RESUMO
BACKGROUND: Desmoid tumors associated with familial adenomatous polyposis show variable behavior; about 10% grow relentlessly, resulting in severe morbidity or mortality. Investigations that could identify the minority of desmoid tumors that behave aggressively would allow these tumors to be treated early and spare the majority of patients who have more benign disease from unnecessary intervention. OBJECTIVE: The aim of this study was to investigate whether imaging the tumor metabolic-vascular phenotype by modern methods predicts growth. DESIGN: This is a prospective case series study. SETTINGS: The study was conducted at a tertiary center specializing in familial adenomatous polyposis and desmoid disease. PATIENTS: Nine patients with familial adenomatous polyposis (4 male, mean age 39 years) with desmoid tumor underwent 18F-FDG-PET and dynamic contrast-enhanced MRI. Standard MRI was repeated a year later to assess tumor growth. MAIN OUTCOME MEASURES: The primary outcome measured was the correlation between 18F-FDG-PET and dynamic contrast-enhanced MRI parameters and subsequent desmoid growth. RESULTS: Failed intravenous access precluded dynamic contrast-enhanced MRI in 1 female patient. Thirteen desmoid tumors (4 intra-abdominal, 2 extra-abdominal, 7 abdominal wall; mean area, 68 cm) were analyzed in the remaining 8 patients. Two patients died before follow-up MRI. Five tumors decreased in size, 3 increased in size, and 3 remained stable after a year. Significant correlation (Spearman rank correlation, significance at 5%) existed between maximum standardized uptake value and k(ep) (r = -0.56, p = 0.04), but not with other vascular parameters (K(trans) (r = -0.47, p = 0.09); v(e) (r = -0.11, p = 0.72); integrated area under the gadolinium-time curve at 60 seconds (r = -0.47, p = 0.10)). There was no significant difference in the maximum standardized uptake value or dynamic contrast-enhanced MRI parameters (K(trans), v(e), k(ep), integrated area under the gadolinium-time curve at 60 seconds) between the tumors that grew or decreased in size or between the tumor sites. However, vascular metabolic ratio (maximum standardized uptake value/K(trans)) was significantly different for tumor site (p = 0.001) and size (p = 0.001, 1-way ANOVA). LIMITATIONS: This investigation is limited because of its exploratory nature and small patient numbers. CONCLUSIONS: Although not predictive for tumor behavior, some correlations existed between dynamic contrast-enhanced MRI and 18F-FDG-PET parameters. Vascular metabolic ratio may provide further information on tumor behavior; however, this needs to be evaluated with further larger studies.
Assuntos
Polipose Adenomatosa do Colo/patologia , Fibromatose Abdominal/patologia , Imageamento por Ressonância Magnética/métodos , Tomografia por Emissão de Pósitrons/métodos , Polipose Adenomatosa do Colo/diagnóstico por imagem , Adulto , Análise de Variância , Área Sob a Curva , Meios de Contraste , Feminino , Fibromatose Abdominal/diagnóstico por imagem , Fluordesoxiglucose F18 , Gadolínio DTPA , Humanos , Masculino , Fenótipo , Valor Preditivo dos Testes , Estudos Prospectivos , Compostos RadiofarmacêuticosRESUMO
Single and double flowered impatiens (Impatiens walleriana Hook.f.) plants with symptoms of downy mildew were found in commercial greenhouses in Delaware, Wayne, and Holmes counties, Ohio, in April 2012. Plants were stunted and defoliated. Symptoms on remaining leaves included general chlorosis without discrete spots and downward curling of leaves. A downy white growth was observed on the lower surface of infected leaves. The disease was widespread in affected greenhouses and incidence in cvs. Shimmer Coral, Accent Mix, and Super Elfin was nearly 90%. The downy growth consisted of coenocytic mycelia, monopodial sporangiophores, and ovoid, hyaline sporangia typical of Plasmopara obducens (J. Schröt.) J. Schröt in Cohn (1,2,4). Sporangia were borne on branchlets measuring 5 to 15 µm long (average 10 µm) at right angles to the main axis of the sporangiophore. Sporangia were 9.4 to 17.5 × 12.8 to 16.3 µm. No oospores were observed. Total DNA was extracted directly from plant tissue with the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. Large ribosomal subunit DNA was amplified by PCR using primers NL-1 and NL-4 (3). Amplicons of 690 bp and 834 bp were produced from each diseased sample, while only the 690-bp amplicon was produced from healthy tissue. DNA from each amplicon of sample IDM041712 was purified using the Wizard SV Gel and PCR Clean-Up System (Promega), sequenced, and the sequence of the diagnostic 834-bp amplicon was deposited in GenBank (JX142134). The sequence of the 834-bp amplicon was 99% similar to those of P. obducens isolates from Serbia (HQ246451) (1), the UK (AY587558), and Austria (EF196869). The sequence of the 690-bp amplicon (JX142135) was 99% similar to that of I. walleriana (HQ223336). Twelve young impatiens 'Shimmer Coral' plants were inoculated with sporangia washed from infected leaves (1 × 104 sporangia/ml). Plants were incubated at room temperature for 24 h in a moist chamber and then maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterile water and maintained in the same environment. After 12 to 14 days, typical symptoms of downy mildew developed on the inoculated plants and microscopic examination revealed the same pathogen morphology as the original isolate. All non-inoculated control plants remained disease free. To our knowledge, this is the first report of downy mildew on impatiens in Ohio. This disease caused considerable economic losses in Ohio in 2012 and is likely to be a recurring problem requiring intensive preventative management. References: (1) A. Bulajic et al. Plant Dis. 95:491, 2011. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) W. Maier et al. Can. J. Bot. 81:12, 2003. (4) S. N. Wegulo et al. Plant Dis. 88:909, 2004.
RESUMO
Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 µm (mean 583.0 µm), stylet length from 15.0 to 17.8 µm (mean 16.8 µm), tail length from 23.2 to 37.5 µm (mean 29.2 µm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 µm (mean 3.1 µm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c' = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 µm (mean 537.9 µm), stylet length from 15.0 to 17.2 µm (mean 16.2 µm), tail length from 22.7 to 28.1 µm (mean 25.5 µm), spicule from 15.0 to 17.5 µm (mean 16.4 µm), gubernaculum from 3.5 to 4.7 µm (mean 4.0 µm), and DGO from 2.6 to 3.7 µm (mean 3.1 µm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c' = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.
RESUMO
AIMS: The benefits of neoadjuvant androgen deprivation therapy (nADT) in the management of intermediate- and high-risk prostate cancer patients have been well-established. The aim of this study was to identify radiomic prognostic features derived from routine anatomic magnetic resonance imaging (MRI) sequences that can predict the response of the prostate cancer to nADT. MATERIALS AND METHODS: Patients with intermediate- and high-risk prostate cancer (with one of clinical stage ≥ T2c, Gleason score ≥7 or presenting prostate-specific antigen ≥10) who received 3 months of ADT prior to radical external beam radiotherapy were enrolled into this study. The relative blood volume and the relative blood flow were used as dynamic MRI kinetic parameters to quantify vascular changes as responses to nADT. For all pre- and post-nADT data sets, a combination of T2-weighted and contrast-enhanced T1-weighted anatomic images were used to define regions of interest (ROI) as the dominant malignant nodules (DMNs) and the benign prostate (the entire prostate with the summed DMNs being subtracted). MRI textural radiomic features associated with prostate cancer response in the literature of energy and homogeneity were selected. Pyradiomics was used to extract textural features of the ROIs. A Wilcoxon signed-rank test was carried out to investigate if there were statistically significant differences in values of radiomic features between: (i) benign prostate ROI and DMN pre-nADT; (ii) pre- and post-nADT of benign prostate ROI; (iii) pre- and post-nADT of DMN. Changes in radiomic features and dynamic MRI kinetic parameters were correlated using the Spearman correlation test. RESULTS: Twenty prostate cancer patients were recruited into the study. The median time between the first baseline scan and the first on-treatment scan was 91.5 days (range 82-105). One patient had no discernible tumour visible, leaving 19 patients with evaluable data for the analysis. Baseline homogeneity and energy values differed significantly between benign and malignant tissue (P < 0.01). In response to nADT, homogeneity and energy showed reciprocal changes, significantly increased in benign prostate while decreasing in the DMN. The reduction in tumour homogeneity and energy feature values showed a positive association with the decline in tumour blood flow and tumour blood volume induced by androgen deprivation as derived from dynamic MRI parameters. CONCLUSION: Energy and homogeneity radiomic features derived from MRI of benign and malignant prostate showed significant reciprocal changes in response to nADT. This study confirms the potential of these radiomic features to act as surrogate markers of tumour androgen sensitivity due to their strong association with ADT-induced physiological effects in prostate tumours.
Assuntos
Antagonistas de Androgênios , Neoplasias da Próstata , Antagonistas de Androgênios/uso terapêutico , Androgênios/uso terapêutico , Humanos , Imageamento por Ressonância Magnética/métodos , Masculino , Gradação de Tumores , Neoplasias da Próstata/diagnóstico por imagem , Neoplasias da Próstata/tratamento farmacológico , Neoplasias da Próstata/patologiaRESUMO
BACKGROUND & AIMS: Patients with cirrhosis are prone to infection which is a frequent precipitant of hepatic encephalopathy (HE). Clinical studies have examined the importance of inflammation and infection in modulating the manifestation of symptoms of HE in acute liver failure and patients with cirrhosis and minimal/low grade HE. It would be logical to presume that this relationship persists in patients who develop severe HE in cirrhosis although this has not been examined to date. METHODS: We report the findings of a prospective audit of 100 consecutive patients with cirrhosis admitted between Jan 2000 and March 2008 to a liver Intensive Care Unit (ICU) where HE was the primary indication for admission (59% Grade 3; 41% Grade 4). Haematological and microbiological data were collected at ICU admission, and organ scores and outcomes were recorded. RESULTS: 46% of patients had positive cultures taken within ± 48h from admission to ICU [25% blood] and a further 22% were culture negative but had evidence of systemic inflammation (SIRS). SIRS score (p=0.03) and SOFA score (p=0.006) were significantly higher in those patients with Grade 4 HE, who were also less likely to survive (p<0.001). HE grade/coma score did not correlate with ammonia, biochemistry or MELD score. Fifty-two percent of patients survived their ICU stay while the remainder developed progressive multiorgan failure and died; 38% survived to discharge, and 16% were transplanted. CONCLUSIONS: These data support an association between infection/SIRS and not ammonia, in patients with cirrhosis that develop severe HE. The presence or absence of infection/SIRS did not determine survival.
Assuntos
Encefalopatia Hepática/etiologia , Cirrose Hepática/complicações , Adulto , Amônia/sangue , Cuidados Críticos , Feminino , Encefalopatia Hepática/sangue , Encefalopatia Hepática/mortalidade , Hepatite A/complicações , Hepatite A/microbiologia , Humanos , Estimativa de Kaplan-Meier , Cirrose Hepática/sangue , Cirrose Hepática/mortalidade , Masculino , Pessoa de Meia-Idade , Estudos Prospectivos , Síndrome de Resposta Inflamatória Sistêmica/complicaçõesRESUMO
Hypoxia has been associated with poor local tumour control and relapse in many cancer sites, including carcinoma of the prostate. This translational study tests whether breathing carbogen gas improves the oxygenation of human prostate carcinoma xenografts in mice and in human patients with prostate cancer. A total of 23 DU145 tumour-bearing mice, 17 PC3 tumour-bearing mice and 17 human patients with prostate cancer were investigated. Intrinsic susceptibility-weighted MRI was performed before and during a period of carbogen gas breathing. Quantitative R(2)* pixel maps were produced for each tumour and at each time point and changes in R(2)* induced by carbogen were determined. There was a mean reduction in R(2)* of 6.4% (P=0.003) for DU145 xenografts and 5.8% (P=0.007) for PC3 xenografts. In all, 14 human subjects were evaluable; 64% had reductions in tumour R(2)* during carbogen inhalation with a mean reduction of 21.6% (P=0.0005). Decreases in prostate tumour R(2)* in both animal models and human patients as a result of carbogen inhalation suggests the presence of significant hypoxia. The finding that carbogen gas breathing improves prostate tumour oxygenation provides a rationale for testing the radiosensitising effects of combining carbogen gas breathing with radiotherapy in prostate cancer patients.
Assuntos
Dióxido de Carbono/metabolismo , Oxigenoterapia , Oxigênio/metabolismo , Neoplasias da Próstata/metabolismo , Neoplasias da Próstata/terapia , Idoso , Animais , Dióxido de Carbono/sangue , Hipóxia Celular , Linhagem Celular Tumoral , Humanos , Imageamento por Ressonância Magnética , Masculino , Camundongos , Pessoa de Meia-Idade , Transplante de Neoplasias/diagnóstico por imagem , Oxigênio/sangue , Neoplasias da Próstata/diagnóstico por imagem , Radiografia , Transplante HeterólogoRESUMO
Combretastatin-A4-phosphate (CA4P) acts most effectively against immature tumour vasculature. We investigated whether histological angiogenic profile can explain the differential sensitivity of human tumours to CA4P, by correlating the kinetic changes demonstrated by dynamic MRI (DCE-MRI) in response to CA4P, with tumour immunohistochemical angiogenic markers. Tissue was received from 24 patients (mean age 59, range 32-73, 18 women, 6 men). An angiogenic profile was performed using standard immunohistochemical techniques. Dynamic MRI data were obtained for the same patients before and 4 h after CA4P. Three patients showed a statistically significant fall in K(trans) following CA4P, and one a statistically significant fall in IAUGC(60). No statistically significant correlations were seen between the continuous or categorical variables and the DCE-MRI kinetic parameters other than between ang-2 and K(trans) (P=0.044). In conclusion, we found no strong relationships between changes in DCE-MRI kinetic variables following CA4P and the immunohistochemical angiogenic profile.
Assuntos
Antineoplásicos Fitogênicos/farmacologia , Neoplasias/irrigação sanguínea , Neoplasias/tratamento farmacológico , Estilbenos/farmacologia , Actinas/metabolismo , Adulto , Idoso , Proteínas Angiogênicas/metabolismo , Antígenos CD/metabolismo , Endoglina , Endotélio Vascular/efeitos dos fármacos , Endotélio Vascular/metabolismo , Feminino , Gadolínio DTPA , Humanos , Imuno-Histoquímica , Integrina beta3/metabolismo , Angiografia por Ressonância Magnética/métodos , Masculino , Pessoa de Meia-Idade , Neovascularização Patológica/tratamento farmacológico , Neovascularização Patológica/metabolismo , Neovascularização Patológica/patologia , Receptores de Superfície Celular/metabolismoRESUMO
Procedures for the production of a new and highly prolific embryogenic culture system have been developed in cassava. The importance of the basal salts and type of auxin in controlling the development of cassava embryogenic tissues has been demonstrated, with culture on Gresshoff and Doy basal medium in the presence of 4-amino-3,5,6,trichloro-picolinic acid (picloram) inducing the formation of friable embryogenic callus from which highly totipotent embryogenic suspension cultures could be established. Plants have been regenerated from these cultures. The availability of embryogenic suspension cultures is considered to have important implications for the application of genetic transformation and other biotechnologies in the agronomic improvement of cassava.
Assuntos
Manihot/embriologia , Sementes , Técnicas de Cultura , Genótipo , Manihot/genética , Manihot/crescimento & desenvolvimento , Picloram , Transformação GenéticaRESUMO
The ability to control integration, inheritance, and expression of multiple transgenes is a prerequisite for manipulating biosynthetic pathways and complex agronomic characteristics in plants. One hundred and twenty-five independent transgenic rice plants were regenerated after cobombarding embryogenic tissues with a mixture of 14 different pUC-based plasmids. Eighty-five percent of the R0 plants contained more than two, and 17% more than nine, of the target genes. Plants containing multiple transgenes displayed normal morphologies and 63% set viable seed. Multigene cotransformation efficiency was correlated with the ratio in which the plasmids were mixed with respect to the selectable marker. All target genes had an equal chance of integration, indicating that the nature of the coding region had no effect on the efficiency of integration. Three plant lines containing 11, 10, and 9 transgenes, respectively, were analyzed for patterns of integration and inheritance until the R3 generation. Integration of multiple transgenes occurred at either one or two genetic loci, with inheritance conforming to a 3:1 Mendelian ratio. Coexpression of four marker genes was investigated until the R2 generation.
Assuntos
Oryza/genética , Acetiltransferases/genética , Animais , Biotecnologia , DNA Recombinante/genética , Expressão Gênica , Marcadores Genéticos , Glucuronidase/genética , Luciferases/genética , Fosfotransferases (Aceptor do Grupo Álcool)/genética , Plantas Geneticamente Modificadas/genética , Plasmídeos/genética , Reação em Cadeia da Polimerase , Transformação GenéticaRESUMO
BACKGROUND: Abnormally invasive placenta describes a spectrum of disorders resulting in pathological placental implantation. It is associated with the potential for severe maternal haemorrhage and poor fetal outcome. Increasing numbers of women are at risk owing to the rising incidence of uterine surgery and increasing maternal age. We report data over a five-year period describing anaesthetic management of cases of abnormally invasive placenta in a UK tertiary-referral maternity unit and assess how management has developed. METHODS: Surgically confirmed cases of abnormally invasive placenta were identified from January 2011 to January 2016. Cases were identified using standard ICD-10 codes and by review of departmental records, with surgically-confirmed cases included following review of medical records. RESULTS: Forty cases of abnormally invasive placenta were identified. Eighteen (40%) women had significant medical co-morbidity. All parturients were delivered by caesarean delivery. Caesarean hysterectomy occurred in 24 (60%) cases, delayed hysterectomy in two (5%) and the uterus was preserved in the remaining 14 (35%). Thirty-eight (95%) caesarean deliveries were commenced under neuraxial anaesthesia with 17 (45%) converted to general anaesthesia intraoperatively. Interventional radiology was undertaken in 23 (58%) cases. Median [range] estimated blood loss was 1700mL [500-12000mL]. Intraoperative transfusion of packed red cells occurred in 14 (35%) cases. Intraoperative cell salvage was used in 26 (65%) cases. Four (10%) women were admitted to critical care postoperatively. There were no maternal deaths. CONCLUSION: Our data illustrate the burden on healthcare resources associated with management of abnormally invasive placenta, underlining the continued need for centralised services for treatment of these complex cases. An integrated multidisciplinary approach to case planning, case management and service provision is key to a successful outcome in these cases.
Assuntos
Anestesia Obstétrica/métodos , Placenta Acreta/cirurgia , Adulto , Anestesia por Condução , Anestesia Geral , Perda Sanguínea Cirúrgica , Transfusão de Sangue/estatística & dados numéricos , Cesárea , Comorbidade , Cuidados Críticos , Feminino , Humanos , Histerectomia , Monitorização Intraoperatória , Equipe de Assistência ao Paciente , Placenta Acreta/diagnóstico por imagem , Gravidez , Estudos Retrospectivos , Reino UnidoRESUMO
PURPOSE: Gradient-Recalled Echo (GRE) Magnetic Resonance Imaging (MRI), which detects changes in blood vessel deoxyhaemoglobin content, has been investigated as a noninvasive monitor of changes in human tumor oxygenation and blood flow, in response to carbogen (95% O2, 5% CO2) breathing. METHODS AND MATERIALS: GRE images (TE = 60 ms, TR = 200 ms, alpha = 40 degrees, 256[2] matrix) were acquired from 31 patients with primary and metastatic disease, prior to and during carbogen breathing. Three patients underwent a follow-up examination after radiotherapy. RESULTS: Seventeen out of 34 tumors showed enhanced image intensity, consistent with an improvement in tumor oxygenation and blood flow, while 11 showed no response; 6 studies were technical failures. In one patient a metastatic node that had eluded orthodox investigation was visualized. A reduction in response was observed in the three patients studied postradiotherapy. CONCLUSION: This method, which can be performed on a standard clinical MRI instrument, provides a noninvasive measurement of tumor response to oxygenation/blood flow modification. In principle, this should enable the clinician to optimize treatment protocols, such as carbogen breathing, for individual radiotherapy patients.
Assuntos
Dióxido de Carbono/administração & dosagem , Imageamento por Ressonância Magnética/métodos , Neoplasias/irrigação sanguínea , Neoplasias/metabolismo , Oxigênio/administração & dosagem , Oxigênio/metabolismo , Administração por Inalação , Carcinoma de Células Escamosas/irrigação sanguínea , Carcinoma de Células Escamosas/metabolismo , Humanos , Metástase Linfática/diagnósticoRESUMO
The syntheses of several novel N-(hydroxydioxocyclobutenyl)-containing analogues of gamma-amino-butyric acid and L-glutamate were undertaken to test the hypothesis that derivatives of 3,4-dihydroxy-3-cyclobutene-1,2-dione (squaric acid), such as 3-amino-4-hydroxy-3-cyclobutene-1,2-dione, could serve as a replacement for the carboxylate moiety in neurochemically interesting molecules. The syntheses were successfully accomplished by preparation of a suitably protected diamine or diamino acid followed by reaction with diethyl squarate. Subsequent deprotection resulted in the isolation of the corresponding N-(hydroxydioxocyclobutenyl)-containing analogues 13, 14, and 18. These analogues were screened as displacers in various neurochemical binding site assays. The L-glutamate analogue 18, which showed high affinity as a displacer for kainate and AMPA binding, was also examined for agonist potency for CA1 pyramidal neurons of the rat hippocampal slice preparation. It rivaled AMPA as one of the most potent agonists for depolarizing pyramidal neurons in medium containing 2.4 mM Mg+2 ions in which kainate/AMPA receptors are active but NMDA receptors are inhibited (IC50 = 1.1 microM). It was 1 order of magnitude less potent for depolarizing pyramidal neurons under conditions in which kainate/AMPA receptors were inhibited by 10 microM CNQX but NMDA receptors were active in 0.1 mM Mg(+2)-containing medium (IC50 = 10 microM). Compound 18 did not induce sensitization of CA1 pyramidal cells to depolarization by phosphonate analogues of glutamate (the QUIS-effect).
Assuntos
Ciclobutanos/metabolismo , Ácido Glutâmico/análogos & derivados , Receptores de Glutamato/metabolismo , Animais , Cristalografia por Raios X , Ciclobutanos/química , Ácido Glutâmico/metabolismo , Hipocampo/efeitos dos fármacos , Hipocampo/metabolismo , Técnicas In Vitro , Estrutura Molecular , Ratos , Receptores de AMPA/antagonistas & inibidores , Receptores de AMPA/metabolismo , Receptores de GABA/metabolismo , Receptores de Ácido Caínico/antagonistas & inibidores , Receptores de Ácido Caínico/metabolismo , Receptores de N-Metil-D-Aspartato/antagonistas & inibidores , Receptores de N-Metil-D-Aspartato/metabolismoRESUMO
A simple pyramidal tube phantom has been designed to allow accurate location of a selected slice along the desired axis of a magnetic resonance scanner and to provide a check of the quality of slice selection. It is particularly helpful in locating the origin of any out-of-slice ghost artefacts. The geometry of the phantom allows the slice positions to be calculated readily.
Assuntos
Artefatos , Imageamento por Ressonância Magnética , Imagens de Fantasmas , Desenho de EquipamentoRESUMO
To evaluate the potential health effects of coal fly ash, a byproduct of coal combustion for electrical energy production, on the immune system, we studied the effects of trace elements found in fly ash on lymphocyte blastogenesis. Of the sixteen trace elements studied, seven inhibited lectin-induced lymphocyte division, six showed no inhibition and three produced inconsistent effects. The ranking of the toxicity of the elements is Mn, V, As (III), Cu, Cd, Se, and Be. Our data indicate that whole blood lectin-induced lymphocyte blastogenesis is a sensitive and reproducible test for in vitro screening of trace elements affecting the immune system.
Assuntos
Carbono/toxicidade , Carvão Mineral/análise , Ativação Linfocitária/efeitos dos fármacos , Oligoelementos/toxicidade , Cinza de Carvão , Humanos , Técnicas In Vitro , Material Particulado , Oligoelementos/análiseRESUMO
Tumour perfusion has been assessed in patients with advanced head and neck cancer using dynamic contrast enhanced MRI prior to and at completion of accelerated radiotherapy, and related to local tumour control. Sequential MRI scans, at 3 s intervals after intravenous injection of gadolinium using a dynamic scan sequence through a tumour region of interest (ROI), were performed in 13 patients with advanced head and neck cancer before and on completion of radiotherapy. The scans have been analysed in terms of maximum tumour enhancement (E), slope of the enhancement versus time curve and the time taken to reach maximum tumour enhancement (Tmax), and these parameters related to tumour outcome after radiotherapy. Local tumour control was related to the value of E on a post-radiotherapy scan and the difference in Tmax between a pre- and post-radiotherapy scan. Durable local control was seen in those tumours with a post-radiotherapy value for E of less than 8 and a mean fall in Tmax of 27.3 s. These results imply that tumours with diminished tumour perfusion at the end of radiotherapy are those most sensitive to treatment and that those tumours which show greater tumour enhancement after accelerated radiotherapy are likely to fail locally. This may reflect the persistence of viable perfused tumour at completion of radiotherapy.
Assuntos
Neoplasias de Cabeça e Pescoço/diagnóstico , Neoplasias de Cabeça e Pescoço/radioterapia , Imageamento por Ressonância Magnética/métodos , Meios de Contraste , Gadolínio DTPA , Neoplasias de Cabeça e Pescoço/irrigação sanguínea , Humanos , Valor Preditivo dos Testes , Resultado do TratamentoRESUMO
The gas mixture carbogen may be breathed by patients to enhance the oxygenation level and therefore the radiosensitivity of tumours. However, owing to the high CO2 content, its inhalation is associated with patient intolerance. Our aim was to determine a suitable carbon dioxide and oxygen gas mixture with similar enhancement of arterial oxygenation to 5% carbogen and with improved patient tolerance. 14 patients entered the study; of those 14, 8 were able to tolerate 2%, 3.5% and 5% carbogen mixtures as well as a control gas for sufficient time to allow successful arterial blood gas sampling. Gas exchange parameters were measured using a carbon dioxide monitor and a blood gas analyser. Arterial carbon dioxide tension ranged from 2.9 kPa to 6.82 kPa whilst breathing the carbogen mixtures, and arterial oxygen tension increased at least three-fold from basal values. There were no significant changes in the respiratory rate, heart rate and blood pH. The results suggest that 2% CO2 in O2 enhances arterial oxygen levels to a similar extent as 3.5% and 5% CO2 and that it is well tolerated.
Assuntos
Dióxido de Carbono/administração & dosagem , Dióxido de Carbono/sangue , Neoplasias de Cabeça e Pescoço/radioterapia , Oxigênio/administração & dosagem , Oxigênio/sangue , Neoplasias Pélvicas/radioterapia , Idoso , Idoso de 80 Anos ou mais , Gasometria/métodos , Neoplasias de Cabeça e Pescoço/fisiopatologia , Humanos , Masculino , Pessoa de Meia-Idade , Neoplasias Pélvicas/fisiopatologia , Troca Gasosa Pulmonar/fisiologia , Padrões de ReferênciaRESUMO
Tissue derived from embryogenic suspension cultures of cassava was bombarded with microparticles coated with a plasmid containing theuidA gene, which codes forß-glucuronidase (GUS). After 3 days, the effect of different bombardment parameters was evaluated by comparing the numbers of blue spots that resulted from histological GUS assays. Counting of blue spots was performed using a system comprised of a black and white video camera, a stereoscope and a personal computer. A reproducible counting method was established by optimizing GUS assay conditions, preparation of tissue samples and acquisition of video images in view of attaining the highest possible contrast between the blue spots and the surrounding tissue. The effects of bombardment pressure, microparticle size, number of bombardments, and osmotic pretreatment on GUS expression were investigated. Optimal transient expression of theuidA gene was observed after bombardment at 1100 psi, with a particle size of 1 µm, an osmotic pretreatment and two bombardments per sample. The highest number of blue spots observed was 2400 per square centimeter of bombarded tissue.
RESUMO
Culture procedures have been developed to facilitate the induction and maintenance of somatic embryogenic tissues in 14 out of 16 tested cultivars of sweet potato [Ipomoea batatas (L.) Lam]. Both the size of the axillary bud explant and the type of auxin were found to be critical for the successful induction of somatic embryogenesis. Of the five auxins screened 2,4-dichlorophenoxyacetic acid 2,4-D and 2,4,5-trichlorophenoxyacetic acid were the most effective, with use of the latter inducing the production of embryogenic tissues in 7 cultivars which responded poorly or not at all to 2,4-D. Procedures for secondary/cyclic embryogenesis, formation of mature embryos and their conversion to plants are also described.
RESUMO
A protocol was developed for Agrobacterium-mediated transformation of embryogenic suspension cultures of cassava. The bacterial strain ABI containing the binary vector pMON977 with the nptII gene as selectable marker and an intron-interrupted uidA gene (encoding ß-glucuronidase) as visible marker was used for the experiments. Selection of transformed tissue with paromomycin resulted in the establishment of antibiotic-resistant, ß-glucuronidase-expressing lines of friable embryogenic callus, from which embryos and subsequently plants were regenerated. Southern blot analysis demonstrated stable integration of the uidA gene into the cassava genome in five lines of transformed embryogenic suspension cultures and in two plant lines.