Development and evaluation of genomics informed real-time PCR assays for the detection and strain typing of Mycobacterium avium subsp. paratuberculosis.

AIMS: This study aimed to identify specific genomic targets for the detection and strain typing of Map and analyse their sensitivity and specificity, and detect Map directly from faeces. METHODS AND RESULTS: A comparative genomics approach was used to identify specific genomic targets for the detection and strain typing of Map. A Map specific qPCR using the primer pair 7132 that targets a DNA segregation ATPase protein was able to detect all strains of Map and is more sensitive than the current Johne's disease PCR assays with a sensitivity of 0.0002 fg µl-1. A strain specific qPCR using the Atsa primer pair that targets the arylsulfase gene was able to differentiate between Type S and Type C strains of Map and was more sensitive than the IS1311 PCR and REA with a sensitivity of 40 fg µl-1 and was specific for Type S Map. Both assays successfully detected Map directly from faeces. CONCLUSION: This study developed and validated two genomics informed qPCR assays, 7132B Map and Atsa Type S and found both assays to be highly specific and sensitive for the detection of Map from culture and directly from faeces. This is the first time that a probe-based qPCR has been designed and developed for Map strain typing, which will greatly improve the response time during outbreak investigations.

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

The pan-genome of Mycobacterium avium subsp. paratuberculosis (Map) confirms ancestral lineage and reveals gene rearrangements within Map Type S.

BACKGROUND: To date genomic studies on Map have concentrated on Type C strains with only a few Type S strains included for comparison. In this study the entire pan-genome of 261 Map genomes (205 Type C, 52 Type S and 4 Type B) and 7 Mycobacterium avium complex (Mac) genomes were analysed to identify genomic similarities and differences between the strains and provide more insight into the evolutionary relationship within this Mycobacterial species. RESULTS: Our analysis of the core genome of all the Map isolates identified two distinct lineages, Type S and Type C Map that is consistent with previous phylogenetic studies of Map. Pan-genome analysis revealed that Map has a larger accessory genome than Mycobacterium avium subsp. avium (Maa) and Type C Map has a larger accessory genome than Type S Map. In addition, we found large rearrangements within Type S strains of Map and little to none in Type C and Type B strains. There were 50 core genes identified that were unique to Type S Map and there were no unique core genes identified between Type B and Type C Map strains. In Type C Map we identified an additional CE10 CAZyme class which was identified as an alpha/beta hydrolase and an additional polyketide and non-ribosomal peptide synthetase cluster. Consistent with previous analysis no plasmids and only incomplete prophages were identified in the genomes of Map. There were 45 hypothetical CRISPR elements identified with no associated cas genes. CONCLUSION: This is the most comprehensive comparison of the genomic content of Map isolates to date and included the closing of eight Map genomes. The analysis revealed that there is greater variation in gene synteny within Type S strains when compared to Type C indicating that the Type C Map strain emerged after Type S. Further analysis of Type C and Type B genomes revealed that they are structurally similar with little to no genetic variation and that Type B Map may be a distinct clade within Type C Map and not a different strain type of Map. The evolutionary lineage of Maa and Map was confirmed as emerging after M. hominissuis.

The genetic variability of grapevine Pinot gris virus (GPGV) in Australia.

Grapevine Pinot gris virus (GPGV; genus Trichovirus in the family Betaflexiviridae) was detected in Australia in 2016, but its impact on the production of nursery material and fruit in Australia is still currently unknown. This study investigated the prevalence and genetic diversity of GPGV in Australia. GPGV was detected by reverse transcription-polymerase chain reaction (RT-PCR) in a range of rootstock, table and wine grape varieties from New South Wales, South Australia, and Victoria, with 473/2171 (21.8%) samples found to be infected. Genomes of 32 Australian GPGV isolates were sequenced and many of the isolates shared high nucleotide homology. Phylogenetic and haplotype analyses demonstrated that there were four distinct clades amongst the 32 Australian GPGV isolates and that there were likely to have been at least five separate introductions of the virus into Australia. Recombination and haplotype analysis indicate the emergence of new GPGV strains after introduction into Australia. When compared with 168 overseas GPGV isolates, the analyses suggest that the most likely origin of Australian GPGV isolates is from Europe. There was no correlation between specific GPGV genotypes and symptoms such as leaf mottling, leaf deformation, and shoot stunting, which were observed in some vineyards, and the virus was frequently found in symptomless grapevines.

The observation of taxonomic boundaries for the 16SrII and 16SrXXV phytoplasmas using genome-based delimitation.

Within the 16SrII phytoplasma group, subgroups A-X have been classified based on restriction fragment length polymorphism of their 16S rRNA gene, and two species have been described, namely 'Candidatus Phytoplasma aurantifolia' and 'Ca. Phytoplasma australasia'. Strains of 16SrII phytoplasmas are detected across a broad geographic range within Africa, Asia, Australia, Europe and North and South America. Historically, all members of the 16SrII group share ≥97.5 % nucleotide sequence identity of their 16S rRNA gene. In this study, we used whole genome sequences to identify the species boundaries within the 16SrII group. Whole genome analyses were done using 42 phytoplasma strains classified into seven 16SrII subgroups, five 16SrII taxa without official 16Sr subgroup classifications, and one 16SrXXV-A phytoplasma strain used as an outgroup taxon. Based on phylogenomic analyses as well as whole genome average nucleotide and average amino acid identity (ANI and AAI), eight distinct 16SrII taxa equivalent to species were identified, six of which are novel descriptions. Strains within the same species had ANI and AAI values of >97 %, and shared ≥80 % of their genomic segments based on the ANI analysis. Species also had distinct biological and/or ecological features. A 16SrII subgroup often represented a distinct species, e.g., the 16SrII-B subgroup members. Members classified within the 16SrII-A, 16SrII-D, and 16SrII-V subgroups as well as strains classified as sweet potato little leaf phytoplasmas fulfilled criteria to be included as members of a single species, but with subspecies-level relationships with each other. The 16SrXXV-A taxon was also described as a novel phytoplasma species and, based on criteria used for other bacterial families, provided evidence that it could be classified as a distinct genus from the 16SrII phytoplasmas. As more phytoplasma genome sequences become available, the classification system of these bacteria can be further refined at the genus, species, and subspecies taxonomic ranks.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Comparative genomics and genomic diversity of Pseudomonas syringae clade 2b-a in Australia.

BACKGROUND: A zucchini disease outbreak with unusual symptoms associated with Pseudomonas syringae clade 2b was identified in Bundaberg, Australia during autumn 2016. To investigate the genetic diversity of the 11 Australian isolates obtained from the outbreak, the genomes were compared to the publicly available P. syringae strains in phylogroup 2. RESULTS: Average nucleotide identity refined the P. syringae clade 2b-a into four clusters (Cluster A, B, C1 and C2), an expansion from the previously identified A, B and C. Australian isolates were in Cluster A, C1 and C2. Genomic analyses highlighted several key factors that may contribute to the virulence of these isolates. Six orthologous groups, including three virulence factors, were associated with P. syringae phylogroup 2 cucurbit-infecting strains. A region of genome plasticity analysis identified a type VI secretion system pathway in clade 2b-a strains which could also contribute to virulence. Pathogenicity assays on isolates KL004-k1, KFR003-1 and 77-4C, as representative isolates of Cluster A, C1 and C2, respectively, determined that all three isolates can infect pumpkin, squash, watermelon and zucchini var. Eva with different levels of disease severity. Subsequently, type III effectors were investigated and four type III effectors (avrRpt2, hopZ5, hopC1 and hopH1) were associated with host range. The hopZ effector family was also predicted to be associated with disease severity. CONCLUSIONS: This study refined the taxonomy of the P. syringae clade 2b-a, supported the association between effector profile and pathogenicity in cucurbits established in a previous study and provides new insight into important genomic features of these strains. This study also provided a detailed and comprehensive resource for future genomic and functional studies of these strains.

Characterization of Pseudomonas syringae Isolated from Systemic Infection of Zucchini in Australia.

Zucchini plants with symptoms including twisted petioles, necrotic leaves, crown rot, and internal fruit rot were found in Bundaberg, Australia, at a commercial field for the first time during late autumn 2016, resulting in direct yield losses of 70 to 80%. Three Pseudomonas syringae strains isolated from symptomatic leaf (KL004-k1), crown (77-4C), and fruit (KFR003-1) were characterized and their pathogenicity evaluated on pumpkin, rockmelon, squash, and zucchini. Biochemical assays showed typical results for P. syringae. The three isolates differed, however, in that two produced fluorescent pigment (KFR003-1 and 77-4C) whereas the third, KL004-k1, was nonfluorescent. Multilocus sequence analysis classified the isolates to phylogroup 2b. The single-nucleotide polymorphism analysis of core genome from the Australian and closely related international isolates of P. syringae showed two separate clusters. The Australian isolates were clustered based on fluorescent phenotype. Pathogenicity tests demonstrated that all three isolates moved systemically within the inoculated plants and induced necrotic leaf symptoms in zucchini plants. Their identities were confirmed with specific PCR assays for P. syringae and phylogroup 2. Pathogenicity experiments also showed that the Eva variety of zucchini was more susceptible than the Rosa variety for all three isolates. Isolate KL004-k1 was more virulent than 77-4C on pumpkin, rockmelon, squash, and zucchini. This study expands the knowledge of P. syringae isolates that infect cucurbits and provides useful information for growers about the relative susceptibility of a range of cucurbit species.

First report of ryegrass cyst nematode, Heterodera mani, in Tasmania, Australia.

Cyst nematodes of the genus Heterodera are a major group of sedentary plant parasites causing a significant economic impact, restricting production and market access globally (Moens et al. 2018). The ryegrass cyst nematode Heterodera mani is in the Avenae group and is found predominantly in pastures and grasslands in Europe, California, and South Africa. It was first described by Mathews (1971) from Northern Ireland. Known hosts are grasses (family Poaceae), principally Lolium perenne (perennial ryegrass), but also Dactylis glomerata (cat grass) and Festuca pratensis (meadow fescue) (Subbotin et al. 2010). Mowat (1974) reported that H. mani causes negligible damage to the yield of L. perenne in pot trials; however, Maas & Brinkman (1982) determined that it may cause significant damage to spring and autumn-sown perennial ryegrass in field conditions. During a routine examination for potato cyst nematode from a farm near Mawbanna in north-west Tasmania, Australia, several pale to dark brown Heterodera cysts were extracted that were lemon shaped with the presence of a small vulval cone at the posterior end and a distinct neck. The J2 (n=20) stylet length ranged from 24-26 µm with round knobs deeply concave anteriorly, hyaline tail length was 37-42 µm, true tail length ranged from 59-68 µm and total body length varied from 526-559 µm. All the above characters match those described for H. mani (Subbotin et al. 2010). To verify this identification, DNA was extracted from five individual J2 juveniles from a single cyst using QIAamp DNA micro kit (Qiagen®), and two gene regions amplified: internal transcribed spacer region of ribosomal RNA (ITS-rRNA) with primer pair AB28 and TW81 and cytochrome oxidase 1 (CO1) with primer pair JB3 and JB5 (Bowles et al. 1992; Curran et al. 1994; Derycke et al. 2005). One PCR reaction contained 10 µM (1 µl each) of each primer, 12.5 µl of OneTaq® DNA Polymerase and 5 µl of DNA template with a final volume of 25 µl. PCR products were sent for purification and Sanger sequencing at Macrogen (Seoul, Rep. of Korea). All resulting sequences were trimmed, aligned, and analysed using Geneious Prime® 2022.0.1 (www.geneious.com). Five ITS sequences (accessions ON402852-ON402856) and five CO1 sequences (accessions ON402857-ON402861) were submitted to GenBank. These ITS sequences were very similar to each other and exhibited 99.16-100% similarity with that of H. mani isolate from Hamminkeln, Germany (AY148377) (Subbotin et al. 2018). The CO1 sequences exhibited 98.96-100% similarity with that of H. mani isolate from Washington, USA (MG523097) (Subbotin et al. 2003). Obtained sequences were mapped to reference sequences downloaded from NCBI GenBank and maximum likelihood phylogenetic trees were calculated. Due to the lack of further living nematode material, pot experiments were not performed. Such experiments are not feasible in Tasmania currently and transfer of live nematode material to the Australian mainland presents logistic and legal issues. However, morphological and molecular evidence for species determination of H. mani was unequivocal and contributes to the list of cyst nematode species present in Australia. This is the first detection of H. mani in Australia and is a range extension of the species from North America, Africa, and Europe to Australia. The nematode may cause damage to perennial ryegrass in Australia, however, impact on yield still needs to be investigated.

Molecular characterisation of Mycobacterium avium subsp. paratuberculosis in Australia.

BACKGROUND: Mycobacterium avium subsp. paratuberculosis (Map) causes Johne's disease (JD), a chronic enteritis widespread in ruminants, resulting in substantial economic losses, especially to the dairy industry. Understanding the genetic diversity of Map in Australia will assist epidemiological studies for tracking disease transmission and identify subtype characteristics for use in development of improved diagnostic typing methods. Here we investigated the phylogenetic relationships of 351 Map isolates and compared different subtyping methods to assess their suitability for use in diagnostics and accuracy. RESULTS: SNP-based phylogenetic analysis of 228 Australian isolates and 123 publicly available international isolates grouped Type S and Type C strains into two distinct lineages. Type C strains were highly monomorphic with only 20 SNP differences separating them. Type S strains, when aligned separately to the Telford strain, fell into two distinct clades: The first clade contained seven international isolates while the second clade contained one international isolate from Scotland and all 59 Australian isolates. The Australian Type B strain clustered with US bison strains. IS1311 PCR and Restriction Enzyme Analysis (REA) intermittently generated incorrect results when compared to Long Sequence Polymorphism (LSP) analysis, whole genome SNP-based phylogenetic analysis, IS1311 sequence alignment and average nucleotide identity (ANI). These alternative methods generated consistent Map typing results. A published SNP based assay for genotyping Map was found to be unsuitable for differentiating between Australian and international strain types of Map. CONCLUSION: This is the first phylogenetic analysis of Australian Map isolates. The Type C lineage was highly monomorphic, and the Type S lineage clustered all Australian isolates into one clade with a single Scottish sheep strain. The Australian isolate classified as Type B by IS1311 PCR and REA is likely to be descended from bison and most closely related to US bison strains. Limitations of the current typing methods were identified in this study.

'Candidatus Phytoplasma stylosanthis', a novel taxon with a diverse host range in Australia, characterised using multilocus sequence analysis of 16S rRNA, secA, tuf, and rp genes.

In Australia, Stylosanthes little leaf (StLL) phytoplasma has been detected in Stylosanthes scabra Vogel, Arachis pintoi Krapov, Saccharum officinarum L., Carica papaya L., Medicago sativa L., and Solanum tuberosum L. The 16S rRNA gene sequence of StLL phytoplasma strains from S. scabra, C. papaya, S. officinarum and S. tuberosum were compared and share 99.93-100 % nucleotide sequence identity. Phylogenetic comparisons between the 16S rRNA genes of StLL phytoplasma and other 'Candidatus Phytoplasma' species indicate that StLL represents a distinct phytoplasma lineage. It shares its most recent known ancestry with 'Ca. Phytoplasma luffae' (16SrVIII-A), with which it has 97.17-97.25 % nucleotide identity. In silico RFLP analysis of the 16S rRNA amplicon using iPhyClassifier indicate that StLL phytoplasmas have a unique pattern (similarity coefficient below 0.85) that is most similar to that of 'Ca. Phytoplasma luffae'. The unique in silico RFLP patterns were confirmed in vitro. Nucleotide sequences of genes that are more variable than the 16S rRNA gene, namely tuf (tu-elongation factor), secA (partial translocation gene), and the partial ribosomal protein (rp) gene operon (rps19-rpl22-rps3), produced phylogenetic trees with similar branching patterns to the 16S rRNA gene tree. Sequence comparisons between the StLL 16S rRNA spacer region confirmed previous reports of rrn interoperon sequence heterogeneity for StLL, where the spacer region of rrnB encodes a complete tRNA-Isoleucine gene and the rrnA spacer region does not. Together these results suggest that the Australian phytoplasma, StLL, is unique according to the International Organization for Mycoplasmology (IRPCM) recommendations. The novel taxon 'Ca. Phytoplasma stylosanthis' is proposed, with the most recent strain from a potato crop in Victoria, Australia, serving as the reference strain (deposited in the Victorian Plant Pathology Herbarium as VPRI 43683).

Genetic diversity and recombination between turnip yellows virus strains in Australia.

Disease outbreaks caused by turnip yellows virus (TuYV), a member of the genus Polerovirus, family Luteoviridae, regularly occur in canola and pulse crops throughout Australia. To understand the genetic diversity of TuYV for resistance breeding and management, genome sequences of 28 TuYV isolates from different hosts and locations were determined using high-throughput sequencing (HTS). We aimed to identify the parts of the genome that were most variable and clarify the taxonomy of viruses related to TuYV. Poleroviruses contain seven open reading frames (ORFs): ORF 0-2, 3a, and 3-5. Phylogenetic analysis based on the genome sequences, including isolates of TuYV and brassica yellows virus (BrYV) from the GenBank database, showed that most genetic variation among isolates occurred in ORF 5, followed by ORF 0 and ORF 3a. Phylogenetic analysis of ORF 5 revealed three TuYV groups; P5 group 1 and group 3 shared 45-49% amino acid sequence identity, and group 2 is a recombinant between the other two. Phylogenomic analysis of the concatenated ORFs showed that TuYV is paraphyletic with respect to BrYV, and together these taxa form a well-supported monophyletic group. Our results support the hypothesis that TuYV and BrYV belong to the same species and that the phylogenetic topologies of ORF 0, 3a and 5 are incongruent and may not be informative for species demarcation. A number of beet western yellow virus (BWYV)- and TuYV-associated RNAs (aRNA) were also identified by HTS for the first time in Australia.

Genome Analysis of Melon Necrotic Spot Virus Incursions and Seed Interceptions in Australia.

Melon necrotic spot virus (MNSV) was detected in field-grown Cucumis melo (rockmelon) and Citrullus lanatus (watermelon) plants in the Sunraysia district of New South Wales and Victoria, Australia, in 2012, 2013, and 2016, and in two watermelon seed lots tested at the Australian border in 2016. High-throughput sequencing was used to generate near full-length genomes of six isolates detected during the incursions and seed testing. Phylogenetic analysis of the genomes suggests that there have been at least two incursions of MNSV into Australia and none of the field isolates were the same as the isolates detected in seeds. The analysis indicated that one watermelon field sample (L10), the Victorian rockmelon field sample, and two seed interception samples may have European origins. The results showed that two isolates (L8 and L9) from watermelon were divergent from the type MNSV strain (MNSV-GA, D12536.2) and had 99% nucleotide identity to two MNSV isolates from human stool collected in the United States (KY124135.1, KY124136.1). These isolates also had high nucleotide pairwise identity (96%) to a partial sequence from a Spanish MNSV isolate (KT962848.1). The analysis supported the identification of three previously described MNSV genotype groups: EU-LA, Japan melon, and Japan watermelon. To account for the greater diversity of hosts and geographic regions of the MNSV isolates used in this study, it is suggested that the genotype groups EU-LA, Japan melon, and Japan watermelon be renamed to groups I, II, and III, respectively. The divergent isolates L8 and L9 from this study and the stool isolates from the United States formed a fourth genotype group, group IV. Soil collected from the site of the Victorian rockmelon MNSV outbreak was found to contain viable MNSV and the virus vector, a chytrid fungus, Olpidium bornovanus (Sahtiyanci) Karling, 18 months after the initial MNSV detection. This is a first report of O. bornovanus from soil sampled from an MNSV-contaminated site in Australia.

Effects of a Potato Spindle Tuber Viroid Tomato Strain on the Symptoms, Biomass, and Yields of Classical Indicator and Currently Grown Potato and Tomato Cultivars.

The Chittering strain of potato spindle tuber viroid (PSTVd) infects solanaceous crops and wild plants in the subtropical Gascoyne Horticultural District of Western Australia. Classical PSTVd indicator hosts tomato cultivar Rutgers (R) and potato cultivar Russet Burbank (RB) and currently widely grown tomato cultivars Petula (P) and Swanson (S) and potato cultivars Nadine (N) and Atlantic (A) were inoculated with this strain to study its pathogenicity, quantify fruit or tuber yield losses, and establish whether tomato strains might threaten potato production. In potato foliage, infection caused spindly stems, an upright growth habit, leaves with ruffled margins and reduced size, and upward rolling and twisting of terminal leaflets (RB, A, and N); axillary shoot proliferation (A); severe plant stunting (N and RB); and necrotic spotting of petioles and stems (RB). Tubers from infected plants were tiny (N) or small and "spindle shaped" with (A) or without (RB) cracking. Potato foliage dry weight biomass was decreased by 30 to 44% in A and RB and 37% in N, whereas tuber yield was diminished by 50 to 89% in A, 69 to 71% in RB, and 90% in N. In tomato foliage, infection caused epinasty and rugosity in apical leaves, leaf chlorosis, and plant stunting (S, P, and N); cupped leaves (S and P); and reduced leaf size, flower abortion, and necrosis of midribs, petioles, and stems (R). Mean tomato fruit size was greatly decreased in all three cultivars. Tomato foliage dry weight biomass was diminished by 40 to 53% (P), 42% (S), and 37 to 51% (R). Tomato fruit yield was decreased by 60 to 76% (P), 52% (S), and 64 to 89% (R), respectively. Thus, the tomato strain studied was highly pathogenic to classical indicator and representative current tomato and potato cultivars, causing major losses in fruit and tuber yields. Tomato PSTVd strains, therefore, pose a threat to tomato and potato industries worldwide.

Prevalence and Incidence of Yellow Dwarf Viruses Across a Climatic Gradient: A Four-Year Field Study in Southeastern Australia.

Yellow dwarf viruses (YDVs) form a complex of economically important pathogens that affect cereal production worldwide, reducing yield and quality. The prevalence and incidence of YDVs including barley yellow dwarf viruses (BYDV-PAV and BYDV-MAV) and cereal yellow dwarf virus (CYDV-RPV) in cereal fields in Victoria, Australia were measured. As temperature decreases and rainfall increases from north to south in Victoria, fields in three geographical regions were evaluated to determine potential differences in virus prevalence and incidence across the weather gradient. Cereal samples randomly collected from each field during spring for four consecutive years (2014-2017) were tested for BYDV-PAV, BYDV-MAV, and CYDV-RPV using tissue blot immunoassay. BYDV-PAV was the most prevalent YDV species overall and had the highest overall mean incidence. Higher temperature and lower rainfall were associated with reduced prevalence and incidence of YDVs as the northern region, which is hotter and drier, had a 17-fold decrease in virus incidence compared with the cooler and wetter regions. Considerable year-to-year variation in virus prevalence and incidence was observed. This study improves our understanding of virus epidemiology, which will aid the development of more targeted control measures and predictive models. It also highlights the need to monitor for YDVs and their vectors over multiple years to assess the level of risk and to make more informed and appropriate disease management decisions.

Biosecurity implications of new technology and discovery in plant virus research.

Human activity is causing new encounters between viruses and plants. Anthropogenic interventions include changing land use, decreasing biodiversity, trade, the introduction of new plant and vector species to native landscapes, and changing atmospheric and climatic conditions. The discovery of thousands of new viruses, especially those associated with healthy-appearing native plants, is shifting the paradigm for their role within the ecosystem from foe to friend. The cost of new plant virus incursions can be high and result in the loss of trade and/or production for short or extended periods. We present and justify three recommendations for plant biosecurity to improve communication about plant viruses, assist with the identification of viruses and their impacts, and protect the high economic, social, environmental, and cultural value of our respective nations' unique flora: 1) As part of the burden of proof, countries and jurisdictions should identify what pests already exist in, and which pests pose a risk to, their native flora; 2) Plant virus sequences not associated with a recognized virus infection are designated as "uncultured virus" and tentatively named using the host plant species of greatest known prevalence, the word "virus," a general location identifier, and a serial number; and 3) Invest in basic research to determine the ecology of known and new viruses with existing and potential new plant hosts and vectors and develop host-virus pathogenicity prediction tools. These recommendations have implications for researchers, risk analysts, biosecurity authorities, and policy makers at both a national and an international level.

Virus disease in wheat predicted to increase with a changing climate.

Current atmospheric CO2 levels are about 400 µmol mol(-1) and are predicted to rise to 650 µmol mol(-1) later this century. Although the positive and negative impacts of CO2 on plants are well documented, little is known about interactions with pests and diseases. If disease severity increases under future environmental conditions, then it becomes imperative to understand the impacts of pathogens on crop production in order to minimize crop losses and maximize food production. Barley yellow dwarf virus (BYDV) adversely affects the yield and quality of economically important crops including wheat, barley and oats. It is transmitted by numerous aphid species and causes a serious disease of cereal crops worldwide. This study examined the effects of ambient (aCO2 ; 400 µmol mol(-1) ) and elevated CO2 (eCO2 ; 650 µmol mol(-1) ) on noninfected and BYDV-infected wheat. Using a RT-qPCR technique, we measured virus titre from aCO2 and eCO2 treatments. BYDV titre increased significantly by 36.8% in leaves of wheat grown under eCO2 conditions compared to aCO2 . Plant growth parameters including height, tiller number, leaf area and biomass were generally higher in plants exposed to higher CO2 levels but increased growth did not explain the increase in BYDV titre in these plants. High virus titre in plants has been shown to have a significant negative effect on plant yield and causes earlier and more pronounced symptom expression increasing the probability of virus spread by insects. The combination of these factors could negatively impact food production in Australia and worldwide under future climate conditions. This is the first quantitative evidence that BYDV titre increases in plants grown under elevated CO2 levels.

A metagenomic investigation of phytoplasma diversity in Australian vegetable growing regions.

In this study, metagenomic sequence data was used to investigate the phytoplasma taxonomic diversity in vegetable-growing regions across Australia. Metagenomic sequencing was performed on 195 phytoplasma-positive samples, originating either from historic collections (n=46) or during collection efforts between January 2015 and June 2022 (n=149). The sampled hosts were classified as crop (n=155), weed (n=24), ornamental (n=7), native plant (n=6), and insect (n=3) species. Most samples came from Queensland (n=78), followed by Western Australia (n=46), the Northern Territory (n=32), New South Wales (n=17), and Victoria (n=10). Of the 195 draft phytoplasma genomes, 178 met our genome criteria for comparison using an average nucleotide identity approach. Ten distinct phytoplasma species were identified and could be classified within the 16SrII, 16SrXII (PCR only), 16SrXXV, and 16SrXXXVIII phytoplasma groups, which have all previously been recorded in Australia. The most commonly detected phytoplasma taxa in this study were species and subspecies classified within the 16SrII group (n=153), followed by strains within the 16SrXXXVIII group ('Ca. Phytoplasma stylosanthis'; n=6). Several geographic- and host-range expansions were reported, as well as mixed phytoplasma infections of 16SrII taxa and 'Ca. Phytoplasma stylosanthis'. Additionally, six previously unrecorded 16SrII taxa were identified, including five putative subspecies of 'Ca. Phytoplasma australasiaticum' and a new putative 16SrII species. PCR and sequencing of the 16S rRNA gene was a suitable triage tool for preliminary phytoplasma detection. Metagenomic sequencing, however, allowed for higher-resolution identification of the phytoplasmas, including mixed infections, than was afforded by only direct Sanger sequencing of the 16S rRNA gene. Since the metagenomic approach theoretically obtains sequences of all organisms in a sample, this approach was useful to confirm the host family, genus, and/or species. In addition to improving our understanding of the phytoplasma species that affect crop production in Australia, the study also significantly expands the genomic sequence data available in public sequence repositories to contribute to phytoplasma molecular epidemiology studies, revision of taxonomy, and improved diagnostics.

Hybrid RNA sequencing of broad bean wilt virus 2 from faba beans.

IMPORTANCE: Globally, viral diseases impair the growth and vigor of cultivated crops such as grains, leading to a significant reduction in quality, marketability, and competitiveness. As an island nation, Australia has a distinct advantage in using its border to prevent the introduction of damaging viruses, which threaten the continental agricultural sector. However, breeding programs in Australia rely on imported seeds as new sources of genetic diversity. As such, it is critical to remain vigilant in identifying new and emerging viral pathogens, by ensuring the availability of accurate genomic diagnostic tools at the grain biosecurity border. High-throughput sequencing offers game-changing opportunities in biosecurity routine testing. Genomic results are more accurate and informative compared to traditional molecular methods or biological indexing. The present work contributes to strengthening accurate phytosanitary screening, to safeguard the Australian grains industry, and expedite germplasm release to the end users.

LAMP assay for the detection of the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psylloidea: Psyllidae).

Diaphorina citri Kuwayama, also known as the Asian citrus psyllid (ACP), can vector the bacterium Candidatus Liberibacter asiaticus (CLas), agent of Huanglongbing (HLB): an incurable disease affecting citrus trees worldwide. In citrus growing regions where ACP and HLB are absent, such as Australia, the risk of an incursion and consequent economic damage to citrus industries make this psyllid one of the top-priority pests. Due to ACP's small dimensions and the generally poorly studied native psylloid fauna worldwide, morphological identification of this insect to distinguish it from harmless species is challenging, especially in the field, and with immature, partial or damaged specimens. To allow rapid and efficient detection of ACP in the field, we designed and optimised a new Loop-mediated isothermal amplification (LAMP) assay for the detection of D. citri based on the mitochondrial 16S locus. The optimised ACP 16S LAMP assay produced amplification from D. citri samples within 13.3 ± 3.6 min, with an anneal derivative of ~ 78.5 °C. A synthetic gBlock gene fragment was also developed to be used as positive control for the new LAMP assay with a different anneal derivative of ~ 83 °C. An existing commercially available LAMP assay for detection of the bacterium CLas was also tested in this study on ACP DNA. The ACP 16S LAMP assay we developed and tested here provides a valuable new in-field compatible tool that can allow early detections of ACP, enabling a quick biosecurity response, and could potentially be adopted by a wide range of users, from farmers to agronomists and from researchers to industry.