Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 115
Filtrar
Mais filtros

Base de dados
Tipo de documento
Intervalo de ano de publicação
1.
Cell ; 179(4): 864-879.e19, 2019 10 31.
Artigo em Inglês | MEDLINE | ID: mdl-31675497

RESUMO

Physical or mental stress leads to neuroplasticity in the brain and increases the risk of depression and anxiety. Stress exposure causes the dysfunction of peripheral T lymphocytes. However, the pathological role and underlying regulatory mechanism of peripheral T lymphocytes in mood disorders have not been well established. Here, we show that the lack of CD4+ T cells protects mice from stress-induced anxiety-like behavior. Physical stress-induced leukotriene B4 triggers severe mitochondrial fission in CD4+ T cells, which further leads to a variety of behavioral abnormalities including anxiety, depression, and social disorders. Metabolomic profiles and single-cell transcriptome reveal that CD4+ T cell-derived xanthine acts on oligodendrocytes in the left amygdala via adenosine receptor A1. Mitochondrial fission promotes the de novo synthesis of purine via interferon regulatory factor 1 accumulation in CD4+ T cells. Our study implicates a critical link between a purine metabolic disorder in CD4+ T cells and stress-driven anxiety-like behavior.


Assuntos
Ansiedade/metabolismo , Comportamento Animal/fisiologia , Encefalopatias Metabólicas/metabolismo , Estresse Psicológico/metabolismo , Tonsila do Cerebelo/metabolismo , Tonsila do Cerebelo/patologia , Animais , Ansiedade/genética , Ansiedade/imunologia , Ansiedade/fisiopatologia , Encefalopatias Metabólicas/genética , Encefalopatias Metabólicas/fisiopatologia , Linfócitos T CD4-Positivos/metabolismo , Linfócitos T CD4-Positivos/patologia , Modelos Animais de Doenças , Humanos , Camundongos , Dinâmica Mitocondrial/genética , Oligodendroglia/metabolismo , Oligodendroglia/patologia , Análise de Célula Única , Estresse Psicológico/genética , Estresse Psicológico/fisiopatologia , Transcriptoma/genética , Xantina/metabolismo
2.
Immunity ; 54(8): 1728-1744.e7, 2021 08 10.
Artigo em Inglês | MEDLINE | ID: mdl-34343498

RESUMO

Inflammatory bowel disease (IBD) mainly includes Crohn's disease (CD) and ulcerative colitis (UC). Immune disorders play an essential role in the pathogenesis of these two IBDs, but the differences in the immune microenvironment of the colon and their underlying mechanisms remain poorly investigated. Here we examined the immunological features and metabolic microenvironment of untreated individuals with IBD by multiomics analyses. Modulation of CD-specific metabolites, particularly reduced selenium, can obviously shape type 1 T helper (Th1) cell differentiation, which is specifically enriched in CD. Selenium supplementation suppressed the symptoms and onset of CD and Th1 cell differentiation via selenoprotein W (SELW)-mediated cellular reactive oxygen species scavenging. SELW promoted purine salvage pathways and inhibited one-carbon metabolism by recruiting an E3 ubiquitin ligase, tripartite motif-containing protein 21, which controlled the stability of serine hydroxymethyltransferase 2. Our work highlights selenium as an essential regulator of T cell responses and potential therapeutic targets in CD.


Assuntos
Antioxidantes/farmacologia , Doença de Crohn/tratamento farmacológico , Doença de Crohn/imunologia , Selênio/farmacologia , Selenoproteína W/metabolismo , Células Th1/citologia , Diferenciação Celular/imunologia , Polaridade Celular , Colo/imunologia , Colo/patologia , Glicina Hidroximetiltransferase/metabolismo , Humanos , Espécies Reativas de Oxigênio/metabolismo , Ribonucleoproteínas/metabolismo , Células Th1/imunologia , Ubiquitina-Proteína Ligases/metabolismo
3.
Hum Mol Genet ; 32(7): 1137-1151, 2023 03 20.
Artigo em Inglês | MEDLINE | ID: mdl-36331344

RESUMO

Mitochondrial dynamics is essential for maintaining the physiological function of the mitochondrial network, and its disorders lead to a variety of diseases. Our previous study identified mitochondrial dynamics controlled anti-tumor immune responses and anxiety symptoms. However, how mitochondrial dynamics affects auditory function in the inner ear remains unclear. Here, we show that the deficiency of FAM73a or FAM73b, two mitochondrial outer membrane proteins that mediate mitochondrial fusion, leads to outer hair cells (HCs) damage and progressive hearing loss in FVB/N mice. Abnormal mitochondrial fusion causes elevated oxidative stress and apoptosis of HCs in the early stage. Thereafter, the activation of macrophages and CD4+ T cell is found in the mutant mice with the increased expression of the inflammatory cytokines IL-12 and IFN-γ compared with control mice. Strikingly, a dramatically decreased number of macrophages by Clophosome®-A-Clodronate Liposomes treatment alleviates the hearing loss of mutant mice. Collectively, our finding highlights that FAM73a or FAM73b deficiency affects HCs survival by disturbing the mitochondrial function, and the subsequent immune response in the cochleae worsens the damage of HCs.


Assuntos
Perda Auditiva , Dinâmica Mitocondrial , Animais , Camundongos , Dinâmica Mitocondrial/genética , Audição , Perda Auditiva/genética , Perda Auditiva/metabolismo , Células Ciliadas Auditivas Externas/metabolismo , Imunidade
4.
J Virol ; : e0099724, 2024 Aug 30.
Artigo em Inglês | MEDLINE | ID: mdl-39212930

RESUMO

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

5.
EMBO Rep ; 24(1): e55387, 2023 01 09.
Artigo em Inglês | MEDLINE | ID: mdl-36394357

RESUMO

Interferon regulatory factor (IRF) 3 and IRF7 are master regulators of type I interferon (IFN-I)-dependent antiviral innate immunity. Upon viral infection, a positive feedback loop is formed, wherein IRF7 promotes further induction of IFN-I in the later stage. Thus, it is critical to maintain a suitably low level of IRF7 to avoid the hyperproduction of IFN-I. In this study, we find that early expression of IFN-I-dependent STAT1 promotes the expression of XAF1 and that XAF1 is associated specifically with IRF7 and inhibits the activity of XIAP. XAF1-knockout and XIAP-transgenic mice display resistance to viral infection, and this resistance is accompanied by increases in IFN-I production and IRF7 stability. Mechanistically, we find that the XAF1-XIAP axis controls the activity of KLHL22, an adaptor of the BTB-CUL3-RBX1 E3 ligase complex through a ubiquitin-dependent pathway. CUL3-KLHL22 directly targets IRF7 and catalyzes its K48-linked ubiquitination and proteasomal degradation. These findings reveal unexpected functions of the XAF1-XIAP axis and KLHL22 in the regulation of IRF7 stability and highlight an important target for antiviral innate immunity.


Assuntos
Interferon Tipo I , Viroses , Camundongos , Animais , Viroses/genética , Antivirais , Imunidade Inata , Ubiquitinação , Fator Regulador 7 de Interferon/genética , Proteínas Adaptadoras de Transdução de Sinal/genética , Proteínas Reguladoras de Apoptose
6.
Proc Natl Acad Sci U S A ; 119(18): e2115013119, 2022 05 03.
Artigo em Inglês | MEDLINE | ID: mdl-35467987

RESUMO

Host-associated microbiomes, particularly gut microbiomes, often harbor related but distinct microbial lineages, but how this diversity arises and is maintained is not well understood. A prerequisite for lineage diversification is reproductive isolation imposed by barriers to gene flow. In host-associated microbes, genetic recombination can be disrupted by confinement to different hosts, for example following host speciation, or by niche partitioning within the same host. Taking advantage of the simple gut microbiome of social bees, we explore the diversification of two groups of gut-associated bacteria, Gilliamella and Snodgrassella, which have evolved for 80 million y with honey bees and bumble bees. Our analyses of sequenced genomes show that these lineages have diversified into discrete populations with limited gene flow. Divergence has occurred between symbionts of different host species and, in some cases, between symbiont lineages within a single host individual. Populations have acquired genes to adapt to specific hosts and ecological niches; for example, Gilliamella lineages differ markedly in abilities to degrade dietary polysaccharides and to use the resulting sugar components. Using engineered fluorescent bacteria in vivo, we show that Gilliamella lineages localize to different hindgut regions, corresponding to differences in their abilities to use spatially concentrated nitrogenous wastes of hosts. Our findings show that bee gut bacteria can diversify due to isolation in different host species and also due to spatial niche partitioning within individual hosts, leading to barriers to gene flow.


Assuntos
Microbioma Gastrointestinal , Microbiota , Adaptação Fisiológica , Animais , Bactérias/genética , Abelhas , Especificidade de Hospedeiro
7.
PLoS Genet ; 18(5): e1010195, 2022 05.
Artigo em Inglês | MEDLINE | ID: mdl-35522718

RESUMO

Pea aphids (Acyrthosiphon pisum) are insects containing genes of bacterial origin with putative functions in peptidoglycan (PGN) metabolism. Of these, rlpA1-5, amiD, and ldcA are highly expressed in bacteriocytes, specialized aphid cells that harbor the obligate bacterial symbiont Buchnera aphidicola, required for amino acid supplementation of the host's nutrient-poor diet. Despite genome reduction associated with endosymbiosis, pea aphid Buchnera retains genes for the synthesis of PGN while Buchnera of many other aphid species partially or completely lack these genes. To explore the evolution of aphid horizontally-transferred genes (HTGs) and to elucidate how host and symbiont genes contribute to PGN production, we sequenced genomes from four deeply branching lineages, such that paired aphid and Buchnera genomes are now available for 17 species representing eight subfamilies. We identified all host and symbiont genes putatively involved in PGN metabolism. Phylogenetic analyses indicate that each HTG family was present in the aphid shared ancestor, but that each underwent a unique pattern of gene loss or duplication in descendant lineages. While four aphid rlpA gene subfamilies show no relation to symbiont PGN gene repertoire, the loss of aphid amiD and ldcA HTGs coincides with the loss of symbiont PGN metabolism genes. In particular, the coincident loss of host amiD and symbiont murCEF in tribe Aphidini, in contrast to tribe Macrosiphini, suggests either 1) functional linkage between these host and symbiont genes, or 2) Aphidini has lost functional PGN synthesis and other retained PGN pathway genes are non-functional. To test these hypotheses experimentally, we used cell-wall labeling methods involving a d-alanine probe and found that both Macrosiphini and Aphidini retain Buchnera PGN synthesis. Our results imply that compensatory adaptations can preserve PGN synthesis despite the loss of some genes considered essential for this pathway, highlighting the importance of the cell wall in these symbioses.


Assuntos
Afídeos , Buchnera , Animais , Afídeos/genética , Afídeos/microbiologia , Buchnera/genética , Buchnera/metabolismo , Genes Bacterianos , Genômica , Peptidoglicano/genética , Peptidoglicano/metabolismo , Filogenia , Simbiose/genética
8.
J Physiol ; 602(3): 507-525, 2024 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-38252405

RESUMO

Evoking muscle responses by electrical vestibular stimulation (EVS) may help to understand the contribution of the vestibular system to postural control. Although paraspinal muscles play a role in postural stability, the vestibulo-muscular coupling of these muscles during walking has rarely been studied. This study aimed to investigate how vestibular signals affect paraspinal muscle activity at different vertebral levels during walking with preferred and narrow step width. Sixteen healthy participants were recruited. Participants walked on a treadmill for 8 min at 78 steps/min and 2.8 km/h, at two different step width, either with or without EVS. Bipolar electromyography was recorded bilaterally from the paraspinal muscles at eight vertebral levels from cervical to lumbar. Coherence, gain, and delay of EVS and EMG responses were determined. Significant EVS-EMG coupling (P < 0.01) was found at ipsilateral and/or contralateral heel strikes. This coupling was mirrored between left and right relative to the midline of the trunk and between the higher and lower vertebral levels, i.e. a peak occurred at ipsilateral heel strike at lower levels, whereas it occurred at contralateral heel strike at higher levels. EVS-EMG coupling only partially coincided with peak muscle activity. EVS-EMG coherence slightly, but not significantly, increased when walking with narrow steps. No significant differences were found in gain and phase between the vertebral levels or step width conditions. In summary, vertebral level specific modulation of paraspinal muscle activity based on vestibular signals might allow a fast, synchronized, and spatially co-ordinated response along the trunk during walking. KEY POINTS: Mediolateral stabilization of gait requires an estimate of the state of the body, which is affected by vestibular afference. During gait, the heavy trunk segment is controlled by phasic paraspinal muscle activity and in rodents the medial and lateral vestibulospinal tracts activate these muscles. To gain insight in vestibulospinal connections in humans and their role in gait, we recorded paraspinal surface EMG of cervical to lumbar paraspinal muscles, and characterized coherence, gain and delay between EMG and electrical vestibular stimulation, during slow walking. Vestibular stimulation caused phasic, vertebral level specific modulation of paraspinal muscle activity at delays of around 40 ms, which was mirrored between left, lower and right, upper vertebral levels. Our results indicate that vestibular afference causes fast, synchronized, and spatially co-ordinated responses of the paraspinal muscles along the trunk, that simultaneously contribute to stabilizing the centre of mass trajectory and to keeping the head upright.


Assuntos
Músculo Esquelético , Músculos Paraespinais , Humanos , Músculo Esquelético/fisiologia , Caminhada/fisiologia , Eletromiografia , Marcha/fisiologia , Coluna Vertebral/fisiologia
9.
Mol Biol Evol ; 40(12)2023 Dec 01.
Artigo em Inglês | MEDLINE | ID: mdl-38069672

RESUMO

Genomes of aphids (family Aphididae) show several unusual evolutionary patterns. In particular, within the XO sex determination system of aphids, the X chromosome exhibits a lower rate of interchromosomal rearrangements, fewer highly expressed genes, and faster evolution at nonsynonymous sites compared with the autosomes. In contrast, other hemipteran lineages have similar rates of interchromosomal rearrangement for autosomes and X chromosomes. One possible explanation for these differences is the aphid's life cycle of cyclical parthenogenesis, where multiple asexual generations alternate with 1 sexual generation. If true, we should see similar features in the genomes of Phylloxeridae, an outgroup of aphids which also undergoes cyclical parthenogenesis. To investigate this, we generated a chromosome-level assembly for the grape phylloxera, an agriculturally important species of Phylloxeridae, and identified its single X chromosome. We then performed synteny analysis using the phylloxerid genome and 30 high-quality genomes of aphids and other hemipteran species. Unexpectedly, we found that the phylloxera does not share aphids' patterns of chromosome evolution. By estimating interchromosomal rearrangement rates on an absolute time scale, we found that rates are elevated for aphid autosomes compared with their X chromosomes, but this pattern does not extend to the phylloxera branch. Potentially, the conservation of X chromosome gene content is due to selection on XO males that appear in the sexual generation. We also examined gene duplication patterns across Hemiptera and uncovered horizontal gene transfer events contributing to phylloxera evolution.


Assuntos
Afídeos , Animais , Masculino , Afídeos/genética , Cromossomo X/genética , Partenogênese/genética , Reprodução , Evolução Molecular
10.
Proc Biol Sci ; 291(2026): 20240514, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-38955232

RESUMO

Caddisflies (Trichoptera) are among the most diverse groups of freshwater animals with more than 16 000 described species. They play a fundamental role in freshwater ecology and environmental engineering in streams, rivers and lakes. Because of this, they are frequently used as indicator organisms in biomonitoring programmes. Despite their importance, key questions concerning the evolutionary history of caddisflies, such as the timing and origin of larval case making, remain unanswered owing to the lack of a well-resolved phylogeny. Here, we estimated a phylogenetic tree using a combination of transcriptomes and targeted enrichment data for 207 species, representing 48 of 52 extant families and 174 genera. We calibrated and dated the tree with 33 carefully selected fossils. The first caddisflies originated approximately 295 million years ago in the Permian, and major suborders began to diversify in the Triassic. Furthermore, we show that portable case making evolved in three separate lineages, and shifts in diversification occurred in concert with key evolutionary innovations beyond case making.


Assuntos
Insetos , Filogenia , Insetos/classificação , Insetos/genética , Insetos/fisiologia , Água Doce , Transcriptoma , Biodiversidade , Fósseis , Evolução Biológica , Animais
11.
Microb Pathog ; 187: 106487, 2024 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-38158143

RESUMO

Escherichia coli LF82 (LF82) is associated with Crohn's disease. The simplicity and genetic maneuverability of honeybees' gut microbiota make them suitable for studying host-microbe interactions. To understand the interaction between LF82 and host gut, LF82 was used to infect germ-free honeybees (Apis mellifera) orally. We found that LF82 successfully colonized the gut and shortened the lifespan of germ-free bees. LF82 altered the gut structure and significantly increased gut permeability. RT-qPCR showed that LF82 infection activated anti-infective immune pathways and upregulated the mRNAs levels of antimicrobial peptides in the gut of germ-free bees. The gut transcriptome showed that LF82 significantly upregulated genes involved in Notch signaling, adhesion junctions, and Toll and Imd signaling pathways and downregulated genes involved in the peroxisome proliferator-activated receptor (PPAR) signaling pathway, protein digestion and absorption, and tyrosine metabolism. In conclusion, the human-derived enteropathogenic bacterium LF82 can successfully colonize the gut of germ-free honeybees and cause enteritis-like changes, which provides an ideal model organism for revealing the pathogenesis of bacterial-associated diseases.


Assuntos
Doença de Crohn , Infecções por Escherichia coli , Abelhas , Humanos , Animais , Escherichia coli/genética , Mucosa Intestinal/microbiologia , Aderência Bacteriana , Infecções por Escherichia coli/microbiologia
12.
Arch Virol ; 169(5): 90, 2024 Apr 05.
Artigo em Inglês | MEDLINE | ID: mdl-38578314

RESUMO

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.


Assuntos
Vírus de RNA , Viburnum , Viburnum/genética , RNA Viral/genética , Filogenia , Genoma Viral , Vírus de RNA/genética , Fases de Leitura Aberta
13.
Arch Virol ; 169(1): 19, 2024 Jan 05.
Artigo em Inglês | MEDLINE | ID: mdl-38180588

RESUMO

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.


Assuntos
Flexiviridae , Mentha , Filogenia , Genômica , Sequenciamento de Nucleotídeos em Larga Escala , RNA Mensageiro , RNA Interferente Pequeno/genética
14.
Plant Dis ; 2024 Sep 05.
Artigo em Inglês | MEDLINE | ID: mdl-39235411

RESUMO

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

15.
Plant Dis ; 2024 Aug 08.
Artigo em Inglês | MEDLINE | ID: mdl-39115952

RESUMO

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

16.
Mol Biol Evol ; 39(9)2022 09 01.
Artigo em Inglês | MEDLINE | ID: mdl-36026509

RESUMO

Evolutionary innovations generate phenotypic and species diversity. Elucidating the genomic processes underlying such innovations is central to understanding biodiversity. In this study, we addressed the genomic basis of evolutionary novelties in the glassy-winged sharpshooter (Homalodisca vitripennis, GWSS), an agricultural pest. Prominent evolutionary innovations in leafhoppers include brochosomes, proteinaceous structures that are excreted and used to coat the body, and obligate symbiotic associations with two bacterial types that reside within cytoplasm of distinctive cell types. Using PacBio long-read sequencing and Dovetail Omni-C technology, we generated a chromosome-level genome assembly for the GWSS and then validated the assembly using flow cytometry and karyotyping. Additional transcriptomic and proteomic data were used to identify novel genes that underlie brochosome production. We found that brochosome-associated genes include novel gene families that have diversified through tandem duplications. We also identified the locations of genes involved in interactions with bacterial symbionts. Ancestors of the GWSS acquired bacterial genes through horizontal gene transfer (HGT), and these genes appear to contribute to symbiont support. Using a phylogenomics approach, we inferred HGT sources and timing. We found that some HGT events date to the common ancestor of the hemipteran suborder Auchenorrhyncha, representing some of the oldest known examples of HGT in animals. Overall, we show that evolutionary novelties in leafhoppers are generated by the combination of acquiring novel genes, produced both de novo and through tandem duplication, acquiring new symbiotic associations that enable use of novel diets and niches, and recruiting foreign genes to support symbionts and enhance herbivory.


Assuntos
Hemípteros , Animais , Evolução Biológica , Genômica , Hemípteros/genética , Proteômica , Simbiose/genética
17.
BMC Pediatr ; 23(1): 597, 2023 11 24.
Artigo em Inglês | MEDLINE | ID: mdl-37996786

RESUMO

BACKGROUND: Symptoms of inflammatory myofibroblastic tumor (IMT) are atypical, and histopathological misdiagnosis of IMT is still inevitable. Here we present a pediatric case that an eight-year-old boy with recurrent fever for fifteen months, received anti-tuberculosis therapy for five months and was ultimately confirmed to be IMT. CASE PRESENTATION: An eight-year-old boy experienced a recurrent fever for fifteen months, accompanied by cough, vomiting, meteorism, night sweating, and emaciation. Thoracoabdominal computer tomography revealed multiple enlarged lymph nodes in the thorax, abdomen, and axilla, as well as minimal bilateral pleural effusion. Histopathological examinations of the intestines and greater omentum implied fibrous tissue hyperplasia along with eosinophil and lymphocyte infiltration. The patient was initially misdiagnosed with tuberculosis, and symptoms were relieved partially following anti-tuberculosis treatment. However, after four months, the symptoms aggravated again and a subsequent histopathological analysis of a second sample from the greater omentum revealed the presence of IMT. Eventually, after surgical resection of the lesions and chemotherapy, the clinical symptoms in the child gradually alleviated. CONCLUSIONS: The clinical course of IMT is variable, and pediatricians should pay attention to differentiating IMT from tuberculosis.


Assuntos
Neoplasias , Tuberculose , Masculino , Humanos , Criança , Tuberculose/diagnóstico , Tuberculose/tratamento farmacológico , Erros de Diagnóstico , Tomografia Computadorizada por Raios X
18.
Phytother Res ; 37(1): 310-328, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36086867

RESUMO

Prostate cancer (PCa) is the most common malignant tumor in males, which frequently develops into castration-resistant prostate cancer (CRPC) with limited therapies. Gambogenic acid (GNA), a flavonoids compound isolated from Gamboge, exhibits anti-tumor capacity in various cancers. Our results showed that GNA revealed not only antiproliferative and pro-apoptotic activities but also the induction of autophagy in PCa cells. In addition, autophagy inhibitor chloroquine enhanced the pro-apoptosis effect of GNA. Moreover, the activation of JNK pathway and the induction of apoptosis and autophagy triggered by GNA were attenuated by JNK inhibitor SP600125. We also found that GNA significantly promoted reactive oxygen species (ROS) generation and endoplasmic reticulum (ER) stress. Meanwhile, suppressing ER stress with 4-phenylbutyric acid (4-PBA) markedly blocked the activation of JNK pathway induced by GNA. Further research indicated that ROS scavenger N-acetyl-L-cysteine (NAC) effectively abrogated ER stress and JNK pathway activation induced by GNA. Furthermore, NAC and 4-PBA significantly reversed GNA-triggered apoptosis and autophagy. Finally, GNA remarkably suppressed prostate tumor growth with low toxicity in vivo. In conclusion, the present study revealed that GNA induced apoptosis and autophagy through ROS-mediated ER stress via JNK signaling pathway in PCa cells. Thus, GNA might be a promising therapeutic drug against PCa.


Assuntos
Sistema de Sinalização das MAP Quinases , Neoplasias da Próstata , Masculino , Humanos , Espécies Reativas de Oxigênio/metabolismo , Apoptose , Estresse do Retículo Endoplasmático , Autofagia , Linhagem Celular Tumoral , Acetilcisteína/metabolismo , Acetilcisteína/farmacologia , Neoplasias da Próstata/tratamento farmacológico
19.
Eur J Cancer Care (Engl) ; 31(6): e13740, 2022 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-36239065

RESUMO

OBJECTIVE: We evaluate cost-effectiveness of primary treatments for localised prostate cancer by uniquely combining prospectively collected real-world outcomes and costs from UCSF Cancer of Prostate Strategic Urologic Research Endeavor (CaPSURE™). METHODS: Markov models assessed cost-effectiveness of radical prostatectomy (RP), brachytherapy, electron beam radiation therapy (EBRT) and brachytherapy with EBRT by risk from US payers perspective over 8 years. Treatment costs included office visits, hospitalisation, procedures, medication and long-term care. Patients' surveyed HRQoL were mapped into utilities. Incremental cost-effectiveness ratios (ICERs) used cost per quality-adjusted life years (QALYs) and willingness-to-pay of $150,000/QALY. RESULTS: Cost-effectiveness analysis (CEA) showed for low-risk prostate cancer, EBRT dominated the lowest cost brachytherapy, but RPns and brachytherapy plus EBRT were cost-effective compared to brachytherapy with ICERs of $18,926 and $41,662 per QALY. In medium-risk patients, RP, EBRT and brachytherapy plus EBRT all were cost-effective compared with brachytherapy, with ICERs of $30,604, $22,588 and $21,627/QALY. In high-risk, brachytherapy dominated all treatments. Procedure cost and utility are driving ICER, but probabilistic sensitivity analysis showed the model was robust across variables. CONCLUSION: This first CEA combining prospective real-world evidence for HRQOL outcomes with costs shows cost-effectiveness of treatments vary by risk groups, providing new evidence for treatment decisions.


Assuntos
Neoplasias da Próstata , Masculino , Humanos , Análise Custo-Benefício , Estudos Prospectivos , Neoplasias da Próstata/terapia , Anos de Vida Ajustados por Qualidade de Vida , Prostatectomia
20.
Proc Natl Acad Sci U S A ; 116(49): 24712-24718, 2019 12 03.
Artigo em Inglês | MEDLINE | ID: mdl-31740601

RESUMO

The thermal tolerance of an organism limits its ecological and geographic ranges and is potentially affected by dependence on temperature-sensitive symbiotic partners. Aphid species vary widely in heat sensitivity, but almost all aphids are dependent on the nutrient-provisioning intracellular bacterium Buchnera, which has evolved with aphids for 100 million years and which has a reduced genome potentially limiting heat tolerance. We addressed whether heat sensitivity of Buchnera underlies variation in thermal tolerance among 5 aphid species. We measured how heat exposure of juvenile aphids affects later survival, maturation time, and fecundity. At one extreme, heat exposure of Aphis gossypii enhanced fecundity and had no effect on the Buchnera titer. In contrast, heat suppressed Buchnera populations in Aphis fabae, which suffered elevated mortality, delayed development and reduced fecundity. Likewise, in Acyrthosiphon kondoi and Acyrthosiphon pisum, heat caused rapid declines in Buchnera numbers, as well as reduced survivorship, development rate, and fecundity. Fecundity following heat exposure is severely decreased by a Buchnera mutation that suppresses the transcriptional response of a gene encoding a small heat shock protein. Similarly, absence of this Buchnera heat shock gene may explain the heat sensitivity of Ap. fabae Fluorescent in situ hybridization revealed heat-induced deformation and shrinkage of bacteriocytes in heat-sensitive species but not in heat-tolerant species. Sensitive and tolerant species also differed in numbers and transcriptional responses of heat shock genes. These results show that shifts in Buchnera heat sensitivity contribute to host variation in heat tolerance.


Assuntos
Afídeos/fisiologia , Buchnera/fisiologia , Simbiose/fisiologia , Termotolerância/fisiologia , Animais , Afídeos/microbiologia , Buchnera/isolamento & purificação , Feminino , Especificidade de Hospedeiro/fisiologia , Temperatura Alta/efeitos adversos
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA