Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 105
Filtrar
Mais filtros

País/Região como assunto
Intervalo de ano de publicação
1.
Cell ; 187(18): 4964-4980.e21, 2024 Sep 05.
Artigo em Inglês | MEDLINE | ID: mdl-39059380

RESUMO

The highly conserved and essential Plasmodium falciparum reticulocyte-binding protein homolog 5 (PfRH5) has emerged as the leading target for vaccines against the disease-causing blood stage of malaria. However, the features of the human vaccine-induced antibody response that confer highly potent inhibition of malaria parasite invasion into red blood cells are not well defined. Here, we characterize 236 human IgG monoclonal antibodies, derived from 15 donors, induced by the most advanced PfRH5 vaccine. We define the antigenic landscape of this molecule and establish that epitope specificity, antibody association rate, and intra-PfRH5 antibody interactions are key determinants of functional anti-parasitic potency. In addition, we identify a germline IgG gene combination that results in an exceptionally potent class of antibody and demonstrate its prophylactic potential to protect against P. falciparum parasite challenge in vivo. This comprehensive dataset provides a framework to guide rational design of next-generation vaccines and prophylactic antibodies to protect against blood-stage malaria.


Assuntos
Anticorpos Monoclonais , Anticorpos Antiprotozoários , Antígenos de Protozoários , Imunoglobulina G , Vacinas Antimaláricas , Malária Falciparum , Plasmodium falciparum , Proteínas de Protozoários , Animais , Humanos , Camundongos , Anticorpos Monoclonais/imunologia , Anticorpos Antiprotozoários/imunologia , Antígenos de Protozoários/imunologia , Proteínas de Transporte/imunologia , Epitopos/imunologia , Eritrócitos/parasitologia , Eritrócitos/imunologia , Imunoglobulina G/imunologia , Vacinas Antimaláricas/imunologia , Malária Falciparum/imunologia , Malária Falciparum/prevenção & controle , Malária Falciparum/parasitologia , Plasmodium falciparum/imunologia , Proteínas de Protozoários/imunologia
2.
Cell ; 185(12): 2116-2131.e18, 2022 06 09.
Artigo em Inglês | MEDLINE | ID: mdl-35662412

RESUMO

Highly transmissible Omicron variants of SARS-CoV-2 currently dominate globally. Here, we compare neutralization of Omicron BA.1, BA.1.1, and BA.2. BA.2 RBD has slightly higher ACE2 affinity than BA.1 and slightly reduced neutralization by vaccine serum, possibly associated with its increased transmissibility. Neutralization differences between sub-lineages for mAbs (including therapeutics) mostly arise from variation in residues bordering the ACE2 binding site; however, more distant mutations S371F (BA.2) and R346K (BA.1.1) markedly reduce neutralization by therapeutic antibody Vir-S309. In-depth structure-and-function analyses of 27 potent RBD-binding mAbs isolated from vaccinated volunteers following breakthrough Omicron-BA.1 infection reveals that they are focused in two main clusters within the RBD, with potent right-shoulder antibodies showing increased prevalence. Selection and somatic maturation have optimized antibody potency in less-mutated epitopes and recovered potency in highly mutated epitopes. All 27 mAbs potently neutralize early pandemic strains, and many show broad reactivity with variants of concern.


Assuntos
Anticorpos Monoclonais , Vacinas contra COVID-19/imunologia , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus , Enzima de Conversão de Angiotensina 2 , Anticorpos Monoclonais/química , Anticorpos Monoclonais/genética , Anticorpos Antivirais , COVID-19 , Vacinas contra COVID-19/administração & dosagem , Epitopos , Humanos , Testes de Neutralização , SARS-CoV-2/classificação , SARS-CoV-2/genética , Glicoproteína da Espícula de Coronavírus/química
3.
Cell ; 185(14): 2422-2433.e13, 2022 07 07.
Artigo em Inglês | MEDLINE | ID: mdl-35772405

RESUMO

The Omicron lineage of SARS-CoV-2, which was first described in November 2021, spread rapidly to become globally dominant and has split into a number of sublineages. BA.1 dominated the initial wave but has been replaced by BA.2 in many countries. Recent sequencing from South Africa's Gauteng region uncovered two new sublineages, BA.4 and BA.5, which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences, and although closely related to BA.2, they contain further mutations in the receptor-binding domain of their spikes. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by the serum from individuals vaccinated with triple doses of AstraZeneca or Pfizer vaccine compared with BA.1 and BA.2. Furthermore, using the serum from BA.1 vaccine breakthrough infections, there are, likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.


Assuntos
COVID-19 , Vacinas Virais , Anticorpos Neutralizantes , Anticorpos Antivirais , COVID-19/prevenção & controle , Humanos , Testes de Neutralização , SARS-CoV-2/genética , África do Sul
4.
Cell ; 184(11): 2939-2954.e9, 2021 05 27.
Artigo em Inglês | MEDLINE | ID: mdl-33852911

RESUMO

Terminating the SARS-CoV-2 pandemic relies upon pan-global vaccination. Current vaccines elicit neutralizing antibody responses to the virus spike derived from early isolates. However, new strains have emerged with multiple mutations, including P.1 from Brazil, B.1.351 from South Africa, and B.1.1.7 from the UK (12, 10, and 9 changes in the spike, respectively). All have mutations in the ACE2 binding site, with P.1 and B.1.351 having a virtually identical triplet (E484K, K417N/T, and N501Y), which we show confer similar increased affinity for ACE2. We show that, surprisingly, P.1 is significantly less resistant to naturally acquired or vaccine-induced antibody responses than B.1.351, suggesting that changes outside the receptor-binding domain (RBD) impact neutralization. Monoclonal antibody (mAb) 222 neutralizes all three variants despite interacting with two of the ACE2-binding site mutations. We explain this through structural analysis and use the 222 light chain to largely restore neutralization potency to a major class of public antibodies.


Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , COVID-19/imunologia , SARS-CoV-2/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Sítios de Ligação , COVID-19/terapia , COVID-19/virologia , Linhagem Celular , Humanos , Evasão da Resposta Imune , Imunização Passiva , Mutação , Ligação Proteica , Domínios Proteicos , SARS-CoV-2/genética , Deleção de Sequência , Glicoproteína da Espícula de Coronavírus/química , Glicoproteína da Espícula de Coronavírus/genética , Vacinação , Vacinas/imunologia , Soroterapia para COVID-19
5.
Cell ; 184(8): 2201-2211.e7, 2021 04 15.
Artigo em Inglês | MEDLINE | ID: mdl-33743891

RESUMO

SARS-CoV-2 has caused over 2 million deaths in little over a year. Vaccines are being deployed at scale, aiming to generate responses against the virus spike. The scale of the pandemic and error-prone virus replication is leading to the appearance of mutant viruses and potentially escape from antibody responses. Variant B.1.1.7, now dominant in the UK, with increased transmission, harbors 9 amino acid changes in the spike, including N501Y in the ACE2 interacting surface. We examine the ability of B.1.1.7 to evade antibody responses elicited by natural SARS-CoV-2 infection or vaccination. We map the impact of N501Y by structure/function analysis of a large panel of well-characterized monoclonal antibodies. B.1.1.7 is harder to neutralize than parental virus, compromising neutralization by some members of a major class of public antibodies through light-chain contacts with residue 501. However, widespread escape from monoclonal antibodies or antibody responses generated by natural infection or vaccination was not observed.


Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , COVID-19/imunologia , SARS-CoV-2/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Animais , Anticorpos Neutralizantes/sangue , Anticorpos Antivirais/sangue , Células CHO , COVID-19/epidemiologia , Chlorocebus aethiops , Cricetulus , Células HEK293 , Humanos , Pandemias , Ligação Proteica , Relação Estrutura-Atividade , Células Vero
6.
Cell ; 184(16): 4220-4236.e13, 2021 08 05.
Artigo em Inglês | MEDLINE | ID: mdl-34242578

RESUMO

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has undergone progressive change, with variants conferring advantage rapidly becoming dominant lineages, e.g., B.1.617. With apparent increased transmissibility, variant B.1.617.2 has contributed to the current wave of infection ravaging the Indian subcontinent and has been designated a variant of concern in the United Kingdom. Here we study the ability of monoclonal antibodies and convalescent and vaccine sera to neutralize B.1.617.1 and B.1.617.2, complement this with structural analyses of Fab/receptor binding domain (RBD) complexes, and map the antigenic space of current variants. Neutralization of both viruses is reduced compared with ancestral Wuhan-related strains, but there is no evidence of widespread antibody escape as seen with B.1.351. However, B.1.351 and P.1 sera showed markedly more reduction in neutralization of B.1.617.2, suggesting that individuals infected previously by these variants may be more susceptible to reinfection by B.1.617.2. This observation provides important new insights for immunization policy with future variant vaccines in non-immune populations.


Assuntos
Anticorpos Antivirais/imunologia , Vacinas contra COVID-19/imunologia , SARS-CoV-2/imunologia , Animais , Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Complexo Antígeno-Anticorpo/química , COVID-19/patologia , COVID-19/terapia , COVID-19/virologia , Vacinas contra COVID-19/administração & dosagem , Chlorocebus aethiops , Cristalografia por Raios X , Humanos , Imunização Passiva , Testes de Neutralização , Domínios Proteicos/imunologia , SARS-CoV-2/genética , SARS-CoV-2/isolamento & purificação , Glicoproteína da Espícula de Coronavírus/química , Glicoproteína da Espícula de Coronavírus/imunologia , Células Vero , Soroterapia para COVID-19
7.
Cell ; 184(8): 2183-2200.e22, 2021 04 15.
Artigo em Inglês | MEDLINE | ID: mdl-33756110

RESUMO

Antibodies are crucial to immune protection against SARS-CoV-2, with some in emergency use as therapeutics. Here, we identify 377 human monoclonal antibodies (mAbs) recognizing the virus spike and focus mainly on 80 that bind the receptor binding domain (RBD). We devise a competition data-driven method to map RBD binding sites. We find that although antibody binding sites are widely dispersed, neutralizing antibody binding is focused, with nearly all highly inhibitory mAbs (IC50 < 0.1 µg/mL) blocking receptor interaction, except for one that binds a unique epitope in the N-terminal domain. Many of these neutralizing mAbs use public V-genes and are close to germline. We dissect the structural basis of recognition for this large panel of antibodies through X-ray crystallography and cryoelectron microscopy of 19 Fab-antigen structures. We find novel binding modes for some potently inhibitory antibodies and demonstrate that strongly neutralizing mAbs protect, prophylactically or therapeutically, in animal models.


Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , COVID-19/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Animais , Sítios de Ligação de Anticorpos , Células CHO , Chlorocebus aethiops , Cricetulus , Epitopos , Feminino , Células HEK293 , Humanos , Masculino , Camundongos , Camundongos Transgênicos , Modelos Moleculares , Ligação Proteica , Estrutura Terciária de Proteína , SARS-CoV-2/imunologia , Células Vero
8.
Annu Rev Cell Dev Biol ; 38: 467-489, 2022 10 06.
Artigo em Inglês | MEDLINE | ID: mdl-35850150

RESUMO

Successful immune responses depend on the spatiotemporal coordination of immune cell migration, interactions, and effector functions in lymphoid and parenchymal tissues. Real-time intravital microscopy has revolutionized our understanding of the dynamic behavior of many immune cell types in the living tissues of several species. Observing immune cells in their native environment has revealed many unanticipated facets of their biology, which were not expected from experiments outside a living organism. Here we highlight both classic and more recent examples of surprising discoveries that critically relied on the use of live in vivo imaging. In particular, we focus on five major cell types of the innate immune response (macrophages, microglia, neutrophils, dendritic cells, and mast cells), and how studying their dynamics in mouse tissues has helped us advance our current knowledge of immune cell-mediated tissue homeostasis, host defense, and inflammation.


Assuntos
Imunidade Inata , Microscopia Intravital , Animais , Inflamação , Microscopia Intravital/métodos , Macrófagos , Camundongos
9.
Immunity ; 50(6): 1482-1497.e7, 2019 06 18.
Artigo em Inglês | MEDLINE | ID: mdl-31201094

RESUMO

The skin comprises tissue macrophages as the most abundant resident immune cell type. Their diverse tasks including resistance against invading pathogens, attraction of bypassing immune cells from vessels, and tissue repair require dynamic specification. Here, we delineated the postnatal development of dermal macrophages and their differentiation into subsets by adapting single-cell transcriptomics, fate mapping, and imaging. Thereby we identified a phenotypically and transcriptionally distinct subset of prenatally seeded dermal macrophages that self-maintained with very low postnatal exchange by hematopoietic stem cells. These macrophages specifically interacted with sensory nerves and surveilled and trimmed the myelin sheath. Overall, resident dermal macrophages contributed to axon sprouting after mechanical injury. In summary, our data show long-lasting functional specification of macrophages in the dermis that is driven by stepwise adaptation to guiding structures and ensures codevelopment of ontogenetically distinct cells within the same compartment.


Assuntos
Diferenciação Celular/imunologia , Vigilância Imunológica , Macrófagos/imunologia , Regeneração Nervosa , Pele/imunologia , Pele/inervação , Animais , Animais Recém-Nascidos , Biomarcadores , Receptor 1 de Quimiocina CX3C/metabolismo , Derme/citologia , Derme/imunologia , Derme/metabolismo , Imunofenotipagem , Macrófagos/metabolismo , Camundongos , Pele/citologia
10.
Nature ; 607(7918): 387-392, 2022 07.
Artigo em Inglês | MEDLINE | ID: mdl-35732733

RESUMO

The α-helix is pre-eminent in structural biology1 and widely exploited in protein folding2, design3 and engineering4. Although other helical peptide conformations do exist near to the α-helical region of conformational space-namely, 310-helices and π-helices5-these occur much less frequently in protein structures. Less favourable internal energies and reduced tendencies to pack into higher-order structures mean that 310-helices rarely exceed six residues in length in natural proteins, and that they tend not to form normal supersecondary, tertiary or quaternary interactions. Here we show that despite their absence in nature, synthetic peptide assemblies can be built from 310-helices. We report the rational design, solution-phase characterization and an X-ray crystal structure for water-soluble bundles of 310-helices with consolidated hydrophobic cores. The design uses six-residue repeats informed by analysing 310-helical conformations in known protein structures, and incorporates α-aminoisobutyric acid residues. Design iterations reveal a tipping point between α-helical and 310-helical folding, and identify features required for stabilizing assemblies of 310-helices. This work provides principles and rules to open opportunities for designing into this hitherto unexplored region of protein-structure space.


Assuntos
Peptídeos , Estrutura Secundária de Proteína , Cristalografia por Raios X , Desenho de Fármacos , Interações Hidrofóbicas e Hidrofílicas , Peptídeos/síntese química , Peptídeos/química , Dobramento de Proteína , Estabilidade Proteica
11.
Nature ; 604(7907): 740-748, 2022 04.
Artigo em Inglês | MEDLINE | ID: mdl-35444273

RESUMO

All tissue-resident macrophages of the central nervous system (CNS)-including parenchymal microglia, as well as CNS-associated macrophages (CAMs1) such as meningeal and perivascular macrophages2-7-are part of the CNS endogenous innate immune system that acts as the first line of defence during infections or trauma2,8-10. It has been suggested that microglia and all subsets of CAMs are derived from prenatal cellular sources in the yolk sac that were defined as early erythromyeloid progenitors11-15. However, the precise ontogenetic relationships, the underlying transcriptional programs and the molecular signals that drive the development of distinct CAM subsets in situ are poorly understood. Here we show, using fate-mapping systems, single-cell profiling and cell-specific mutants, that only meningeal macrophages and microglia share a common prenatal progenitor. By contrast, perivascular macrophages originate from perinatal meningeal macrophages only after birth in an integrin-dependent manner. The establishment of perivascular macrophages critically requires the presence of arterial vascular smooth muscle cells. Together, our data reveal a precisely timed process in distinct anatomical niches for the establishment of macrophage subsets in the CNS.


Assuntos
Linhagem da Célula , Sistema Nervoso Central , Macrófagos , Sistema Nervoso Central/imunologia , Feminino , Humanos , Imunidade Inata , Macrófagos/citologia , Microglia , Gravidez , Saco Vitelino
12.
Angew Chem Int Ed Engl ; 63(13): e202318863, 2024 03 22.
Artigo em Inglês | MEDLINE | ID: mdl-38271265

RESUMO

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.


Assuntos
Complexos de Coordenação , Compostos Organometálicos , Rutênio , Compostos Organometálicos/química , DNA/química , Oligonucleotídeos/química , Complexos de Coordenação/química , Temperatura , Rutênio/química
14.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Artigo em Inglês | MEDLINE | ID: mdl-35324198

RESUMO

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


Assuntos
Quadruplex G , Rutênio , Dicroísmo Circular , DNA/química , Humanos , Rutênio/química , Telômero/metabolismo
15.
Nature ; 531(7592): 64-9, 2016 Mar 03.
Artigo em Inglês | MEDLINE | ID: mdl-26901871

RESUMO

All Gram-negative bacteria, mitochondria and chloroplasts have outer membrane proteins (OMPs) that perform many fundamental biological processes. The OMPs in Gram-negative bacteria are inserted and folded into the outer membrane by the ß-barrel assembly machinery (BAM). The mechanism involved is poorly understood, owing to the absence of a structure of the entire BAM complex. Here we report two crystal structures of the Escherichia coli BAM complex in two distinct states: an inward-open state and a lateral-open state. Our structures reveal that the five polypeptide transport-associated domains of BamA form a ring architecture with four associated lipoproteins, BamB-BamE, in the periplasm. Our structural, functional studies and molecular dynamics simulations indicate that these subunits rotate with respect to the integral membrane ß-barrel of BamA to induce movement of the ß-strands of the barrel and promote insertion of the nascent OMP.


Assuntos
Proteínas da Membrana Bacteriana Externa/química , Proteínas da Membrana Bacteriana Externa/metabolismo , Proteínas de Escherichia coli/química , Proteínas de Escherichia coli/metabolismo , Escherichia coli/química , Complexos Multiproteicos/química , Complexos Multiproteicos/metabolismo , Cristalografia por Raios X , Lipoproteínas/química , Lipoproteínas/metabolismo , Modelos Moleculares , Simulação de Dinâmica Molecular , Movimento , Periplasma/metabolismo , Ligação Proteica , Estrutura Terciária de Proteína , Subunidades Proteicas/química , Subunidades Proteicas/metabolismo , Rotação
16.
Nature ; 525(7567): 140-3, 2015 Sep 03.
Artigo em Inglês | MEDLINE | ID: mdl-26308900

RESUMO

Methane-oxidizing bacteria (methanotrophs) require large quantities of copper for the membrane-bound (particulate) methane monooxygenase. Certain methanotrophs are also able to switch to using the iron-containing soluble methane monooxygenase to catalyse methane oxidation, with this switchover regulated by copper. Methane monooxygenases are nature's primary biological mechanism for suppressing atmospheric levels of methane, a potent greenhouse gas. Furthermore, methanotrophs and methane monooxygenases have enormous potential in bioremediation and for biotransformations producing bulk and fine chemicals, and in bioenergy, particularly considering increased methane availability from renewable sources and hydraulic fracturing of shale rock. Here we discover and characterize a novel copper storage protein (Csp1) from the methanotroph Methylosinus trichosporium OB3b that is exported from the cytosol, and stores copper for particulate methane monooxygenase. Csp1 is a tetramer of four-helix bundles with each monomer binding up to 13 Cu(I) ions in a previously unseen manner via mainly Cys residues that point into the core of the bundle. Csp1 is the first example of a protein that stores a metal within an established protein-folding motif. This work provides a detailed insight into how methanotrophs accumulate copper for the oxidation of methane. Understanding this process is essential if the wide-ranging biotechnological applications of methanotrophs are to be realized. Cytosolic homologues of Csp1 are present in diverse bacteria, thus challenging the dogma that such organisms do not use copper in this location.


Assuntos
Proteínas de Bactérias/química , Proteínas de Bactérias/metabolismo , Cobre/metabolismo , Metano/metabolismo , Methylosinus trichosporium/química , Motivos de Aminoácidos , Cristalografia por Raios X , Citosol/metabolismo , Metano/química , Methylosinus trichosporium/enzimologia , Modelos Moleculares , Oxirredução , Oxigenases/metabolismo , Dobramento de Proteína , Estrutura Secundária de Proteína
17.
Paediatr Anaesth ; 31(3): 309-315, 2021 03.
Artigo em Inglês | MEDLINE | ID: mdl-33222407

RESUMO

BACKGROUND: Liver transplantation is conducted with strict oversight of organizational structure and clinical practice. However, specific regulations pertaining to the delivery of anesthetic services are lacking and consideration of departmental structure and mechanisms for quality control must occur at a local level. Busy centers collect and process sufficient data to guide this process but those with low case loads may not generate enough data for useful analysis. In Australia and New Zealand, pediatric liver transplants are performed at only four locations. As these operations are not equally distributed geographically or temporally there are periods of low activity at some centers. As anesthesia affects patient outcome, quality assurance activities are important in this setting. AIMS: Provide a global overview of the structure and function of liver transplantation networks. Identify issues related to provision of pediatric anesthetic services with specific reference to Australasia. Examine anesthetic data from a single pediatric center to illustrate benefits and limitations of such activity. METHODS: Pediatric liver transplant centers from Australia and New Zealand were surveyed to determine the organizational and logistical issues related to a liver transplant service. An audit of 15 years of liver transplants from a single center was conducted for benchmarking purposes and to identify changes in anesthetic practice over time. RESULTS: Pediatric liver transplants performed in Queensland from January 2005 to December 2019 were reviewed. Changes in transfusion practice reflected international trends. Morbidity and mortality were comparable to international data. Important complications such as hepatic artery and portal vein thrombosis were uncommon and did not generate enough data for further analysis. CONCLUSIONS: Combining the anesthetic liver transplant data from all sites in a single registry would expand data collection and generate broadly applicable findings. We propose the establishment of an Australasian pediatric anesthetic liver transplant database.


Assuntos
Anestésicos , Transplante de Fígado , Australásia , Austrália , Criança , Humanos , Nova Zelândia
18.
Paediatr Anaesth ; 31(3): 323-329, 2021 03.
Artigo em Inglês | MEDLINE | ID: mdl-33280199

RESUMO

BACKGROUND: Barrier techniques, such as plastic sheets or intubation boxes, are purported to offer additional protection for healthcare workers. AIMS: To assess the functionality, perceived safety, droplet protection, and aerosol protection of several barrier techniques. METHODS: Firstly, a simulation study with 12 different laryngoscopists was conducted to assess the time taken to perform an intubation (via direct laryngoscopy, via video laryngoscopy, and via a bougie) with four different barrier techniques (personal protective equipment only, a plastic sheet, a tented plastic sheet, and an intubation box). Secondly, a cough at the time of intubation was simulated using ultraviolet dye to assess the spread of droplets; and thirdly, smoke was used to assess the spread of aerosols. RESULTS: Intubation time using the box was noninferior to using no barrier. Based on subjective ratings by the laryngoscopists, the most functional technique was no barrier followed by the intubation box, then the tented sheet, and then the plastic sheet. The technique that conferred the highest feeling of safety to the laryngoscopists was the intubation box, followed by the tented sheet, then no barrier, and then the plastic sheet. All the barriers prevented the ultraviolet dye contaminating the head and torso of the laryngoscopist. Smoke remained within the intubation box if plastics sheets were used to cover the openings and suction was ineffective at clearing it. With no barrier in place, smoke was effectively cleared away from the patient in a theater with laminar flow but tended to spread up toward the laryngoscopist in a room without laminar flow. CONCLUSIONS: A well-designed intubation box is an effective barrier against droplets and is noninferior to no barrier in relation to intubation time. However, a box interferes with laminar flow in theaters with formal ventilation systems and may result in accumulation of aerosols if it is completely enclosed.


Assuntos
Anestésicos , COVID-19 , Criança , Humanos , Transmissão de Doença Infecciosa do Paciente para o Profissional , Intubação Intratraqueal , SARS-CoV-2
19.
Br J Anaesth ; 125(5): 826-834, 2020 11.
Artigo em Inglês | MEDLINE | ID: mdl-32682554

RESUMO

BACKGROUND: We compared anaesthetists' ability to identify haemoglobin oxygen saturation (SpO2) levels using two auditory displays: one based on a standard pulse oximeter display (varying pitch plus alarm) and the other enhanced with additional sound properties (varying pitch plus tremolo and acoustic brightness) to differentiate SpO2 ranges. METHODS: In a counter-balanced crossover study in a simulator, 20 experienced anaesthetists supervised a junior colleague (an actor) managing two airway surgery scenarios: once while using the enhanced auditory display and once while using a standard auditory display. Participants were distracted with other tasks such as paperwork and workplace interruptions, but were required to identify when SpO2 transitioned between pre-set ranges (target, low, critical) and when other vital signs transitioned out of a target range. They also identified the range once a transition had occurred. Visual displays were available for all monitored vital signs, but the numerical value for SpO2 was excluded. RESULTS: Participants were more accurate and faster at detecting transitions to and from the target SpO2 range when using the enhanced display (100.0%, 3.3 s) than when using the standard display plus alarm (73.2%, 27.4 s) (P<0.001 and P=0.004, respectively). They were also more accurate at identifying the SpO2 range once a transition had occurred when using the enhanced display (100.0%) than when using the standard display plus alarm (57.1%; P<0.001). CONCLUSIONS: The enhanced auditory display helps anaesthetists judge SpO2 levels more effectively than current auditory displays and may facilitate 'eyes-free' monitoring.


Assuntos
Apresentação de Dados , Oximetria/instrumentação , Estimulação Acústica , Adulto , Anestesiologistas , Alarmes Clínicos , Estudos Cross-Over , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Salas Cirúrgicas/organização & administração , Oxigênio/sangue , Inquéritos e Questionários , Sinais Vitais
20.
Nature ; 511(7507): 52-6, 2014 Jul 03.
Artigo em Inglês | MEDLINE | ID: mdl-24990744

RESUMO

Lipopolysaccharide (LPS) is essential for most Gram-negative bacteria and has crucial roles in protection of the bacteria from harsh environments and toxic compounds, including antibiotics. Seven LPS transport proteins (that is, LptA-LptG) form a trans-envelope protein complex responsible for the transport of LPS from the inner membrane to the outer membrane, the mechanism for which is poorly understood. Here we report the first crystal structure of the unique integral membrane LPS translocon LptD-LptE complex. LptD forms a novel 26-stranded ß-barrel, which is to our knowledge the largest ß-barrel reported so far. LptE adopts a roll-like structure located inside the barrel of LptD to form an unprecedented two-protein 'barrel and plug' architecture. The structure, molecular dynamics simulations and functional assays suggest that the hydrophilic O-antigen and the core oligosaccharide of the LPS may pass through the barrel and the lipid A of the LPS may be inserted into the outer leaflet of the outer membrane through a lateral opening between strands ß1 and ß26 of LptD. These findings not only help us to understand important aspects of bacterial outer membrane biogenesis, but also have significant potential for the development of novel drugs against multi-drug resistant pathogenic bacteria.


Assuntos
Proteínas da Membrana Bacteriana Externa/química , Proteínas da Membrana Bacteriana Externa/metabolismo , Lipopolissacarídeos/metabolismo , Complexos Multiproteicos/química , Complexos Multiproteicos/metabolismo , Salmonella typhimurium/química , Membrana Celular/química , Membrana Celular/metabolismo , Parede Celular/química , Parede Celular/metabolismo , Cristalografia por Raios X , Lipopolissacarídeos/química , Modelos Moleculares , Ligação Proteica , Estrutura Secundária de Proteína , Salmonella typhimurium/citologia , Relação Estrutura-Atividade
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA