evidence for counseling to the affected family, and offered potential clues and biomarkers to the pathogenesis of CIPA.

8.
Mol Genet Genomic Med ; 9(11): e1839, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34674383

RESUMO

BACKGROUND: Congenital insensitivity to pain (CIP) conditions are a group of Mendelian disorders with clinical and genetic heterogeneity. CIP with anhidrosis (CIPA) is a distinct subtype caused by biallelic variants in the NTRK1 gene. METHODS: In this study, six families with CIPA were recruited and submitted to a series of clinical and genetic examinations. Whole-exome sequencing and whole-genome sequencing were applied to perform a comprehensive genetic analysis. Sanger sequencing was used as a validation method. RESULTS: These patients exhibited phenotypic variability. All probands in the six families were positive for biallelic pathogenic variants in NTRK1. Five individual variants, namely NTRK1: (NM_002529.3) c.851-33T>A, c.717+2T>C, c.1806-2A>G, c.1251+1G>A, and c.851-794C>G, including three novel ones, were identified, which were carried by the six patients in a homozygous or compound heterozygous way. The validation results indicated that all the parents of the six probands, except for one father and one mother, were monoallelic carriers of a single variant. CONCLUSIONS: The findings in our study extended the variation spectrum of the NTRK1 gene and highlighted the advantage of the integrated application of multiplatform genetic technologies.


Assuntos
Neuropatias Hereditárias Sensoriais e Autônomas , Hipo-Hidrose , Insensibilidade Congênita à Dor , Receptor trkA , Neuropatias Hereditárias Sensoriais e Autônomas/genética , Humanos , Hipo-Hidrose/genética , Mutação , Insensibilidade Congênita à Dor/genética , Receptor trkA/genética
9.
Phytomedicine ; 85: 153522, 2021 May.
Artigo em Inglês | MEDLINE | ID: mdl-33799223

RESUMO

BACKGROUND: Thousands of years of clinical application of Wutou decoction (WTD) support its reliable efficacy and safety in treating rheumatoid arthritis (RA). However, the underlying molecular mechanism remains unclear, and the synergistic involvement of assistant herbs in WTD in enhancing the sovereign herb in treating RA is unknown. PURPOSE: This study aimed to investigate the efficacy-oriented compatibility of five herbs in WTD and the underlying mechanisms. METHODS: The anti-arthritic effects of WTD and the compatibilities of the five herbs in WTD were studied in vivo with adjuvant-induced arthritis (AIA) rat model and in vitro with LPS-induced RAW264.7 macrophage. Network pharmacology analysis was conducted to identify the dominant pathways involved in the anti-arthritis mechanisms of WTD and how the five herbs work synergistically. The results were further verified by in vivo and in vitro experiments. RESULTS: Our data revealed that the five herbs in WTD exert synergistic anti-arthritic effects on RA. Moreover, Radix Aconite (AC) is the principal anti-inflammatory component in WTD according to the extent of therapeutic effects exerted on the AIA rats. In vivo and in vitro experiments demonstrated that WTD inhibited NF-κB phosphorylation and simultaneously increased the expression of Nrf2, which were the major pathways identified by the network pharmacology analysis. The major assistant component, Herba Ephedrae (EP), evidently inhibited NF-κB mediated inflammatory response. The other assistant component, Radix Astragali (AS), considerably enhanced the expression of Nrf2 when used alone or in combination with AC. These combinations improved the anti-arthritis effects on the AIA rats better than that of AC alone. Nevertheless, WTD always achieved the best effects than any combinations both in vivo and in vitro. CONCLUSION: The ministerial herbs EP and AS intensify the anti-arthritic effects of AC by regulating the NF-κB-mediated inflammatory pathway and the Nrf2-mediated anti-oxidation pathway which are the major pathways of WTD for alleviating the symptoms of RA.


Assuntos
Anti-Inflamatórios/uso terapêutico , Artrite Experimental/tratamento farmacológico , Artrite Reumatoide/tratamento farmacológico , Medicamentos de Ervas Chinesas/uso terapêutico , Aconitum/química , Animais , Astragalus propinquus , Feminino , Humanos , Masculino , Medicina Tradicional Chinesa , Camundongos , Fator 2 Relacionado a NF-E2/metabolismo , NF-kappa B/metabolismo , Fosforilação , Células RAW 264.7 , Ratos , Ratos Sprague-Dawley , Células THP-1
10.
Orthop Surg ; 11(1): 102-108, 2019 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30714691

RESUMO

OBJECTIVE: The treatment of missed Monteggia fracture remains a challenge, despite the various surgical methods described. The purpose of this study was to explore a new surgical technique utilizing external fixator-assisted ulnar osteotomy and to assess the surgical results in a case series. METHODS: Thirteen patients with missed Monteggia fractures were treated at our institution using this new surgical technique from August 2012 to January 2016. Our series included 11 boys and 2 girls. The left elbow was involved in 6 patients and the right elbow was involved in 7 patients. According to the Bado classification, 10 fractures were classified as Bado type I with anterior radial head dislocation and 3 were classified as Bado type III with anterolateral dislocation. The average age at the time of surgery was 5 years 8 months (range, 2 years 2 months-10 years). The mean trauma-to-surgery interval was 12 months (range, 2-36 months). All patients underwent ulnar osteotomy with angulation and lengthening using a temporary external fixator, plate fixation of the osteotomy, and open reduction of the radial head dislocation without annular ligament reconstruction. RESULTS: The average follow-up was 27 months (range, 16-44 months). The average operation time was 175 min (range, 140-215 min). The average length of distraction was 0.7 cm (range, 0.5-1.2 cm) and the average angulation was 28° (range, 20°-30°) at the ulnar osteotomy site intraoperatively. The elbow performance score (Kim's) was excellent in 10 cases and good in 3 cases. No neurovascular complications, compartment syndrome or implant breakage occurred. No pain in the distal radioulnar joint or limited range of motion of the wrist occurred in any patient. The radial head remained reduced in all patients with no subluxation or redislocation. However, delayed ulnar union occurred in 3 cases, all of which were successfully treated with plaster cast immobilization within approximately 6 months postoperatively. One patient presented with cubitus valgus postoperatively with a carrying angle of 30°, which was 10° greater than the contralateral carrying angle. CONCLUSIONS: External fixator-assisted ulnar osteotomy offers substantial flexibility for achieving the optimal positioning of the transected ulna to reduce the radial head prior to the final ulnar osteotomy fixation with a plate, thereby facilitating an effective operative performance. Our procedure is a safe and effective method to treat missed pediatric Monteggia fractures.


Assuntos
Articulação do Cotovelo/cirurgia , Fixadores Externos , Fratura de Monteggia/cirurgia , Osteotomia/métodos , Ulna/cirurgia , Placas Ósseas , Criança , Pré-Escolar , Diagnóstico Tardio , Articulação do Cotovelo/diagnóstico por imagem , Feminino , Seguimentos , Fratura-Luxação/diagnóstico por imagem , Fratura-Luxação/cirurgia , Fixação Interna de Fraturas/métodos , Humanos , Fraturas Intra-Articulares/diagnóstico por imagem , Fraturas Intra-Articulares/cirurgia , Masculino , Fratura de Monteggia/diagnóstico por imagem , Radiografia , Ulna/diagnóstico por imagem , Lesões no Cotovelo
11.
Clin Pediatr (Phila) ; 57(5): 580-583, 2018 05.
Artigo em Inglês | MEDLINE | ID: mdl-28990434

RESUMO

The aims of this study were to investigate the effect of neuromuscular electrical stimulation (NMES) combined with strengthening exercise on movement in children with spastic cerebral palsy (CP). One hundred children with spastic CP were randomly divided into a treatment group (NMES and strengthening exercise, n = 50) and a control group (only NMES, n = 50). We compared the Comprehensive Spasticity Scale (CSS) score, Gross Motor Function Measure (GMFM) score, and walking speed before treatment and 6 weeks and 3 months after treatment between the 2 groups. There was no difference in CSS score between the treatment and control groups before the therapy (12.0 ± 3.4 vs 12.3 ± 3.6), which decreased much more in the treatment group after 6 weeks (7.6 ± 3.0 vs 9.5 ± 2.8) and 3 months (7.4 ± 2.4 vs 9.4 ± 2.6) with significant differences ( P < .05). No difference in GMFM score was observed between the treatment and control groups before the therapy (44.5 ± 13.2 vs 44.0 ± 12.6), which increased much more in the treatment group after 6 weeks (70.6 ± 15.2 vs 56.7 ± 14.3) and 3 months (71.0 ± 16.4 vs 58.0 ± 15.6) with significant differences ( P < .05). The walking speed improved over time, which was the same before the treatment (0.43 ± 0.13 m/s vs 0.45 ± 0.14 m/s), and was significantly greater in the treatment group than that in the control group (6 weeks: 0.69 ± 0.15 m/s vs 0.56 ± 0.12 m/s, P < .05; 3 months: 0.72 ± 0.17 m/s vs 0.57 ± 0.18 m/s, P < .05). NMES combined with strengthening exercise was more effective than NMES alone in the recovery of spastic CP.


Assuntos
Paralisia Cerebral/terapia , Terapia por Estimulação Elétrica/métodos , Terapia por Exercício/métodos , Força Muscular/fisiologia , Criança , Terapia Combinada , Feminino , Humanos , Masculino , Espasticidade Muscular/terapia , Resultado do Tratamento
12.
Asian Pac J Trop Med ; 7(6): 492-5, 2014 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-25066401

RESUMO

OBJECTIVE: To To investigate the effect of acupuncture on the tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), C-reactive protein (CRP), nitric oxide synthase (NOS) content and muscular tension of spasticity cerebral palsy rat model. METHODS: The rats with spastic cerebral palsy were randomly divided into the control group, model group and acupuncture group. After successful modeling, the muscular tension and the content of TNF-α, IL-6, CRP, NOS were measured. RESULTS: The serum TNF-α, IL-6, CRP, NOS content were significantly decreased in the acupuncture group (P<0.05). The low and high shear viscosity of whole blood of the acupuncture group were significantly lower than the control group and the model group (P<0.05). The erythrocyte electrophoresis indexes in the acupuncture group were significantly lower than that in the model group and the control group (P<0.05). Acupuncture significantly reduced the muscular tension of spastic cerebral palsy rat and increased the active extent in the paralytic extremity (P<0.05), but it could not be restored to normal level. Compared with the control group, the difference had significant (P<0.05). CONCLUSIONS: Acupuncture treatment can inhibit the release of inflammatory cells after brain injury, then reduce immune injury, relieve muscle spasms and reduce muscular tension.


Assuntos
Terapia por Acupuntura , Paralisia Cerebral/sangue , Paralisia Cerebral/terapia , Citocinas/sangue , Animais , Modelos Animais de Doenças , Hemorreologia/fisiologia , Masculino , Tono Muscular/fisiologia , Ratos , Ratos Wistar
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA