New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Next-generation sequencing panel analysis in 24 Chinese patients with congenital ectopia lentis.

BACKGROUND: Congenital ectopia lentis (CEL) is a rare but serious disease. We use next-generation sequencing to detect genes associated with lens abnormalities in 24 patients with bilateral CEL and search for pathogenic genes and mutation sites. MATERIALS AND METHODS: A total of 24 patients diagnosed with CEL from January 2019 to November 2019 were enrolled in this study, and their clinical data were collected and genome-wide deoxyribonucleic acid was extracted from peripheral venous blood. Targeted gene capture technology was used to obtain 188 exons of lens abnormality-related genes, which were sequenced using a high-throughput method. The mutation sites were determined through data analysis and verified by the Sanger method. According to the data from previous studies, the association between the genotype and clinical phenotype was analysed. RESULT: Of the 24 patients, 23 had mutations in the fibrillin-1 (FBN1) gene, and 20 were diagnosed with Marfan syndrome. The 23 cases of FBN1 mutations were all heterozygous mutations, including 17 missense mutations, 3 splicing variants, 2 exon deletion mutations, 1 codon mutation, and 9 new mutations. A total of 17 mutations were located in the calcium-binding epidermal growth factor domain, including 16 mutations that contained missense mutations of cysteine. In addition, a heterozygous mutation of the gap junction protein alpha 8 (GJA8) gene was detected in one patient. CONCLUSION: In this study, we identified 23 FBN1 gene mutations and 1 GJA8 gene mutation in 24 patients with CEL. Of these, 9 new FBN1 mutations and 14 known mutations were found. The results expanded the mutation spectrum of the FBN1 gene, suggesting that FBN1 mutation may be the main cause of CEL in Chinese patients.

PRPF4 mutations cause autosomal dominant retinitis pigmentosa.

Retinitis pigmentosa (RP), a disease characterized by progressive loss of photoreceptors, exhibits significant genetic heterogeneity. Several genes associated with U4/U6-U5 triple small nuclear ribonucleoprotein (tri-snRNP) complex of the spliceosome have been implicated in autosomal dominant RP (adRP). HPrp4, encoded by PRPF4, regulates the stability of U4/U6 di-snRNP, which is essential for continuous splicing. Here, we identified two heterozygous variants in PRPF4, including c.-114_-97del in a simplex RP patient and c.C944T (p.Pro315Leu), which co-segregates with disease phenotype in a family with adRP. Both variants were absent in 400 unrelated controls. The c.-114_-97del, predicted to affect two transcription factor binding sites, was shown to down-regulate the promoter activity of PRPF4 by a luciferase assay, and was associated with a significant reduction of PRPF4 expression in the blood cells of the patient. In fibroblasts from an affected individual with the p.Pro315Leu variant, the expression levels of several tri-snRNP components, including PRPF4 itself, were up-regulated, with altered expression pattern of SC35, a spliceosome marker. The same alterations were also observed in cells over expressing hPrp4(Pro315Leu), suggesting that they arose as a compensatory response to a compromised splicing mechanism caused by hPrp4 dysfunction. Further, over expression of hPrp4(Pro315Leu), but not hPrp4(WT), triggered systemic deformities in wild-type zebrafish embryos with the retina primarily affected, and dramatically augmented death rates in morphant embryos, in which orthologous zebrafish prpf4 gene was silenced. We conclude that mutations of PRPF4 cause RP via haploinsufficiency and dominant-negative effects, and establish PRPF4 as a new U4/U6-U5 snRNP component associated with adRP.

Whole exome sequencing confirms the clinical diagnosis of Marfan syndrome combined with X-linked hypophosphatemia.

BACKGROUND: To determine the genetic lesions and to modify the clinical diagnosis for a Chinese family with significant intrafamilial phenotypic diversities and unusual presentations. METHODS: Three affected patients and the asymptomatic father were included and received comprehensive systemic examinations. Whole exome sequencing (WES) was performed for mutation detection. Structural modeling test was applied to analyze the potential structural changes caused by the missense substitution. RESULTS: The proband showed a wide spectrum of systemic anomalies, including bilateral ectopia lentis, atrial septal defect, ventricular septal defect, widening of tibial metaphysis with medial bowing, and dolichostenomelia in digits, while her mother and elder brother only demonstrated similar skeletal changes. A recurrent mutation, PHEX p.R291*, was found in all patients, while a de novo mutation, FBN1 p.C792F, was only detected in the proband. The FBN1 substitution was also predicted to cause significant conformational change in fibrillin-1 protein, thus changing its physical and biological properties. CONCLUSIONS: Taken together, we finalized the diagnosis for this family as X-linked hypophosphatemia (XLH), and diagnosed this girl as Marfan syndrome combined with XLH, and congenital heart disease. Our study also emphasizes the importance of WES in assisting the clinical diagnosis for complicated cases when the original diagnoses are challenged.

[Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

OBJECTIVE: To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. METHODS: Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. RESULTS: Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. CONCLUSIONS: Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

MFRP variations cause nanophthalmos in five Chinese families with distinct phenotypic diversity.

Purpose: Nanophthalmos is a congenital ocular structural anomaly that can cause significant visual loss in children. The early diagnosis and then taking appropriate clinical and surgical treatment remains a challenge for many ophthalmologists because of genetic and phenotypic heterogeneity. The objective of this study is to identify the genetic cause of nanophthalmos in the affected families and analyze the clinical phenotype of nanophthalmos with MFRP gene variation (Microphthalmia, isolated; OMIM#611040 and Nanophthalmos 2; OMIM#609549, respectively). Methods: Comprehensive ophthalmic examinations were performed on participants to confirm the phenotype. The genotype was identified using whole exome sequencing, and further verified the results among other family members by Sanger sequencing. The normal protein structure was constructed using Alphafold. Mutant proteins were visualized using pymol software. Pathogenicity of identified variant was determined by in silico analysis and the guidelines of American College of Medical Genetics and Genomics (ACMG). The relationship between genetic variants and clinical features was analyzed. Results: Five nanophthalmos families were autosomal recessive, of which four families carried homozygous variants and one family had compound heterozygous variants in the MFRP gene. Both family one and family three carried the homozygous missense variant c.1486G>A (p.Glu496Lys) in the MFRP gene (Clinvar:SCV005060845), which is a novel variant and evaluated as likely pathogenic according to the ACMG guidelines and in silico analysis. The proband of family one presented papilloedema in both eyes, irregular borders, thickened retinas at the posterior pole, tortuous and dilated retinal vessels, and indistinguishable arteries and veins, while the proband of family three presented uveal effusion syndrome-like changes in the right eye. In families one and 3, despite carrying the same gene variant, the probands had completely different clinical phenotypes. The homozygous nonsense variant c.271C>T (p.Gln91Ter) (Clinvar:SCV005060846) of the MFRP gene was detected in family 2, presenting shallow anterior chamber in both eyes, pigmentation of peripheral retina 360° from the equator to the serrated rim showing a clear demarcation from the normal retina in the form of strips. Family four proband carried the homozygous missense variant c.1411G>A (p.Val471Met) in the MFRP gene (Clinvar:SCV005060847), family five proband carried compound heterozygous missense variants c.1486G>A (p.Glu496Lys) and c.602G>T (p.Arg201Leu) in the MFRP gene (Clinvar:SCV005060848), which is a novel variant and evaluated as likely pathogenic according to the ACMG guidelines and in silico analysis, and they all presented clinically with binocular angle-closure glaucoma, family four also had retinal vein occlusion in the right eye during the follow-up. Conclusion: In this study, pathogenic variants of the MFRP gene were detected in five nanophthalmos families, including two novel variants. It also revealed a distinct phenotypic diversity among five probands harboring variants in the MFRP gene. Our findings extend the phenotype associated with MFRP variants and is helpful for ophthalmologists in early diagnosis and making effective treatment and rehabilitation strategies.

Exome sequencing confirms the clinical diagnosis of both joubert syndrome and klinefelter syndrome with keratoconus in a han Chinese family.

Introduction: Joubert syndrome a rare genetic disorder, is characterized by abnormalities in the development of the central nervous system with "molar signs" on magnetic resonance imaging of the brain and accompanied by cerebellar vermis hypoplasia, ataxia, hypotonia, and developmental delay. Keratoconus (KC) is a kind of genetically predisposed eye disease that causes blindness characterized by a dilated thinning of the central or paracentral cornea conically projected forward, highly irregular astigmatism, and severe visual impairment. Klinefelter syndrome is caused by an extra X chromosome in the cells of male patients, and the main phenotype is tall stature and dysplasia with secondary sex characteristics. This study was intended to identify the genetic etiology and determine the clinical diagnosis of one Han Chinese family with specific clinical manifestations of keratoconus and multiorgan involvement. Methods: A comprehensive ocular and related general examination was performed on one patient and his asymptomatic parents and brother. Pathogenic genes were tested by exome sequencing. CNV-seq was used to verify the copy number variation, and peripheral blood was cultured for karyotype analysis. The pathogenicity of the identified variant was determined subject to ACMG guidelines. The Gene Expression Omnibus (GEO) dataset of keratoconus-related genes in the NCBI database was obtained to analyze the differentially expressed genes in corneal tissues of the keratoconus group and the normal control group, and analysis of protein-protein interaction networks (PPI) was performed. Results: Proband, a 25-year-old male, had sudden loss of vision in the left eye for 1 week. Best corrected visual acuity (BCVA): 0.5 (-1.00DS/-5.00DC*29°) in the right eye, counting fingers/40 cm in the left eye. Slit-lamp microscopy of the right eye showed mild anterior protrusion of the cornea and thinning of the cone-topped cornea. The left eye showed marked thinning of the central region of the cornea, rounded edema in the form of a cone-like bulge, epithelial bullae, edema and turbidity of the stroma, and bulging of the Descemet's membrane. Cranial magnetic resonance imaging (MRI) revealed changes in the midbrain and cerebellum, with a "molar sign" and a "bat-winged" ventriculus quartus cerebri. General check-up: 168 cm in height, decreased muscle tone in all four limbs, knee jerk elicited, negative Babinski sign, abdominal reflexes elicited, finger-to-nose test positive, intentional tremor evident in both hands, positive Romberg's sign, instability of gait, level I intellectual disability, poor adaptive behavior, communication disorders, teeth all dentures, a peculiar face with blepharophimosis, wide inner canthus distance, mild ptosis, severe positive epicanthus, high palatal arches, exotropia, hypotrichosis of beard and face, inconspicuous prominentia laryngea, and short upper and lower limbs. Exome sequencing detected compound heterozygous frameshift variants M1:c.9279dup:p.His3094Thrfs*18 and M2:c.6515_6522del:p.Lys2172Thrfs*37 in the patient's CPLANE1 gene and the presence of duplication-type CNV on the X chromosome. Sanger sequencing showed that the mother and father carried the M1 and M2 variants, respectively, and the younger brother carried the M2 variant, which was a novel variant. CNV-seq analysis showed the presence of a duplication-type CNV Xp22.33-Xq28 (2757837-156030895) of approximately 155 Mb on the X chromosome of the proband, which was a de novo variant and carried by neither of the parents. The two heterozygous frameshift variants and duplication-type CNV were pathogenic according to the ACMG guidelines. Differential expression analysis of keratoconus-related genes showed that CPLANE1 was upregulated in the corneal tissues of keratoconus patients compared with normal controls, and such a difference was statistically significant (p = 0.000515, <0.05). PPI analysis showed that the CPLANE1-NPHP3 complex protein acted as a bridge between cilia and extracellular matrix tissue. According to the genetic test results and clinical phenotype analysis, the family was finally diagnosed with Joubert syndrome combined with Keratoconus and Klinefelter syndrome. Discussion: In this study, we report a proband in a Han Chinese family with both Joubert syndrome and X-linked Klinefelter syndrome as well as keratoconus, and the phenotype spectrum of CPLANE1-Joubert syndrome may be expanded accordingly. Meanwhile, the significance of exome sequencing was emphasized in aiding the clinical diagnosis of complex cases, which is difficult to make.

De novo variation in ARID1B gene causes Coffin-Siris syndrome 1 in a Chinese family with excessive early-onset high myopia.

Coffin-Siris syndrome (CSS) is a rare autosomal dominant inheritance disorder characterized by distinctive facial features, hypoplasia of the distal phalanx or nail of the fifth and additional digits, developmental or cognitive delay of varying degree, hypotonia, hirsutism/hypertrichosis, sparse scalp hair and varying kind of congenital anomalies. CSS can easily be misdiagnosed as other syndromes or disorders with a similar clinical picture because of their genetic and phenotypic heterogeneity. We describde the genotype-phenotype correlation of one patient from a healthy Chinese family with a novel genotype underlying CSS, who was first diagnosed in the ophthalmology department as early-onset high myopia (eoHM). Comprehensive ophthalmic tests as well as other systemic examinations were performed on participants to confirm the phenotype. The genotype was identified using whole exome sequencing, and further verified the results among other family members by Sanger sequencing. Real-time quantitative PCR (RT-qPCR) technology was used to detect the relative mRNA expression levels of candidate genes between proband and normal family members. The pathogenicity of the identified variant was determined by The American College of Medical Genetics and Genomics (ACMG) guidelines. STRING protein-protein interactions (PPIs) network analysis was used to detect the interaction of candidate gene-related proteins with high myopia gene-related proteins. The patient had excessive eoHM, cone-rod dystrophy, coarse face, excessive hair growth on the face, sparse scalp hair, developmental delay, intellectual disability, moderate hearing loss, dental hypoplasia, patent foramen ovale, chronic non-atrophic gastritis, bilateral renal cysts, cisterna magna, and emotional outbursts with aggression. The genetic assessment revealed that the patient carries a de novo heterozygous frameshift insertion variant in the ARID1B c.3981dup (p.Glu1328ArgfsTer5), which are strongly associated with the typical clinical features of CSS patients. The test results of RT-qPCR showed that mRNA expression of the ARID1B gene in the proband was approximately 30% lower than that of the normal control in the family, suggesting that the variant had an impact on the gene function at the level of mRNA expression. The variant was pathogenic as assessed by ACMG guidelines. Analysis of protein interactions in the STRING online database revealed that the ARID1A protein interacts with the high myopia gene-related proteins FGFR3, ASXL1, ERBB3, and SOX4, whereas the ARID1A protein antagonizes the ARID1B protein. Therefore, in this paper, we are the first to report a de novo heterozygous frameshift insertion variant in the ARID1B gene causing CSS with excessive eoHM. Our study extends the genotypic and phenotypic spectrums for ARID1B-CSS and supplies evidence of significant association of eoHM with variant in ARID1B gene. As CSS has high genetic and phenotypic heterogeneity, our findings highlight the importance of molecular genetic testing and an interdisciplinary clinical diagnostic workup to avoid misdiagnosis as some disorders with similar manifestations of CSS.

Novel mutations of the X-linked genes associated with early-onset high myopia in five Chinese families.

PURPOSE: To report novel pathogenic variants of X-linked genes in five Chinese families with early-onset high myopia (eoHM) by using whole-exome sequencing and analyzing the phenotypic features. METHODS: 5 probands with X-linked recessive related eoHM were collected in Ningxia Eye Hospital from January 2021 to June 2022. The probands and their family members received comprehensive ophthalmic examinations,and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined by Sanger sequencing and co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using silico analysis and evaluated according to ACMG guidelines. RT-qPCR was used to detect differences in the relative mRNAs expression of candidate gene in mRNAs available with the proband and family members in the pedigree 2. The relationship between genetic variants and clinical features was analyzed. RESULTS: All probands were male, and all pedigrees conformed to an X-linked recessive inheritance pattern. They were diagnosed with high myopia at their first visits between 4 and 7 years old. Spherical equivalent ranged between - 6.00D and - 11.00D.The five novel hemizygous variants were found in the probands, containing frameshift deletion variant c.797_801del (p.Val266Alafs*75) of OPN1LW gene in the pedigree 1, nonsense variant c.513G > A (p.Trp171Ter)of RP2 gene in the pedigree 2, missense variant c.98G > T (p.Cys33Phe) of GPR143 gene in the pedigree 3, frameshift deletion variant c.1876_1877del (p.Met626Valfs*22) of FRMD7 gene in the pedigree 4 and inframe deletion variant c.670_ 675del (p.Glu192_ Glu193del) of HMGB3 gene in the pedigree 5. All variants were classified as pathogenic or likely pathogenic by the interpretation principles of HGMD sequence variants and ACMG guidelines. In family 2, RT-qPCR showed that the mRNA expression of RP2 gene was lower in the proband than in other normal family members, indicating that such variant caused an effect on gene function at the mRNA expression level. Further clinical examination showed that pedigrees 1, 2, 3, and 4 were diagnosed as X-linked recessive hereditary eye disease with early-onset high myopia, including quiescent cone dysfunction, retinitis pigmentosa, ocular albinism, and idiopathic congenital nystagmus respectively. The pedigree 5 had eoHM in the right eye and ptosis in both eyes. CONCLUSION: In this paper,we are the first to report five novel hemizygous variants in OPN1LW, RP2, GPR143, FRMD7, HMGB3 genes are associated with eoHM. Our study extends the genotypic spectrums for eoHM and better assists ophthalmologists in assessing, diagnosing, and conducting genetic screening for eoHM.

De novo variation in EP300 gene cause Rubinstein-Taybi syndrome 2 in a Chinese family with severe early-onset high myopia.

BACKGROUND: Rubinstein-Taybi syndrome (RSTS) is characterized by distinctive facial features, broad and often angulated thumbs and halluces, short stature, and moderate-to-severe intellectual disability, classified into two types RSTS1 (CREBBP-RSTS) and RSTS2 (EP300-RSTS). More often, the clinical features are inconclusive and the diagnosis of RSTS is established in a proband with identification of a heterozygous pathogenic variant in CREBBP or EP300 to confirm the diagnosis. METHODS: In this study, to describe an association between the clinical phenotype and the genotype of a RSTS2 patient who was initially diagnosed with severe early-onset high myopia (eoHM) from a healthy Chinese family, we tested the proband of this family by whole exome sequencing (WES) and further verified among other family members by Sanger sequencing. Real-time quantitative PCR was used to detect differences in the relative mRNA expression of candidate genes available in the proband and family members. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. RESULTS: Whole-exome sequencing revealed that the proband carried the heterozygous frameshift deletion variant c.3714_3715del (p.Leu1239Glyfs*3) in the EP300 gene, which was not carried by the normal parents and young sister as verified by Sanger sequencing, indicating that the variant was de novo. Real-time quantitative PCR showed that the mRNA expression of EP300 gene was lower in the proband than in other normal family members, indicating that such a variant caused an effect on gene function at the mRNA expression level. The variant was classified as pathogenic as assessed by the interpretation principles of HGMD sequence variants and ACMG guidelines. According to ACMG guidelines, the heterozygous frameshift deletion variant c.3714_3715del (p.Leu1239Glyfs*3) in the EP300 gene was more likely the pathogenic variant of this family with RSTS2. CONCLUSIONS: Therefore, in this paper, we first report de novo heterozygous variation in EP300 causing eoHM-RSTS. Our study extends the genotypic spectrums for EP300-RSTS and better assists physicians in predicting, diagnosis, genetic counseling, eugenics guidance and gene therapy for EP300-RSTS.

Four different gene-related cone-rod dystrophy: clinical and genetic findings in six Chinese families with diverse modes of inheritance.

Purpose: To investigate pathogenic variants in six families with cone-rod dystrophy (CORD) presenting various inheritance patterns by using whole-exome sequencing (WES) and analyzing phenotypic features. Methods: A total of six families with CORD were enrolled in Ningxia Eye Hospital for this study. The probands and their family members received comprehensive ophthalmic examinations, and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined via Sanger sequencing. Furthermore, co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using in silico analysis and evaluated according to the American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Of the six families, two families were assigned as X-linked recessive (XL), two families were assigned as autosomal recessive (AR), and two families were assigned as autosomal dominant (AD). Pathogenic variants were detected in CACNA1F in two X-linked recessive probands, among which family 1 had a hemizygous frameshift variant c.2201del (p.Val734Glyfs*17) and family 2 had a hemizygous missense variant c.245G>A (p.Arg82Gln). Both probands had high myopia, with fundus tessellation accompanied by abnormalities in the outer structure of the macular area. The homozygous splice variant c.2373 + 5G>T in PROM1 and the homozygous nonsense variant c.604C>T (p.Arg202Ter) in ADAM9 were detected in two autosomal recessive families of the probands. Both probands showed different degrees of atrophy in the macular area, and the lesions showed hypofluorescence changes in autofluorescence. The heterozygous variation in CRX c.682C>T (p.Gln228Ter) was detected in two autosomal dominant families. The onset age of the two probands was late, with better vision and severe macular atrophy. According to ACMG guidelines and the analysis of online in silico tools, all variations were labeled as potentially harmful or pathogenic. Conclusion: Pathogenic variants in CACNA1F, PROM1, ADAM9, and CRX genes were identified in six families affected by the diverse inheritance patterns of CORD. Furthermore, the potential impact of the nonsense-mediated decay (NMD) mechanism on the manifestation of CORD phenotypes was examined and addressed. Simultaneously, the spectrum of pathogenic variants and clinical phenotypes associated with the CORD gene was extended.

Two novel variations in LRP2 cause Donnai-Barrow syndrome in a Chinese family with severe early-onset high myopia.

Donnai-Barrow syndrome (DBS) is a rare autosomal recessive disorder caused by mutation in the low density lipoprotein receptor-related protein 2 gene (LRP2). Defects in this protein may lead to clinical multiple organ malformations by affecting the development of organs such as the nervous system, eyes, ears, and kidneys. Although some variations on LRP2 have been found to be associated with DBS, early diagnosis and prevention of patients with atypical DBS remains a challenge for many physicians because of their clinical heterogeneity. The objective of this study is to explore the association between the clinical presentation and the genotype of a DBS patient who was initially diagnosed with early-onset high myopia (eoHM) from a healthy Chinese family. To this end, we tested the patient of this family via whole exome sequencing and further verified the results among other family members by Sanger sequencing. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. Genetic assessment revealed that two novel variations in LRP2, a de novo missense variation (c.9032G>A; p.Arg3011Lys) and a novel splicing variation (c.2909-2A>T) inherited from the father, were both carried by the proband in this family, and they are strongly associated with the typical clinical features of DBS patients. Therefore, in this paper we are the first to report two novel compound heterozygous variations in LPR2 causing DBS. Our study extends the genotypic spectrums for LPR2-DBS and better assists physicians in predicting, diagnosing, and conducting gene therapy for DBS.

BEST1 novel mutation causes Bestrophinopathies in six families with distinct phenotypic diversity.

PURPOSE: To report novel BEST1 variants in six Chinese families with bestrophinopathies of two different inheritance modes and analyze the intrafamilial phenotypic diversity. METHOD: A total of 25 participants including 13 patients and 12 healthy family members from 6 Chinese families with bestrophinopathies were available for genetic and clinical analysis. All of the patients were subjected to comprehensive ophthalmic evaluations and exome sequencing was performed on the probands to detect the causative variants. The pathogenicity of gene variants was predicted using silico analysis and evaluated according to ACMG guidelines. All (likely) pathogenic variants were determined by Sanger sequencing and co-segregation analyses were performed on available family members. The relevant original literature previously reported was retrieved to explore the relationship between BEST1-related gene variants and clinical features. RESULTS: In the 6 families, 3 families (10 patients) were assigned as autosomal dominant bestrophinopathies (VMD) and 3 families (3 patients) were assigned as Autosomal recessive Bestrophinopathies (ARB). A total of 9 variants on the BEST1 gene were identified, containing 7 missense variants, 1 nonsense variant, and 1 frameshift variant, respectively, of which 3 variants c.88A > G (p.Lys30Glu), c.764G > A (p.Arg255Gln) and c.233dupT (p.Ser79Phefs*153) were novel variants. Three families with ARB were detected with heterozygous variants on the BEST1 gene.2 families (8 patients) with BVMD showed markedly irregular dominant inheritance, and the severity of macular lesions varies greatly among individuals of the same family. Among them, the probands showed typical vitelliform lesions in the macula, while the other six patients had no visible signs of the disease by fundus photography (ophthalmoscopy) and minor lesions could be detected on OCT in two patients, the continuity of the ellipsoidal band was interrupted with the chimeric band. The phenotypes of the patients in the three ARB families ranged from typical/atypical vitelliform lesions to extensive extramacular deposits (peripheral spots). CONCLUSION: This study provided evidence that the phenotype of BVMD manifested irregular dominant inheritance, with patients carrying a pathogenic heterozygous variant of BEST1 to develop obvious intrafamilial phenotypic diversity, and the patients who harbor two pathogenic alleles showed recessive inheritance bestrophinopathies with distinct phenotypic diversity. Our study also emphasized the importance of comprehensive genetic analysis in patients with bestrophinopathies, and in such challenging families with distinct intrafamilial phenotypic diversity, it shall provide novel insights into phenotypic assessments of bestrophinopathies, and contribute to better diagnosis, prognosis, and treatment for these patients.

Association of insulin-like growth factor-1 polymorphisms with high myopia in the Chinese population.

PURPOSE: The purpose of this study was to determine whether genetic variants in the insulin-like growth factor-1 (IGF-1) gene were associated with high myopia in the Chinese population. METHODS: A case-control association study of 421 unrelated Chinese patients with high myopia and 401 control subjects matched in ethnicity and gender was undertaken. Genomic DNA was prepared from peripheral blood. All individuals were genotyped for 7 tag single nucleotide polymorphisms (tSNPs) across the IGF-1 gene region. Genotypic distribution was tested for Hardy-Weinberg equilibrium. The genotype and allele frequencies were evaluated using the χ(2) tests. Bonferroni corrections for multiple comparisons were performed. RESULTS: The polymorphism of rs12423791 showed positive association with extreme myopia (p(allel)=0.006 and p(allel1 recessive model)=0.004, respectively) after Bonferroni correction for multiple testing and the haplotype GC of rs5742629-rs12423791 was also associated with extreme myopia (p=0.033) after 50,000 permutations for multiple comparisons. CONCLUSIONS: The polymorphism of rs12423791 in IGF-1 may be associated with extreme myopia in the Chinese population and should be investigated further.

[Analysis of clinical phenotype and mode of inheritance in retinitis pigmentosa patients with consanguineous marriage].

OBJECTIVE: To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage. METHODS: RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG). RESULTS: A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes. CONCLUSIONS: The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal recessive. The common marriage pattern of consanguinity is between first cousins. The age of onset is early and the ocular fundus changes of some patients are atypical, this should be paid attention clinically.

[Novel RPGR gene mutation in a Chinese family with X-linked recessive retinitis pigmentosa].

OBJECTIVE: To screen the mutation in the RPGR gene in a large Chinese family with X-linked recessive retinitis pigmentosa (RP) and to describe the phenotype in affected males and female carriers. METHODS: Ophthalmic examinations were performed in 77 family members of a RP pedigree to identify affected individuals. Polymerase chain reaction (PCR) and direct sequencing were used for screening of mutations in RPGR gene exon ORF15. RESULTS: Mutation screening demonstrated a novel mutation, g.ORF15 + 577_578delAG, which caused an open reading frameshift and resulted in premature truncation of the RPGR protein. This mutation was detected in 8 affected male individuals and 14 obligate female carriers in this family and was found to segregate with the phenotype in this family. This mutation led to a severe RP phenotype in male affected individuals with some variability in the age of onset of night blindness and loss of visual acuity, but was recessive in female carriers without a RP phenotype. However the most striking phenotypic feature in female carriers in this pedigree was moderate to high myopia with refractive error ranging from -5.00 D to -22.00 D in 14 female carriers. CONCLUSIONS: This novel mutation in RPGR ORF15 causes serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing RP and phenotypic spectrum of the disease in Chinese family, which is useful for further genetic consultation and genetic diagnosis.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

A novel mutation in retinitis pigmentosa GTPase regulator gene with a distinctive retinitis pigmentosa phenotype in a Chinese family.

PURPOSE: To screen the mutation in the retinitis pigmentosa GTPase regulator (RPGR) ORF15 in a large Chinese family with X-linked recessive retinitis pigmentosa and describe the phenotype in affected male and female carriers. METHODS: Ophthalmic examination was performed on 77 family members to identify affected individuals and to characterize the disease phenotype. PCR and direct sequencing were used for screening mutations in the RPGR gene. RESULTS: Mutation screening demonstrated a novel mutation ORF15+577_578 delAG, which caused an open reading frameshift and resulted in premature truncation of the RPGR protein. The mutation was detected in eight affected male individuals and 14 obligate female carriers of the family and was found to segregate with the phenotype in this family. The mutation led to a severe retinitis pigmentosa (RP) phenotype in male-affected individuals, with some variability in the age of onset of night blindness and visual acuity, but was recessive in female carriers without an RP phenotype. However, the state associated with the carrier was moderate to high myopia with the refractive error ranging from -5.00 D to 22.00 D in 14 female carriers. CONCLUSIONS: This novel mutation in RPGR ORF15 causes a serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing X-linked RP and expands phenotypic spectrum of the disease in a Chinese family. This finding will be useful for further genetic consultations and genetic diagnosis.

Variants of RP1 gene in Chinese patients with autosomal dominant retinitis pigmentosa.

BACKGROUND: The objective of this study was to determine the frequency and characteristics of mutations in the RP1 gene and to characterize mutations with the clinical features in the Chinese family with autosomal dominant retinitis pigmentosa (ADRP). METHODS: Forty-three affected, unrelated Chinese individuals with ADRP were recruited between 2002 and 2006. Polymerase chain reaction and direct DNA sequencing were used to screen in the entire coding region and splice sites of the RP1 gene. Cosegregation analysis and population frequency studies were performed for patients with identified mutations. The clinical features were determined by complete ophthalmologic examinations. RESULTS: The mutation detectable rate of the RP1 gene in Chinese patients with ADRP was 1/43. A missense mutation, N985Y, was identified in exon 4 of the RP1 gene in 8 affected individuals from a Chinese family with ADRP. The ophthalmic findings with an N985Y mutation were similar to those of typical retinitis pigmentosa with delayed onset after age 40 years and slow progression. In addition, a total of 9 distinct variants were detected in our study population, most of which were RP1 gene polymorphisms; the pathological significance of P903L, a novel missense mutation, was unconfirmed. INTERPRETATION: Mutations in the RP1 gene are relatively rare in Chinese patients with ADRP. In our cases, N985Y mutation segregated with the phenotype from 1 Chinese family with mild and late-onset ADRP, a finding that has not been documented in other races.

Prognostic value of legumain in uveal melanoma.

The present study aimed to assess the expression of legumain in uveal melanoma (UM) cell lines and primary UM specimens, and to determine the possible association between legumain expression and clinical as well as pathological characteristics to reveal its impact on the prognosis of patients with UM. Records of primary UM cases treated at Beijing Tongren Hospital and Tianjin Eye Hospital between 1996 and 2005 were retrieved for analysis and a total of 82 patients with uveal melanoma were included in the study. The expression of legumain in the formalin­fixed and paraffin­embedded surgical specimens of these 82 patients was determined using immunohistochemical analysis. In addition, the expression of legumain was examined in two uveal melanoma cell lines using polymerase chain reaction and western blot analyses. The association of legumain expression with clinical/pathological characteristics was analyzed using the χ2 and Fisher's exact test. In addition, the impact of legumain on the prognosis of patients with uveal melanoma was examined. Upregulation of legumain was more predominant in the highly invasive uveal melanoma cell line MUM­2B compared with that in the MUM­2C with low invasiveness. Of 82 primary uveal melanoma tissues, 35 exhibited high expression of legumain, while the other 47 specimens exhibited low or negative expression of legumain. High legumain expression was primarily associated with local invasion of UM. Overall survival analysis revealed that the patients with high legumain expression exhibited poorer survival than patients with low/negative legumain expression. These findings suggested that upregulation of legumain is associated with malignant behavior of UM and that legumain may be used as an negative prognostic factor as well as a therapeutic target.