Structural Motifs at the Telomeres and Their Role in Regulatory Pathways.

Telomeres are specialized structures, found at the ends of linear chromosomes in eukaryotic cells, that play a crucial role in maintaining the stability and integrity of genomes. They are composed of repetitive DNA sequences, ssDNA overhangs, and several associated proteins. The length of telomeres is linked to cellular aging in humans, and deficiencies in their maintenance are associated with various diseases. Key structural motifs at the telomeres serve to protect vulnerable chromosomal ends. Telomeric DNA also has the ability to form diverse complex DNA higher-order structures, including T-loops, D-loops, R-loops, G-loops, G-quadruplexes, and i-motifs, in the complementary C-rich strand. While many essential proteins at telomeres have been identified, the intricacies of their interactions and structural details are still not fully understood. This Perspective highlights recent advancements in comprehending the structures associated with human telomeres. It emphasizes the significance of telomeres, explores various telomeric structural motifs, and delves into the structural biology surrounding telomeres and telomerase. Furthermore, telomeric loops, their topologies, and the associated proteins that contribute to the safeguarding of telomeres are discussed.

A simple and Sequential Strategy for the Introduction of Complexity and Hierarchy in Hydrogen-bonded Organic Framework (HOF) Crystals for Environmental Applications.

Hydrogen-bonded organic frameworks (HOFs) are a new class of crystalline porous organic molecular materials (POMMs) with great potential for a diverse range of applications. HOFs face common challenges to POMMs, and in general to purely organic crystals, that is, the difficulty of integrating complexity in crystals. Herein, we proposed a simple and sequential strategy for the formation of HOFs with hierarchical superstructures. The strategy is based on controlling the assembly conditions, avoiding the use of any surface functionalization or template, which allows to obtain hierarchical crystalline porous superstructures in an easy manner. As proof of concept, we obtained the first example of core-shell (HOF-on-HOF) crystals and HOFs with hierarchical superstructures having superhydrophobicity and trapping abilities for the capture of persistent water contaminants such as oils and microplastics. We expect that this strategy could serve as inspiration for the construction of more intricated multiscale structures that could greatly expand the library of HOFs materials.

More than forty years of nucleic acid structural science.

As scientists who have worked with Stephen Neidle over many years and stages of his career, we present our perspective of his contributions to nucleic acid structural science. We trace some of the highlights of his research on nucleic acid drug interactions and the unique insights about the importance of hydration.

Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths.

Obtaining phase information remains a formidable challenge for nucleic acid structure determination. The introduction of an X-ray synchrotron beamline designed to be tunable to long wavelengths at Diamond Light Source has opened the possibility to native de novo structure determinations by the use of intrinsic scattering elements. This provides opportunities to overcome the limitations of introducing modifying nucleotides, often required to derive phasing information. In this paper, we build on established methods to generate new tools for nucleic acid structure determinations. We report on the use of (i) native intrinsic potassium single-wavelength anomalous dispersion methods (K-SAD), (ii) use of anomalous scattering elements integral to the crystallization buffer (extrinsic cobalt and intrinsic potassium ions), (iii) extrinsic bromine and intrinsic phosphorus SAD to solve complex nucleic acid structures. Using the reported methods we solved the structures of (i) Pseudorabies virus (PRV) RNA G-quadruplex and ligand complex, (ii) PRV DNA G-quadruplex, and (iii) an i-motif of human telomeric sequence. Our results highlight the utility of using intrinsic scattering as a pathway to solve and determine non-canonical nucleic acid motifs and reveal the variability of topology, influence of ligand binding, and glycosidic angle rearrangements seen between RNA and DNA G-quadruplexes of the same sequence.

BMPQ-1 binds selectively to (3+1) hybrid topologies in human telomeric G-quadruplex multimers.

A single G-quadruplex forming sequence from the human telomere can adopt six distinct topologies that are inter-convertible under physiological conditions. This presents challenges to design ligands that show selectivity and specificity towards a particular conformation. Additional complexity is introduced in differentiating multimeric G-quadruplexes over monomeric species, which would be able to form in the single-stranded 3' ends of telomeres. A few ligands have been reported that bind to dimeric quadruplexes, but their preclinical pharmacological evaluation is limited. Using multidisciplinary approaches, we identified a novel quinoline core ligand, BMPQ-1, which bound to human telomeric G-quadruplex multimers over monomeric G-quadruplexes with high selectivity, and induced the formation of G-quadruplex DNA along with the related DNA damage response at the telomere. BMPQ-1 reduced tumor cell proliferation with an IC50 of ∼1.0 µM and decreased tumor growth rate in mouse by half. Biophysical analysis using smFRET identified a mixture of multiple conformations coexisting for dimeric G-quadruplexes in solution. Here, we showed that the titration of BMPQ-1 shifted the conformational ensemble of multimeric G-quadruplexes towards (3+1) hybrid-2 topology, which became more pronounced as further G-quadruplex units are added.

Mechanistic In Situ and Ex Situ Studies of Phase Transformations in Molecular Co-Crystals.

Co-crystallisation is widely explored as a route to improve the physical properties of pharmaceutical active ingredients, but little is known about the fundamental mechanisms of the process. Herein, we apply a hyphenated differential scanning calorimetry-X-ray diffraction technique to mimic the commercial hot melt extrusion process, and explore the heat-induced synthesis of a series of new co-crystals containing isonicotinamide. These comprise a 1:1 co-crystal with 4-hydroxybenzoic acid, 2:1 and 1:2 systems with 4-hydroxyphenylacetic acid and a 1:1 crystal with 3,4-dihydroxyphenylactic acid. The formation of co-crystals during heating is complex mechanistically. In addition to co-crystallisation, conversions between polymorphs of the co-former starting materials and co-crystal products are also observed. A subsequent study exploring the use of inkjet printing and milling to generate co-crystals revealed that the synthetic approach has a major effect on the co-crystal species and polymorphs produced.

Towards the Inhibition of Protein-Protein Interactions (PPIs) in STAT3: Insights into a New Class of Benzothiadiazole Derivatives.

Signal transducer and activator of transcription 3 (STAT3) is a validated anticancer target due to the relationship between its constitutive activation and malignant tumors. Through a virtual screening approach on the STAT3-SH2 domain, 5,6-dimethyl-1H,3H-2,1,3-benzothiadiazole-2,2-dioxide (1) was identified as a potential STAT3 inhibitor. Some benzothiadiazole derivatives were synthesized by employing a versatile methodology, and they were tested by an AlphaScreen-based assay. Among them, benzosulfamide 1 showed a significant activity with an IC50 = 15.8 ± 0.6 µM as a direct STAT3 inhibitor. Notably, we discovered that compound 1 was also able to interact with cysteine residues located around the SH2 domain. By applying mass spectrometry, liquid chromatography, NMR, and UV spectroscopy, an in-depth investigation was carried out, shedding light on its intriguing and unexpected mechanism of interaction.

Holliday Junctions Formed from Human Telomeric DNA.

Cells have evolved inherent mechanisms, like homologous recombination (HR), to repair damaged DNA. However, repairs at telomeres can lead to genomic instability, often associated with cancer. While most rapidly dividing cells employ telomerase, the others maintain telomere length through HR-dependent alternative lengthening of telomeres (ALT) pathways. Here we describe the crystal structures of Holliday junction intermediates of the HR-dependent ALT mechanism. Using an extended human telomeric repeat, we also report the crystal structure of two Holliday junctions in close proximity, which associate together through strand exchange to form a hemicatenated double Holliday junction. Our combined structural results demonstrate that ACC nucleotides in the C-rich lagging strand (5'-CTAACCCTAA-3') at the telomere repeat sequence constitute a conserved structural feature that constrains crossover geometry and is a preferred site for Holliday junction formation in telomeres.

A naphthalene diimide G-quadruplex ligand inhibits cell growth and down-regulates BCL-2 expression in an imatinib-resistant gastrointestinal cancer cell line.

Gastro-intestinal tumours (GISTs) are driven by aberrant expression of the c-KIT oncoprotein. They can be effectively treated by the kinase inhibitor imatinib, which locks the c-KIT kinase domain into an inactive conformation. However resistance to imatinib, driven by active-site mutations, is a recurrent clinical challenge, which has been only partly met by the subsequent development of second and third-generation c-KIT inhibitors. It is reported here that a tetra-substituted naphthalene diimide derivative, which is a micromolar inhibitor of cell growth in a wild-type patient-derived GIST cell line, has a sub-micromolar activity in two distinct patient-derived imatinib-resistant cell lines. The compound has been previously shown to down-regulate expression of the c-KIT protein in a wild-type GIST cell line. It does not affect c-KIT protein expression in a resistant cell line to the same extent, whereas it profoundly down-regulates the expression of the anti-apoptopic protein BCL-2. It is proposed that the mechanism of action involves targeting quadruplex nucleic acid structures, and in particular those in the BCL-2 gene and its RNA transcript. The BCL-2 protein is up-regulated in the GIST-resistant cell line, and is strongly down-regulated after treatment. The compound strongly stabilises a range of G-quadruplexes including a DNA one from the BCL-2 promoter and an RNA quadruplex from its 5'-UTR region. A reporter assay construct incorporating the 5'-UTR quadruplex sequence demonstrates down-regulation of BCL-2 expression.

Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay.

BACKGROUND: Natural bioproducts are invaluable resources in drug discovery. Isoquinoline alkaloids of Chelidonium majus constitute a structurally diverse family of natural products that are of great interest, one of them being their selectivity for human telomeric G-quadruplex structure and telomerase inhibition. METHODS: The study focuses on the mechanism of telomerase inhibition by stabilization of telomeric G-quadruplex structures by berberine, chelerythrine, chelidonine, sanguinarine and papaverine. Telomerase activity and mRNA levels of hTERT were estimated using quantitative telomere repeat amplification protocol (q-TRAP) and qPCR, in MCF-7 cells treated with different groups of alkaloids. The selectivity of the main isoquinoline alkaloids of Chelidonium majus towards telomeric G-quadruplex forming sequences were explored using a sensitive modified thermal FRET-melting measurement in the presence of the complementary oligonucleotide CT22. We assessed and monitored G-quadruplex topologies using circular dichroism (CD) methods, and compared spectra to previously well-characterized motifs, either alone or in the presence of the alkaloids. Molecular modeling was performed to rationalize ligand binding to the G-quadruplex structure. RESULTS: The results highlight strong inhibitory effects of chelerythrine, sanguinarine and berberine on telomerase activity, most likely through substrate sequestration. These isoquinoline alkaloids interacted strongly with telomeric sequence G-quadruplex. In comparison, chelidonine and papaverine had no significant interaction with the telomeric quadruplex, while they strongly inhibited telomerase at transcription level of hTERT. Altogether, all of the studied alkaloids showed various levels and mechanisms of telomerase inhibition. CONCLUSIONS: We report on a comparative study of anti-telomerase activity of the isoquinoline alkaloids of Chelidonium majus. Chelerythrine was most effective in inhibiting telomerase activity by substrate sequesteration through G-quadruplex stabilization. GENERAL SIGNIFICANCE: Understanding structural and molecular mechanisms of anti-cancer agents can help in developing new and more potent drugs with fewer side effects. Isoquinolines are the most biologically active agents from Chelidonium majus, which have shown to be telomeric G-quadruplex stabilizers and potent telomerase inhibitors.

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

A regular thymine tetrad and a peculiar supramolecular assembly in the first crystal structure of an all-LNA G-quadruplex.

Locked nucleic acids (LNAs) are formed by bicyclic ribonucleotides where the O2' and C4' atoms are linked through a methylene bridge and the sugar is blocked in a 3'-endo conformation. They represent a promising tool for therapeutic and diagnostic applications and are characterized by higher thermal stability and nuclease resistance with respect to their natural counterparts. However, structural descriptions of LNA-containing quadruplexes are rather limited, since few NMR models have been reported in the literature. Here, the first crystallographically derived model of an all-LNA-substituted quadruplex-forming sequence 5'-TGGGT-3' is presented refined at 1.7 Šresolution. This high-resolution crystallographic analysis reveals a regular parallel G-quadruplex arrangement terminating in a well defined thymine tetrad at the 3'-end. The detailed picture of the hydration pattern reveals LNA-specific features in the solvent distribution. Interestingly, two closely packed quadruplexes are present in the asymmetric unit. They face one another with their 3'-ends giving rise to a compact higher-order structure. This new assembly suggests a possible way in which sequential quadruplexes can be disposed in the crowded cell environment. Furthermore, as the formation of ordered structures by molecular self-assembly is an effective strategy to obtain nanostructures, this study could open the way to the design of a new class of LNA-based building blocks for nanotechnology.

Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation.

We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.

Structural descriptions of ligand interactions to RNA quadruplexes folded from the non-coding region of pseudorabies virus.

To rationalise the binding of specific ligands to RNA-quadruplex we investigated several naphthalene diimide ligands that interact with the non-coding region of Pseudorabies virus (PRV). Herein we report on the x-ray structure of the naphthalene diimide ND11 with an RNA G-quadruplex putative forming sequence from rPRV. Consistent with previously observed rPRV sequence it assembles into a bimolecular RNA G-quadruplex consisting of a pair of two tetrads stacked 3' to 5'. We observe that ND11 interacts by binding on both the externally available 5' and 3' quartets. The CUC (loop 1) is structurally altered to enhance the 5' mode of interaction. These loop residues are shifted significantly to generate a new ligand binding pocket whereas the terminal A14 residue is lifted away from the RNA G-quadruplex tetrad plane to be restacked above the bound ND11 ligand NDI core. CD analysis of this family of NDI ligands shows consistency in the spectra between the different ligands in the presence of the rPRV RNA G-quadruplex motif, reflecting a common folded topology and mode of ligand interaction. FRET melt assay confirms the strong stabilising properties of the tetrasubstituted NDI compounds and the contributions length of the substituted groups have on melt temperatures.

Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex.

The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

H-NS forms a superhelical protein scaffold for DNA condensation.

The histone-like nucleoid structuring (H-NS) protein plays a fundamental role in DNA condensation and is a key regulator of enterobacterial gene expression in response to changes in osmolarity, pH, and temperature. The protein is capable of high-order self-association via interactions of its oligomerization domain. Using crystallography, we have solved the structure of this complete domain in an oligomerized state. The observed superhelical structure establishes a mechanism for the self-association of H-NS via both an N-terminal antiparallel coiled-coil and a second, hitherto unidentified, helix-turn-helix dimerization interface at the C-terminal end of the oligomerization domain. The helical scaffold suggests the formation of a H-NS:plectonemic DNA nucleoprotein complex that is capable of explaining published biophysical and functional data, and establishes a unifying structural basis for coordinating the DNA packaging and transcription repression functions of H-NS.

Structural basis for telomeric G-quadruplex targeting by naphthalene diimide ligands.

The folding of the single-stranded 3' end of the human telomere into G-quadruplex arrangements inhibits the overhang from hybridizing with the RNA template of telomerase and halts telomere maintenance in cancer cells. The ability to thermally stabilize human telomeric DNA as a four-stranded G-quadruplex structure by developing selective small molecule compounds is a therapeutic path to regulating telomerase activity and thereby selectively inhibit cancer cell growth. The development of compounds with the necessary selectivity and affinity to target parallel-stranded G-quadruplex structures has proved particularly challenging to date, relying heavily upon limited structural data. We report here on a structure-based approach to the design of quadruplex-binding ligands to enhance affinity and selectivity for human telomeric DNA. Crystal structures have been determined of complexes between a 22-mer intramolecular human telomeric quadruplex and two potent tetra-substituted naphthalene diimide compounds, functionalized with positively charged N-methyl-piperazine side-chains. These compounds promote parallel-stranded quadruplex topology, binding exclusively to the 3' surface of each quadruplex. There are significant differences between the complexes in terms of ligand mobility and in the interactions with quadruplex grooves. One of the two ligands is markedly less mobile in the crystal complex and is more quadruplex-stabilizing, forming multiple electrostatic/hydrogen bond contacts with quadruplex phosphate groups. The data presented here provides a structural rationale for the biophysical (effects on quadruplex thermal stabilization) and biological data (inhibition of proliferation in cancer cell lines and evidence of in vivo antitumor activity) on compounds in this series and, thus, for the concept of telomere targeting with DNA quadruplex-binding small molecules.

Structural characterization and antimicrobial evaluation of atractyloside, atractyligenin, and 15-didehydroatractyligenin methyl ester.

We report the first complete structure elucidation of the ent-kaurane diterpenoid glycoside atractyloside (1) by means of NMR and X-ray diffractometry techniques. Extensive one- and two-dimensional NMR experiments were employed to assign the proton and carbon signals of 1, and crystallography experiments established the configurations of all stereogenic centers. Furthermore, we present a novel semisynthetic route for the preparation of the highly cytotoxic aglycone derivative of 1, 15-didehydroatractyligenin methyl ester (3). All compounds were tested for their antibiotic activity against Enterococcus faecalis, Escherichia coli, and several strains of Staphylococcus aureus, including fluoroquinolone-resistant (SA1199B) and two epidemic MRSA (EMRSA-15 and -16) strains. Compound 3 exhibited moderate activity against all of the Staph. aureus strains with an MIC value of 128 mg/L.

A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex.

DNA telomeric repeats in mammalian cells are transcribed to guanine-rich RNA sequences, which adopt parallel-stranded G-quadruplexes with a propeller-like fold. The successful crystallization and structure analysis of a bimolecular human telomeric RNA G-quadruplex, folded into the same crystalline environment as an equivalent DNA oligonucleotide sequence, is reported here. The structural basis of the increased stability of RNA telomeric quadruplexes over DNA ones and their preference for parallel topologies is described here. Our findings suggest that the 2'-OH hydroxyl groups in the RNA quadruplex play a significant role in redefining hydration structure in the grooves and the hydrogen bonding networks. The preference for specific nucleotides to populate the C3'-endo sugar pucker domain is accommodated by alterations in the phosphate backbone, which leads to greater stability through enhanced hydrogen bonding networks. Molecular dynamics simulations on the DNA and RNA quadruplexes are consistent with these findings. The computations, based on the native crystal structure, provide an explanation for RNA G-quadruplex ligand binding selectivity for a group of naphthalene diimide ligands as compared to the DNA G-quadruplex.

The application of DNA and RNA G-quadruplexes to therapeutic medicines.

The intriguing structural diversity in folded topologies available to guanine-rich nucleic acid repeat sequences have made four-stranded G-quadruplex structures the focus of both basic and applied research, from cancer biology and novel therapeutics through to nanoelectronics. Distributed widely in the human genome as targets for regulating gene expression and chromosomal maintenance, they offer unique avenues for future cancer drug development. In particular, the recent advances in chemical and structural biology have enabled the construction of bespoke selective DNA based aptamers to be used as novel therapeutic agents and access to detailed structural models for structure based drug discovery. In this critical review, we will explore the important underlying characteristics of G-quadruplexes that make them functional, stable, and predictable nanoscaffolds. We will review the current structural database of folding topologies, molecular interfaces and novel interaction surfaces, with a consideration to their future exploitation in drug discovery, molecular biology, supermolecular assembly and aptamer design. In recent years the number of potential applications for G-quadruplex motifs has rapidly grown, so in this review we aim to explore the many future challenges and highlight where possible successes may lie. We will highlight the similarities and differences between DNA and RNA folded G-quadruplexes in terms of stability, distribution, and exploitability as small molecule targets. Finally, we will provide a detailed review of basic G-quadruplex geometry, experimental tools used, and a critical evaluation of the application of high-resolution structural biology and its ability to provide meaningful and valid models for future applications (255 references).