Investigating Protein-Protein Interactions Between Grapevine Leafroll-Associated Virus 3 and Vitis vinifera.

Grapevine leafroll disease (GLD) is a globally important disease that affects the metabolic composition and biomass of grapes, leading to a reduction in grape yield and quality of wine produced. Grapevine leafroll-associated virus 3 (GLRaV-3) is the main causal agent for GLD. This study aimed to identify protein-protein interactions between GLRaV-3 and its host. A yeast two-hybrid (Y2H) library was constructed from Vitis vinifera mRNA and screened against GLRaV-3 open reading frames encoding structural proteins and those potentially involved in systemic spread and silencing of host defense mechanisms. Five interacting protein pairs were identified, three of which were demonstrated in planta. The minor coat protein of GLRaV-3 was shown to interact with 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase 02, a protein involved in primary carbohydrate metabolism and the biosynthesis of aromatic amino acids. Interactions were also identified between GLRaV-3 p20A and an 18.1-kDa class I small heat shock protein, as well as MAP3K epsilon protein kinase 1. Both proteins are involved in the response of plants to various stressors, including pathogen infections. Two additional proteins, chlorophyll a-b binding protein CP26 and a SMAX1-LIKE 6 protein, were identified as interacting with p20A in yeast but these interactions could not be demonstrated in planta. The findings of this study advance our understanding of the functions of GLRaV-3-encoded proteins and how the interaction between these proteins and those of V. vinifera could lead to GLD.

First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa.

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

Utilisation of a mitochondrial intergenic region for species differentiation of fruit flies (Diptera: Tephritidae) in South Africa.

BACKGROUND: Fruit flies (Diptera: Tephritidae) comprise species of agricultural and economic importance. Five such fruit fly species are known to affect commercial fruit production and export in South Africa: Ceratitis capitata, Ceratitis cosyra, Ceratitis rosa, Ceratitis quilicii, and Bactrocera dorsalis. Management practices for these pests include monitoring, application of pest control products, post-harvest disinfestation measures and inspection of consignments both prior to shipment and at ports of entry. In activities relating to monitoring and inspection, accurate identification of these pests to species level is required. While morphological keys for adult stages of these fruit fly species have been well developed, morphological keys for earlier life stages remain problematic. In instances where closely related species cannot be reliably distinguished morphologically, there is a need for molecular tools to assist in identifying these five fruit fly species during surveillance practices, where sequencing-based approaches would be beneficial. RESULTS: Two complete mitochondrial genomes were assembled for each fruit fly species investigated using high throughput sequencing data generated in this study. A single primer set was designed to amplify a region between tRNAile and tRNAmet. The amplicon consists of a partial segment of tRNAile, intergenic region I (tRNAile - tRNAgln), the complete sequence of tRNAgln, intergenic region II (tRNAgln - tRNAmet), and a partial segment of tRNAmet. PCR amplicons were generated for 20 specimens of each species, five of which were colony adult males, five colony larvae, and 10 wild, trap-collected specimens. Upon analysis of the amplicon, intergenic region I was identified as the most informative region, allowing for unambiguous identification of the five fruit fly species. The similarity in intergenic region II was too high between C. rosa and C. quilicii for accurate differentiation of these species. CONCLUSION: The identity of all five fruit flies investigated in this study can be determined through sequence analysis of the mitochondrial intergenic regions. Within the target amplicon, intergenic region I (tRNAile - tRNAgln) shows interspecific variation sufficient for species differentiation based on multiple sequence alignment. The variation in the length of intergenic region I is proposed as a potential tool for accurately identifying these five fruit flies in South Africa.

A Review of the 'Candidatus Liberibacter africanus' Citrus Pathosystem in Africa.

It has been nearly 100 years since citrus growers in two distinct regions in the northern provinces of South Africa noticed unusual symptoms in their citrus trees, causing significant crop losses. They had no idea that these symptoms would later become part of an almost global pandemic of a disease called greening or huanglongbing (HLB). The rapid spread of the disease indicated that it might be caused by a transmissible pathogen, but it took >50 years to identify the causative agent as 'Candidatus Liberibacter africanus'. Recently, the disease appeared in more African countries, spreading by both infected planting material and Trioza erytreae. To date, five 'Ca. L. africanus' subspecies have been identified in various rutaceous species, with 'Ca. L. africanus subsp. clausenae' the only subspecies for which a biovar was detected in citrus. Efforts to detect and differentiate HLB-causing Liberibacter species are ongoing, and recent developments are discussed here. This review focuses on aspects of the African form of HLB, including its specific bacterial species and subspecies, its main insect vector, its geographic distribution, and current management strategies.

First report of the plum marbling disease associated agent, plum viroid I, in apricots (Prunus armeniaca) in South Africa.

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

Distribution and Genetic Diversity of Coguvirus eburi in South African Citrus and the Development of a Real-Time RT-PCR Assay for Citrus-Infecting Coguviruses.

Citrus virus A (CiVA), a novel negative-sense single-stranded RNA virus assigned to the species Coguvirus eburi in the genus Coguvirus, was detected in South Africa with the use of high-throughput sequencing after its initial discovery in Italy. CiVA is closely related to citrus concave gum-associated virus (CCGaV), recently assigned to the species Citrus coguvirus. Disease association with CiVA is, however, incomplete. CiVA was detected in grapefruit (C. paradisi Macf.), sweet orange [C. sinensis (L.) Osb.], and clementine (C. reticulata Blanco) in South Africa, and a survey to determine the distribution, symptom association, and genetic diversity was conducted in three provinces and seven citrus production regions. The virus was detected in 'Delta' Valencia trees in six citrus production regions, and a fruit rind symptom was often observed on CiVA-positive trees. Additionally, grapefruit showing symptoms of citrus impietratura disease were positive for CiVA. This virus was primarily detected in older orchards that were established prior to the application of shoot tip grafting for virus elimination in the South African Citrus Improvement Scheme. The three viral-encoded genes of CiVA isolates from each cultivar and region were sequenced to investigate sequence diversity. Genetic differences were detected between the Delta Valencia, grapefruit, and clementine samples, with greater sequence variation observed with the nucleocapsid protein (NP) compared with the RNA-dependent RNA polymerase (RdRp) and the movement protein (MP). A real-time detection assay, targeting the RdRp, was developed to simultaneously detect citrus-infecting coguviruses, CiVA and CCGaV, using a dual priming reverse primer to improve PCR specificity.

Towards the validation of high-throughput sequencing (HTS) for routine plant virus diagnostics: measurement of variation linked to HTS detection of citrus viruses and viroids.

BACKGROUND: High-throughput sequencing (HTS) has been applied successfully for virus and viroid discovery in many agricultural crops leading to the current drive to apply this technology in routine pathogen detection. The validation of HTS-based pathogen detection is therefore paramount. METHODS: Plant infections were established by graft inoculating a suite of viruses and viroids from established sources for further study. Four plants (one healthy plant and three infected) were sampled in triplicate and total RNA was extracted using two different methods (CTAB extraction protocol and the Zymo Research Quick-RNA Plant Miniprep Kit) and sent for Illumina HTS. One replicate sample of each plant for each RNA extraction method was also sent for HTS on an Ion Torrent platform. The data were evaluated for biological and technical variation focussing on RNA extraction method, platform used and bioinformatic analysis. RESULTS: The study evaluated the influence of different HTS protocols on the sensitivity, specificity and repeatability of HTS as a detection tool. Both extraction methods and sequencing platforms resulted in significant differences between the data sets. Using a de novo assembly approach, complemented with read mapping, the Illumina data allowed a greater proportion of the expected pathogen scaffolds to be inferred, and an accurate virome profile was constructed. The complete virome profile was also constructed using the Ion Torrent data but analyses showed that more sequencing depth is required to be comparative to the Illumina protocol and produce consistent results. The CTAB extraction protocol lowered the proportion of viroid sequences recovered with HTS, and the Zymo Research kit resulted in more variation in the read counts obtained per pathogen sequence. The expression profiles of reference genes were also investigated to assess the suitability of these genes as internal controls to allow for the comparison between samples across different protocols. CONCLUSIONS: This study highlights the need to measure the level of variation that can arise from the different variables of an HTS protocol, from sample preparation to data analysis. HTS is more comprehensive than any assay previously used, but with the necessary validations and standard operating procedures, the implementation of HTS as part of routine pathogen screening practices is possible.

Complete genome sequence of a grapevine Roditis leaf discoloration-associated virus (GRLDaV) variant from South Africa.

High-throughput sequencing (HTS) was used to construct the virome profile of an old grapevine-leafroll-diseased grapevine (Vitis vinifera). De novo assembly of HTS data showed a complex infection, including a virus sequence with similarity to viruses of the genus Badnavirus, family Caulimoviridae. The complete genome sequence of this virus consists of 7090 nucleotides and has four open reading frames (ORFs). Genome organisation and phylogenetic analysis identify this virus as a divergent variant of grapevine Roditis leaf discoloration-associated virus (GRLDaV) with 90% nucleotide sequence identity to isolate w4 (NC_027131). This is the first genome sequence of a South African variant of GRLDaV.

Grapefruit Field Trial Evaluation of Citrus Tristeza Virus T68-Strain Sources.

Determination of virus genomes and differentiation of strains and strain variants facilitate the linkage of biological expression to specific genetic units. For effective management of stem pitting disease of citrus tristeza virus (CTV) by cross-protection, an understanding of these links is necessary. The deliberate field application of a biological agent such as a virus first requires a thorough assessment of the long-term impact before it can be applied commercially. Three CTV sources were genetically characterized as different variants of the T68 strain, and their long-term effects on stem pitting and production were investigated. The different CTV sources were inoculated to 'Star Ruby' grapefruit trees and evaluated for a number of biological parameters in a field trial in the Limpopo Province of South Africa over a 10-year period. Significant differences were observed in stem pitting severity, impact on tree growth, yield, and the percentage of small fruit produced. These T68 variants were also associated with different stem pitting phenotypes. The variants differed in only 44 nucleotide positions across their genomes, and these minor genetic differences can therefore be used to identify possible genome regions affecting stem pitting.

ICTV Virus Taxonomy Profile: Closteroviridae.

Viruses in the family Closteroviridae have a mono-, bi- or tripartite positive-sense RNA genome of 13-19 kb, and non-enveloped, filamentous particles 650-2200 nm long and 12 nm in diameter. They infect plants, mainly dicots, many of which are fruit crops. This is a summary of the ICTV Report on the family Closteroviridae, which is available at ictv.global/report/closteroviridae.

Genomic characterisation of a newly identified badnavirus infecting ivy (Hedera helix).

High-throughput sequencing (HTS) was used to investigate ringspots on ivy (Hedera helix) leaves. De novo assembly of HTS data generated from a total RNA extract from these leaves yielded a contig with sequence similarity to viruses of the genus Badnavirus, family Caulimoviridae. The complete genome sequence of this virus consists of 8,885 nucleotides and has three open reading frames (ORFs). Genome organisation and phylogenetic analysis identifies this newly identified virus as a new member of the genus Badnavirus for which we propose the name "ivy ringspot-associated virus" (IRSaV).

A Plum Marbling Conundrum: Identification of a New Viroid Associated with Marbling and Corky Flesh in Japanese Plums.

Over the past 2 decades, fruit symptoms resembling a marbling pattern on the fruit skin or corking of the fruit flesh were observed on Japanese plums in South Africa, resulting in unmarketable fruit. The ability of high-throughput sequencing (HTS) to detect known and unknown pathogens was exploited by assaying affected and unaffected fruit tree accessions to identify the potential aetiological agent of marbling and/or corky flesh disease. In this study, it is shown that the disease is associated with a previously undescribed small RNA with typical viroid structural features. The potential viroid was the only pathological agent consistently detected in all symptomatic trees by HTS, and the association with the symptoms was confirmed in field surveys over two seasons. To date, this RNA was not detectable by RT-PCR in seedlings raised from seeds collected from infected trees. Although the autonomous replication of this viroid-like RNA was not proven, it was shown to be transmissible by grafting and associated with a range of symptoms that include marbling on the fruit skin, corky flesh, reduced fruit size, irregular shape, and uneven fruit surface depending on the cultivar. Moreover, the circular RNA genome, consisting of 317 nucleotides, strongly supports that this viroid-like RNA is most likely a viroid for which the name plum viroid I (PVd-I) is proposed. The primary structure of this viroid showed a less than 90% nucleotide sequence identity to viroids of the genus Apscaviroid, with which it has close phylogenetic relationships and shares conserved structural motifs.

Citrus Tristeza Virus Isolates of the Same Genotype Differ in Stem Pitting Severity in Grapefruit.

Two isolates of the T68 genotype of citrus tristeza virus (CTV) were derived from a common source, GFMS12, by single aphid transmission. These isolates, named GFMS12-8 and GFMS12-1.3, induced stem pitting with differing severity in 'Duncan' grapefruit (Citrus × paradisi [Macfad.]). Full-genome sequencing of these isolates showed only minor nucleotide sequence differences totaling 45 polymorphisms. Numerous nucleotide changes, in relatively close proximity, were detected in the p33 open reading frame (ORF) and the leader protease domains of ORF1a. This is the first report of full-genome characterization of CTV isolates of a single genotype, derived from the same source, but showing differences in pathogenicity. The results demonstrate the development of intragenotype heterogeneity known to occur with single-stranded RNA viruses. Identification of genetic variability between isolates showing different pathogenicity will enable interrogation of specific genome regions for potential stem pitting determinants.

First report of 'Candidatus Liberibacter africanus' associated with African Greening of Citrus in Angola.

Huanglongbing (HLB, Asian Citrus Greening), the most devastating disease of citrus has not been detected in southern Africa (Gottwald, 2010). HLB is associated with 'Candidatus Liberibacter asiaticus' (CLas), a phloem-limited bacterium vectored by Diaphorina citri Kuwayama (Hemiptera: Liviidae), the Asian Citrus Psyllid (ACP). African Citrus Greening, associated with 'Candidatus Liberibacter africanus' (CLaf) and its vector the African Citrus Triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae), are endemic to Africa, although not previously reported from Angola. African Greening is less severe than HLB, largely due to heat sensitivity of CLaf and its vector. Introduction of HLB into southern Africa would be devastating to citrus production in commercial and informal sectors. Concern was raised that CLas or ACP might hae inadvertently been introduced into Angola. In July 2019, a survey was conducted in two citrus nurseries in Luanda and Caxito and in different orchards on 7 farms surrounding Calulo and Quibala. Yellow sticky traps for insects were placed at the various localities and collected after c. 3 weeks. Breeding signs of T. erytreae (pit galls) were observed on citrus in some locations, but no insect vectors were detected on traps. Trees were inspected for signs and symptoms of citrus pests and diseases, particularly those that resemble HLB (foliar blotchy mottle, shoot chlorosis, vein yellowing and corking, lopsided fruit with aborted seeds and colour inversion) and its vectors (pit galls on leaves or waxy exudates). Leaves and shoots with suspect symptoms were sampled for laboratory analysis (43 samples). DNA was extracted from petiole and midrib tissue of leaves using a modified CTAB extraction protocol of Doyle and Doyle (1990). Real-time PCR was done using universal Liberibacter primers of Roberts et al. (2015), CLaf specific primers of Li et al. (2006) and CLas specific primers of Bao et al. (2019). All real-time PCR protocols indicated the presence of CLaf in 6 samples (Tab. S1). CLas or other citrus Liberibacter species were not detected. The presence of CLaf in sample 37 was confirmed by constructing a library (NEXTFLEX® DNA Sequencing Kit, PerkinElmer) with extracted DNA and performing high-throughput sequencing on an Ion Torrent™ S5™ platform (Central Analytical Facility, Stellenbosch University). To improve the quality of the reads, all 233,617,700 obtained reads were trimmed from the 3' end to a maximum length of 240 nt using Trimmomatic (Bolger et al. 2014). The high quality reads were mapped to the Citrus sinensis reference genome (NC_023046.1) using Bowtie 2.3.4 (Langmead and Salzberg 2012) to subtract all the reads that had high identity to the host plant (number of mismatches allowed in the seed was set to 1). The 14,691,369 unmapped reads (6.2% of original data) were mapped to the CLaf reference genome NZ_CP004021.1 using CLC Genomics Workbench 10.1.1 (Qiagen) (Length fraction = 0.8; Similarity fraction = 0.9). A CLaf consensus genome was generated that spanned 99.7% of the reference genome and the 163001 mapped reads had a 22.9 mean read coverage. The consensus sequence was 99.7% identical to NZ_CP004021.1 and was submitted to Genbank as accession: CP054879. The positive CLaf detections were from trees with typical HLB or African Citrus Greening symptoms, viz. lopsided fruit with green stylar ends, aborted seed and stained columella at base of fruit button; yellow shoots with leaves showing symptoms of blotchy mottle and vein yellowing and corking (Fig. S1) in a commercial citrus farm outside Calulo and included 2 'Ponkan' mandarin (C. reticulata), 2 Valencia and 1 'Navelina' tree (C. sinensis), and a citrus nursery in Luanda (1 lime tree; C. aurantifolia) (Tab. S1). This first report of CLaf in Angola highlights the need to prevent spread by removing infected trees and managing the insect vector, as well as the need for further surveys to determine the occurrence of African Greening and its vectors in other provinces and to confirm the absence of exotic citrus pests and diseases. References Bao, M. et al. 2020. Plant Dis. 104:527 Bolger, A. M. et al. 2014. Bioinformatics. 30:2114-2120. Doyle, J.J. and Doyle, J.L. 1990. Focus 12:13 Gottwald, T.R. 2010. Annu. Rev. Phytopathol. 48:119 Langmead, B. and Salzberg, S. 2012. Nature Methods. 9:357-359. Li, W. et al. 2006. Jnl. Microbiol. Methods 66:104 Roberts, R. et al. 2015. Int. J. Syst. Evol. Micr. 65:723.

Virus Detection by High-Throughput Sequencing of Small RNAs: Large-Scale Performance Testing of Sequence Analysis Strategies.

Recent developments in high-throughput sequencing (HTS), also called next-generation sequencing (NGS), technologies and bioinformatics have drastically changed research on viral pathogens and spurred growing interest in the field of virus diagnostics. However, the reliability of HTS-based virus detection protocols must be evaluated before adopting them for diagnostics. Many different bioinformatics algorithms aimed at detecting viruses in HTS data have been reported but little attention has been paid thus far to their sensitivity and reliability for diagnostic purposes. Therefore, we compared the ability of 21 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 12 plant viruses through a double-blind large-scale performance test using 10 datasets of 21- to 24-nucleotide small RNA (sRNA) sequences from three different infected plants. The sensitivity of virus detection ranged between 35 and 100% among participants, with a marked negative effect when sequence depth decreased. The false-positive detection rate was very low and mainly related to the identification of host genome-integrated viral sequences or misinterpretation of the results. Reproducibility was high (91.6%). This work revealed the key influence of bioinformatics strategies for the sensitive detection of viruses in HTS sRNA datasets and, more specifically (i) the difficulty in detecting viral agents when they are novel or their sRNA abundance is low, (ii) the influence of key parameters at both assembly and annotation steps, (iii) the importance of completeness of reference sequence databases, and (iv) the significant level of scientific expertise needed when interpreting pipeline results. Overall, this work underlines key parameters and proposes recommendations for reliable sRNA-based detection of known and unknown viruses.

Cell division and turgor mediate enhanced plant growth in Arabidopsis plants treated with the bacterial signalling molecule lumichrome.

MAIN CONCLUSION: Transcriptomic analysis indicates that the bacterial signalling molecule lumichrome enhances plant growth through a combination of enhanced cell division and cell enlargement, and possibly enhances photosynthesis. Lumichrome (7,8 dimethylalloxazine), a novel multitrophic signal molecule produced by Sinorhizobium meliloti bacteria, has previously been shown to elicit growth promotion in different plant species (Phillips et al. in Proc Natl Acad Sci USA 96:12275-12280, https://doi.org/10.1073/pnas.96.22.12275 , 1999). However, the molecular mechanisms that underlie this plant growth promotion remain obscure. Global transcript profiling using RNA-seq suggests that lumichrome enhances growth by inducing genes impacting on turgor driven growth and mitotic cell cycle that ensures the integration of cell division and expansion of developing leaves. The abundance of XTH9 and XPA4 transcripts was attributed to improved mediation of cell-wall loosening to allow turgor-driven cell enlargement. Mitotic CYCD3.3, CYCA1.1, SP1L3, RSW7 and PDF1 transcripts were increased in lumichrome-treated Arabidopsis thaliana plants, suggesting enhanced growth was underpinned by increased cell differentiation and expansion with a consequential increase in biomass. Synergistic ethylene-auxin cross-talk was also observed through reciprocal over-expression of ACO1 and SAUR54, in which ethylene activates the auxin signalling pathway and regulates Arabidopsis growth by both stimulating auxin biosynthesis and modulating the auxin transport machinery to the leaves. Decreased transcription of jasmonate biosynthesis and responsive-related transcripts (LOX2; LOX3; LOX6; JAL34; JR1) might contribute towards suppression of the negative effects of methyl jasmonate (MeJa) such as chlorophyll loss and decreases in RuBisCO and photosynthesis. This work contributes towards a deeper understanding of how lumichrome enhances plant growth and development.

Genetic diversity and identification of putative recombination events in grapevine rupestris stem pitting-associated virus.

The impact of recombination on variant classification and the use of different genomic regions to identify virus variants were investigated using a diversity study performed on grapevine rupestris stem pitting-associated virus (GRSPaV). Three surveys were conducted to investigate the genetic diversity of GRSPaV and to compare the ability of the GRSPaV coat protein and replicase domains to classify virus variants. GRSPaV variants identified in the surveys clustered into five of the six currently recognised lineages, and a seventh, previously unclassified lineage was detected. A correlation was observed between the detection of recombinant GRSPaV sequences and inconsistencies in classification when using different genome regions for analysis.

In silico analysis of the grapefruit sRNAome, transcriptome and gene regulation in response to CTV-CDVd co-infection.

BACKGROUND: Small RNA (sRNA) associated gene regulation has been shown to play a significant role during plant-pathogen interaction. In commercial citrus orchards co-infection of Citrus tristeza virus (CTV) and viroids occur naturally. METHODS: A next-generation sequencing-based approach was used to study the sRNA and transcriptional response in grapefruit to the co-infection of CTV and Citrus dwarfing viroid. RESULTS: The co-infection resulted in a difference in the expression of a number of sRNA species when comparing healthy and infected plants; the majority of these were derived from transcripts processed in a phased manner. Several RNA transcripts were also differentially expressed, including transcripts derived from two genes, predicted to be under the regulation of sRNAs. These genes are involved in plant hormone systems; one in the abscisic acid, and the other in the cytokinin regulatory pathway. Additional analysis of virus- and viroid-derived small-interfering RNAs (siRNAs) showed areas on the pathogen genomes associated with increased siRNA synthesis. Most interestingly, the starting position of the p23 silencing suppressor's sub-genomic RNA generated a siRNA hotspot on the CTV genome. CONCLUSIONS: This study showed the involvement of various genes, as well as endogenous and exogenous RNA-derived sRNA species in the plant-defence response. The results highlighted the role of sRNA-directed plant hormone regulation during biotic stress, as well as a counter-response of plants to virus suppressors of RNA-silencing.

Differential expression of miRNAs and associated gene targets in grapevine leafroll-associated virus 3-infected plants.

MicroRNAs (miRNAs) are a class of endogenous small non-coding RNAs (sRNA) that play an essential role in the regulation of target mRNAs expressed during plant development and in response to stress. MicroRNA expression profiling has helped to identify miRNAs that regulate a range of processes, including the plant's defence response to pathogens. In this study, differential miRNA expression in own-rooted Vitis vinifera cv. Cabernet Sauvignon plants infected with grapevine leafroll-associated virus 3 was investigated with microarrays and next-generation sequencing (NGS) of sRNA and mRNA. These high-throughput approaches identified several differentially expressed miRNAs. Four miRNAs, identified by both approaches, were validated by stemloop RT-PCRs. Three of the predicted targets of the differentially expressed miRNAs were also differentially expressed in the transcriptome data of infected plants, and were validated by RT-qPCR. Identification of these miRNAs and their targets can lead to a better understanding of host-pathogen interactions involved in grapevine leafroll disease and the identification of possible targets for virus resistance.

Harbin: a quantitation PCR analysis tool.

OBJECTIVES: To enable analysis and comparisons of different relative quantitation experiments, a web-browser application called Harbin was created that uses a quantile-based scoring system for the comparison of samples at different time points and between experiments. RESULTS: Harbin uses the standard curve method for relative quantitation to calculate concentration ratios (CRs). To evaluate if different datasets can be combined the Harbin quantile bootstrap test is proposed. This test is more sensitive in detecting distributional differences between data sets than the Kolmogorov-Smirnov test. The utility of the test is demonstrated in a comparison of three grapevine leafroll associated virus 3 (GLRaV-3) RT-qPCR data sets. CONCLUSIONS: The quantile-based scoring system of CRs will enable the monitoring of virus titre or gene expression over different time points and be useful in other genomic applications where the combining of data sets are required.