Physiological traits of endornavirus-infected and endornavirus-free common bean (Phaseolus vulgaris) cv Black Turtle Soup.

This study evaluated the physiological traits of eight lines of common bean (Phaseolus vulgaris) cv. Black Turtle Soup, four of which were double-infected with Phaseolus vulgaris endornavirus 1 and Phaseolus vulgaris endornavirus 2, and four of which were endornavirus-free. Plants from all eight lines were morphologically similar and did not show statistically significant differences in plant height, wet weight, number of days to flowering and pod formation, pods per plant, pod thickness, seed size, number of seeds per pod, and anthocyanin content. However, the endornavirus-infected lines had faster seed germination, longer radicle, lower chlorophyll content, higher carotene content, longer pods, and higher weight of 100 seeds, all of which were statistically significant. The endornaviruses were not associated with visible pathogenic effects.

[Therapeutic approach in urinary tract stones in children]. / Abordaje de la litiasis en tracto urinario en niños.

PURPOSE: Kidney stone disease in children is a rare pathology, with a low incidence in Spain (1/4,500 hospitalized children). The spontaneous expulsion rate is about 34-47% which means that more of 50% of children need active treatment. Paediatric patients forming urinary stones have a high risk of recurrence, therefore, a standard diagnosis and treatment are needed. We present our experience in urolithiasis treatment in children. MATERIALS AND METHODS: We reviewed retrospectively all the patients ≤ 16 years hospitalized in our hospital with urolithiasis diagnosis from 2000 to 2013, citing treatment modality, stone-free rates and complications. RESULTS: A total of 69 patients with a mean age of 8,2 years (range 1-16 years) were treated in our hospital during that period. The main clinical presentation was pain (52%). The diagnosis was made by abdominal ultrasounds in all cases. About localization, 21 lithiasis were found in distal urether (UD), 8 in medium urether (UM), 3 in proximal urether (UP) and 13 in renal pelvis (PR). The mean size was 13 mm. 21 (30%) patients had a spontaneous expulsion of the stone, 14 (20%) patients were treated with extracorporeal shock wave lithotripsy and in 22 (32%) patients the elected therapy was ureterosopic stone fragmentation (n = 13) or removal (n = 9). No complications were observed. The overall stone-free rate was 79% (n = 55). CONCLUSIONS: Kidney stone disease in children is a rare pathology, with its own features about diagnosis and treatment, which requires medical care in a specialized center. The optimal treatment should be considered regarding the age of the patient, localization and size of the stone, as well as the team experience.

[Genital-urinary rhabdomyosarcoma in childhood: our experience]. / Rabdomiosarcoma genitourinario en la infancia, nuestra experiencia.

INTRODUCTION: Rhabdomyosarcoma (RSM) becomes the most common tumour of the soft tissues during the paediatric age. It represents among 2-3% of child tumours. The genital-urinary location is the second most common location, only after head and neck. The treatment is usually medical, being the surgery a mere contribution, except for the cases in which the situation is not under control, when very aggressive surgery is necessary. The aim of this study is to analyse the cases of genial-urinary RMS that have been treated in our centre and the role that surgery has in their treatment. MATERIAL AND METHODS: Retrospective study of 20 patient (7 girls and 13 boys) with a median age of 24 months (range from 1 month to 12 years) with RMS in the aurochs-genial tract who have been treated in our hospital from 1990 to 2012. The variables described are demographic, location of the primary tumour, state at diagnosis, received treatment, both medical and surgical, with greater emphasis on the kind of surgery applied and monitoring in terms of survival. RESULTS: The location of the primary tumour was: bladder (6), paratesticular (5), vagina (3) retroperitoneal space (3), lesser pelvis (2) and prostate (1). All of them received medical treatment with chemotherapy and radiotherapy following International Society of Pediatric Oncology protocol after diagnostic biopsy. Surgery, which was always used as help, was: reappraisal of biopsy (1), orchiectomy (5), tumoral resection (8) and radical surgery (cystoprostatectomy or pelvic exenteration) in 6 patients. There were 3 deaths, 2 because of the evolution of the disease and 1 because of postoperative sepsis. The survival rate is 80% with a median follow - up of 14 years. CONCLUSIONS: The RMS is the most common tumour of soft tissues in childhood and the genital-urinary location is the second most common after the parameningeal one. The treatment is multidisciplinary and the surgery has a contributing role when there is no answer to the medical treatment or when there is a residual tumour even if some patients do not respond to medical treatment and they need a radical surgery for recovery.

INTRODUCCION: El rabdomiosarcoma (RMS) constituye el tumor de tejidos blandos más frecuente en la edad pediátrica, representando el 2-3% de los tumores infantiles. La localización genitourinaria es la segunda en frecuencia tras la cabeza y cuello. El tratamiento suele ser médico, quedando la cirugía como coadyuvante, excepto en casos no controlados en que se precisan cirugías muy agresivas. El objetivo del estudio es analizar los casos de RMS de localización genitourinaria tratados en nuestro Centro y el papel que la cirugía tiene en su tratamiento. MATERIAL Y METODOS: Estudio retrospectivo de 20 pacientes (7 niñas y 13 niños) con una mediana de edad de 24 meses (rango de 1 mes a 12 años) con RMS del tracto urogenital tratados en nuestro Hospital desde 1990 hasta 2012. Se describen variables demográficas, localización del tumor primario, estadio al diagnóstico, tratamiento recibido, tanto médico como quirúrgico, con especial atención al tipo de cirugía realizada y seguimiento en términos de supervivencia. RESULTADOS: La localización del tumor primario fue: vejiga (6), paratesticular (5), vagina (3), retroperitoneo (3), pelvis menor (2) y próstata (1). Todos recibieron tratamiento médico con quimioterapia y radioterapia según protocolo de la Sociedad Internacional de Oncología Pediátrica (SIOP) previa biopsia diagnóstica. La cirugía, practicada en todos los casos como coadyuvante fue: reevaluación por biopsia (1), orquiectomía (5), resección tumoral (8) y cirugía radical (cistoprostatectomía o exanteración pélvica) en 6 pacientes. Hubo 3 fallecimientos, 2 por progresión de la enfermedad y 1 por sepsis postoperatoria. Los 17 restantes están vivos, lo que supone una supervivencia del 80% con una mediana de seguimiento de 14 años. CONCLUSIONES: El RMS es el tumor de tejidos blandos más frecuente en la infancia y la localización genitourinaria la segunda en frecuencia tras las parameníngeas. El tratamiento es multidisciplinar y la cirugía tiene un papel coadyuvante en casos de no respuesta al tratamiento médico o de tumor residual aunque hay pacientes que no responden al tratamiento médico y precisan de cirugía radical para su curación.

Prevalence of basilar artery dolichoectasia in patients with acute ischemic stroke or transient ischemic attack in a single center of Spain. / Prevalencia de la dolicoectasia de la arteria basilar en pacientes con ictus isquémico agudo o ataque isquémico transitorio en un centro español.

INTRODUCTION: Basilar artery dolichoectasia (BADE) refers to abnormal enlargement or displacement of the basilar artery (BA). The previously reported prevalence of BADE among patients with stroke is 0.3 to 33.1%, however, it might vary among studied populations. We aim is to determine the prevalence of BADE in patients presenting with acute ischemic stroke (AIS) or transient ischemic attack (TIA) in a Stroke Unit in a single center in Spain. PATIENTS AND METHODS: Patients 50 years old or older presenting with AIS or TIA were eligible for inclusion. Demographic and clinical data were prospectively collected. Two neuroradiologists, blind to each other, assessed BA morphology. RESULTS: Among 126 patients, 34.1% fulfilled the criteria for BADE (ectasia or dolichosis). BADE was associated with advanced age (p = 0.04). Patients with fetal-type circle of Willis presented smaller BA diameters (2.9 ± 0.1 vs. 3.5 ± 0.1; p < 0.001), whereas patients with lacunar strokes presented a greater diameter than other stroke subtypes (3.8 ± 0.3 mm vs. 3.3 ± 0.1 mm; p = 0.04). DISCUSSION AND CONCLUSIONS: In this single-center study of patients presenting with AIS or TIA, the prevalence of BADE (ectasia or dolichosis) is high. Further studies focusing on Spaniards should confirm our results.

TITLE: Prevalencia de la dolicoectasia de la arteria basilar en pacientes con ictus isquémico agudo o ataque isquémico transitorio en un centro español.Introducción. La dolicoectasia de la arteria basilar (DEAB) es un término que se refiere a la dilatación o elongación anormal de la arteria basilar (AB). La prevalencia de DEAB notificada hasta la fecha en pacientes con ictus es del 0,3 al 33,1%; sin embargo, puede variar entre poblaciones. Se propuso determinar la prevalencia de DEAB en pacientes con ictus isquémico agudo (IIA) o ataque isquémico transitorio (AIT) en una unidad de ictus de España. Pacientes y métodos. Se consideró a pacientes de 50 años o más con IIA o AIT para ser incluidos. La información demográfica y clínica se obtuvo de forma prospectiva. Dos neurorradiólogos evaluaron la morfología de la AB de forma independiente. Resultados. De 126 pacientes, el 34,1% cumplió los criterios de DEAB (ectasia o dolicosis). La DEAB se asoció a mayor edad (p = 0,04). Los pacientes con la variante fetal del polígono de Willis presentaron menor diámetro de la AB (2,9 ± 0,1 frente a 3,5 ± 0,1; p < 0,001), mientras que pacientes con ictus lacunar presentaron diámetros mayores de la AB que otros subtipos de ictus (3,8 ± 0,3 mm frente a 3,3 ± 0,1 mm; p = 0,04). Discusión y conclusiones. En este estudio de centro único de pacientes con IIA o AIT, la prevalencia de DEAB (ectasia o dolicosis) fue alta. Estudios futuros enfocados en población española podrían confirmar nuestros resultados.

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana.

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3'), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

[Laparoscopic pyeloplasty in pediatric patients: our experience]. / Pieloplastia laparoscópica en la edad pediátrica. Nuestra experiencia.

The aim of this essay is to present our initial experience with laparoscopic pyeloplasty and highlight how some specific technical changes allowed us to improve our results. We performed a chart review of the patients that underwent laparoscopic pyeloplasty in our institution. We included patients older than 6 months old with proved stenosis of the ureteropelvic junction. We compared our first patients with the last ones in which we performed laterocolic approach in all left pyeloplasties and included a modification of the technique to place an external ureteric stent. We performed 13 laparoscopic pyeloplasties, 8 male patients and 5 female. There were 3 right pyeloplasties (23%) and 10 left ones (77%). We performed transmesocolic approach in 2 cases (left) and laterocolic approach in 11. Mean surgical time was 184 minutes in the first 8 cases and 142 in the 5 last ones. We had three cases of complications in the first group, two stents migrated to ureter and one postsurgical infection. In the last cases we had a postoperative bleeding. Laparoscopic approach is an effective option for pyeloplasty with similar results to those of the open approach in spite of a longer surgical time. Experience and specific surgical details allow us to reduce complication rate and surgical time.

Re-interventions following appendectomy in children: a multicenter study. / Reintervenciones tras apendicectomía en niños. Estudio multicéntrico.

INTRODUCTION: Acute appendicitis is the most frequent cause of acute abdomen in children. The objective of this study was to analyze the causes, approach, and results of complications requiring surgery following appendectomy. MATERIAL AND METHODS: A retrospective study of the appendectomies conducted in three third-level institutions from 2015 to 2019 was carried out. Complications, causes, and number of re-interventions, time from one surgery to another, surgical technique used, operative findings at baseline appendectomy according to the American Association for the Surgery of Trauma (AAST) classification, and hospital stay were collected. RESULTS: 3,698 appendicitis cases underwent surgery, 76.7% of which laparoscopically, with 37.2% being advanced (grades II-V of the AAST classification). Mean operating time was 50.4 minutes (49.8 ± 20.1 for laparoscopy vs. 49.9 ± 20.1 for open surgery, p > 0.05), and longer in patients requiring re-intervention (68.6 ± 27.2 vs. 49.1 ± 19.3, p < 0.001). 76 re-interventions (2.05%) were carried out. The causes included postoperative infection (n = 46), intestinal obstruction (n = 20), dehiscence (n = 4), and others (n = 6). Re-intervention risk was not impacted by the baseline approach used (open surgery or laparoscopy, OR: 1.044, 95% CI: 0.57-1.9), but it was by appendicitis progression (7.8% advanced vs. 0.7% incipient, OR: 12.52, 95% CI: 6.18-25.3). There was a tendency to use the same approach both at baseline appendectomy and re-intervention. This occurred in 72.2% of laparoscopic appendectomies, and in 67.7% of open appendectomies. The minimally invasive approach (50/76) was more frequent than the open one (27 laparoscopies and 23 ultrasound-guided drainages vs. 26 open surgeries) (p < 0.05). 55% of obstruction patients underwent re-intervention through open surgery (p > 0.05). CONCLUSION: Re-intervention rate was higher in advanced appendicitis cases. In this series, the minimally invasive approach (laparoscopic or ultrasound-guided drainage) was the technique of choice for re-interventions.

INTRODUCCION: La apendicitis aguda es la causa más frecuente de abdomen agudo en niños. El objetivo de este trabajo es estudiar las causas, abordaje y resultados de las complicaciones que requieren intervención quirúrgica después de la apendicectomía. MATERIAL Y METODOS: Estudio retrospectivo de las apendicectomías realizadas en 3 centros de tercer nivel entre 2015-2019. Se recogieron las complicaciones, causas y número de reintervenciones, intervalo entre ambas cirugías, técnica empleada, hallazgos operatorios según la Clasificación de la American Association for the Surgery of Trauma (AAST) en la apendicectomía inicial y tiempo de ingreso. RESULTADOS: Se intervinieron 3.698 apendicitis, un 76,7% por vía laparoscópica, encontrando un 37,2% evolucionadas (grado II-V de la clasificación AAST). El tiempo medio quirúrgico fue de 50,4 minutos (laparoscopia 49,8 ± 20,1 vs. laparotomía 49,9 ± 20,1, p > 0,05), superior en aquellos pacientes que requirieron reintervención (68,6 ± 27,2 vs. 49,1 ± 19,3, p < 0,001). Se realizaron 76 reintervenciones (2,05%). Las causas fueron: infección postoperatoria (n = 46), obstrucción intestinal (n = 20), dehiscencia (n = 4) y otras (n = 6). El abordaje inicial no influyó en el riesgo de reintervención (laparotomía o laparoscopia, OR 1,044, IC 95% 0,57-1,9), pero sí el grado de evolución de la apendicitis (7,8% evolucionadas vs. 0,7% incipientes, OR 12,52, IC 95% 6,18-25,3). Hubo una tendencia a reintervenir por el mismo abordaje que la apendicectomía, esto ocurrió en un 72,2% de las apendicectomías laparoscópicas y en un 67,7% de las apendicectomías abiertas. El abordaje mínimamente invasivo (50/76) fue más frecuente que la laparotomía (27 laparoscopias y 23 drenajes ecoguiados frente a 26 laparotomías) (p < 0,05). El 55% de los pacientes obstruidos se reintervinieron por vía abierta (p > 0,05). CONCLUSION: El índice de reintervención fue superior en las apendicitis evolucionadas. En esta serie, el abordaje mínimamente invasivo (laparoscópico o drenaje ecoguiado) fue la técnica de elección en las reintervenciones.

A novel monopartite dsRNA virus from rhododendron.

A dsRNA molecule of 3.4 kbp was extracted from two great rhododendron samples from Great Smoky Mountains National Park. Sequencing of this molecule suggests that it represents the genome of an undescribed virus, for which the provisional name rhododendron virus A (RhVA) is proposed. In phylogenetic analyses, this virus clustered together with southern tomato virus and related viruses, forming a coherent and distinct clade among dsRNA viruses. RhVA likely belongs to a yet-to-be-established taxon of viruses with a non-segmented dsRNA genome.

Molecular cloning and characterization of a type 3 iodothyronine deiodinase in the pine snake Pituophis deppei.

The three distinct but related isotypes of the iodothyronine deiodinase family: D1, D2, and D3, have been amply studied in vertebrate homeotherms and to a lesser extent in ectotherms, particularly in reptiles. Here, we report the molecular and kinetic characteristics of both the native and the recombinant hepatic D3 from the pine snake Pituophis deppei (PdD3). The complete PdD3 cDNA (1680 bp) encodes a protein of 287 amino acids (aa), which is the longest type 3 deiodinase so far cloned. PdD3 shares 78% identity with chicken and 71% with its other orthologs. Interestingly, the hinge domain in D3s, including PdD3, is rich in proline. This structural feature is shared with D1s, the other inner-ring deiodinases, and deserves further study. The kinetic characteristics of both native and recombinant PdD3 were similar to those reported for D3 in other vertebrates. True K(m) values for T(3) IRD were 9 and 11 nM for native and recombinant PdD3, respectively. Both exhibited a requirement for a high concentration of cofactor (40 mM DTT), insensitivity to inhibition by PTU (>2 mM), and bisubstrate, sequential-type reaction kinetics. In summary, the present data demonstrate that the liver of the adult pine snake P. deppei expresses D3. Furthermore, this is the first report of the cloning and expression of a reptilian D3 cDNA. The finding of hepatic D3 expression in the adult pine snake P. deppei is consistent with results in adult piscine species in which the dietary T(3) content seems to regulate liver deiodinase expression. Thus, our present results support the proposal that hepatic D3 in adult vertebrates plays a sentinel role in avoiding an inappropriate overload of exogenous T(3) secondary to feeding in those species that devour the whole prey.

Effects of herbage ingestion upon ileal digestibility of amino acids in heavy Iberian pigs fed on an acorn-based diet.

We conducted two experiments with heavy Iberian pigs to determine the ileal digestibility of amino acids (AA) in acorns and freshly cut herbage, and the effects of adding fresh herbage upon the supply of ileal digestible AA when pigs were fed on holm-oak acorns. In Experiment 1, carried out in cannulated pigs of 107 kg bodyweight (BW), daily intake of acorns reached 44.9 g DM/kg(0.75) BW. Arg, His and Thr showed the lowest apparent ileal digestibility (AID) values, whereas Met, the branched-chain AA and Phe had the highest coefficients. The AID of total EAA was 0.716 but only 0.222 for NEAA. Most of the digestive and absorptive processes of acorn protein occurred before the hindgut. Acorn provides (per kg DM) 2.27 g apparent ileal digestible Lys and 22.7 g apparent total digestible AA. Standardized ileal digestibility (SID) values for EAA, NEAA and total AA were 0.924 ± 0.020, 0.784 ± 0.041 and 0.860 ± 0.029. In Experiment 2 fresh herbage was given to six cannulated Iberian pigs of 140 kg either as a single feed (13.7 g DM/kg(0.75) BW) or as a supplement to acorns (28.4 g DM/kg(0.75) BW). When only freshly cut forage was offered the AID of the EAA, NEAA and total AA was close to 0.65 and supplied (per kg DM ingested) 5.61 g AID Lys and 91.7 g digestible AA. Standardized ileal values were 0.744 ± 0.023, 0.912 ± 0.038 and 0.831 ± 0.030 respectively. The addition of fresh forage to the acorns led to a significant decrease in AID of AA in acorn due to digesta transfer to the hindgut: His (p < 0.01), Met (p < 0.001), Phe (p = 0.092), Thr (p < 0.05) and Val (p < 0.05), but Arg, Lys and the branched-chain AA remained unaffected. The main contribution of herbage to AA nutrition of the grazing Iberian pig relies mainly on increasing the supply of digestible AA for pig tissues.

Substrain-related dependence of Cu(I)-ATPase activity among prion protein-null mice.

The prion protein (PrPC) binds copper and affects copper metabolism, albeit among a poorly understood functional landscape. Much of the data on physiological roles of PrPC were obtained in mice of mixed genetic background deficient of the PrPC-coding gene Prnp. This strategy is currently under scrutiny due to the flanking gene problem, in particular related with a polymorphism, typical of both the 129Sv and 129Ola mouse substrains, in the Sirpa gene located in the vicinity of Prnp. Here we report an investigation of biochemical properties of Cu(I)-ATPases as a function of genotype in two strains of PrPC-deficient mice. We found that both the brain and liver of Prnp-null mice of mixed B6;129Sv background had diminished activity, accompanied by increased catalytic phosphorylation of Cu(I)-ATPase, as compared with the respective wild-type animals. However, no such differences were found between Prnp-null and wild-type mice of a B10;129Ola background. Activity of Cu(I)-ATPase was strongly reduced in brain tissue from mice of 129Sv strain, when compared with wild-type either of B6;129Sv, and especially of mice of the B6 strain. No differences between wild-type and Prnp-null brain tissue were noted in the expression of either Atp7a or b genes, and RFLP analysis indicated that the Sirpa129 polymorphism was present in both the B6;129Sv and B10;129Ola Prnp-null mouse colonies used in this study. The results suggest a novel substrain-dependent effect of 129Sv, but not 129Ola, genotype upon the regulation of the Cu(I)-ATPase catalytic cycle in Prnp-null mice, rather than either a Prnp-dependent, or a 129 strain-dependent effect.

Genealogical data of Boer and Nubian goats in Mexico.

The pedigree file of the Boer and Nubian goat breeds in Mexico was constructed using the national database provided by the Asociación Mexicana de Criadores de Ganado Caprino de Registro. Field technicians routinely updated the goat national database by recording information from flocks participating in the performance-recording system. Information on animal identification number, parents, birth date, sex, breed, and farm of origin were used to undertake pedigree analyses using the ENDOG program (version 4.8). This paper presents a pedigree data file, tables and figures of characteristics of pedigree data, pedigree analyses, pedigree integrity, effective population size and genetic conservation index. The data can be used to estimate other population parameters, to monitor the genetic diversity of the Boer and Nubian goat breeds in Mexico, and also to design balanced breeding programs, maintaining genetic variation at reasonable levels and maximizing genetic progress in these populations.

Development and full validation of a multiresidue method for the analysis of a wide range of pesticides in processed fruit by UHPLC-MS/MS.

A reliable 16-min analytical method for the simultaneous determination of 250 pesticides in processed fruit using ultra-performance liquid chromatography, coupled to tandem mass spectrometry (UHPLC-MS/MS), was developed and validated according to SANTE 11813/2017 guidelines and accredited successfully based on ISO 17025. Extraction was achieved using a modified QuEChERS method, without any clean-up, including a dilution to obtain good peak shapes and to reduce matrix effects. Pesticides were quantified using matrix-matched calibration, and the method was validated in terms of relative retention time window, linearity (6-167 µg kg-1 and 0.6-16.7 µg kg-1, coefficient R2 ≥ 0.98), trueness (recovery of 70-120%), selectivity, precision (RSD ≤ 20%), limits of quantification (LOQs = 0.6-6.0 µg kg-1) and uncertainty. Finally, the method was applied to the routine analysis of 103 samples of processed fruits, detecting the presence of several pesticide residues, such as fluopyram, spinosad or cyprodinil (0.006-0.22 mg kg-1).

Evidence of exposure to zoonotic flaviviruses in zoo mammals in Spain and their potential role as sentinel species.

A serosurvey was carried out to assess emerging flavivirus exposure in zoo mammals in Spain and to determine the dynamics of seropositivity in species that were longitudinally sampled during the study period. Sera from 570 zoo animals belonging to 120 mammal species were collected at ten zoos (A-J) in Spain between 2002 and 2019. Twenty-one of these animals, belonging to ten different species, were sampled longitudinally at four of the zoos during the study period. Antigenically-related flavivirus antibodies were detected in 19 (3.3 %; 95 %CI: 2.0-5.2) of the 570 animals analyzed using bELISA. Seropositivity was observed in ten (8.3 %) of the 120 species tested. Five (23.8 %) of the 21 animals sampled more than once presented seropositivity in all samplings whereas seroconversion was only observed in one white rhinoceros (Ceratotherium simum). Flavivirus antibodies were found at six of the ten sampled zoos and in consecutive years between 2008 and 2018. Virus neutralization tests confirmed West Nile virus (WNV), Usutu virus (USUV) and tick-borne encephalitis virus (TBEV) infection in ten (1.8 %; 95 %CI: 0.7-2.8), five (0.9 %; 95 %CI: 0.1-1.6) and one (0.2 %; 95 %CI: 0.0-0.5) animal, respectively. Antibodies against Meaban virus (0 %; 95 %CI: 0.0-0.7 %) were not found in the tested sera. The results demonstrate WNV, USUV and TBEV exposure in zoo mammals, which may be of public health and conservation concern. Seropositivity to WNV and USUV was detected in regions where these viruses have not been reported previously. Anti-WNV antibodies found in zoo animals sampled in 2009 point to WNV circulation at least one year before the first outbreaks were reported in horses and humans in Spain. Our results indicate that zoo mammals could be useful sentinel species for monitoring emerging flavivirus activity in urban areas.

[Continuous glucose monitoring system in the screening of glucose disorders in cystic fibrosis]. / Monitorización continua de glucosa para cribado de alteraciones hidrocarbonadas en fibrosis quística.

BACKGROUND: Diabetes mellitus (DM) is an increasing complication of cystic fibrosis (CF). It is associated with enhance morbidity. Continuous glucose monitoring system (CGMS) could detect glucose disorders earlier than other screening tests usually used. AIMS: To compare oral glucose tolerance test (OGTT), HbA(1c) and CGMS in patients with CF and recent disorders of glucose homeostasis and to analyse changes in nutritional status and/or pulmonary function. PATIENTS AND METHODS: Thirteen patients with CF (11-22 years, 7 males) were studied using OGTT, HbA(1c) and CGMS. All of them had newly diagnosed glucose disturbances. They were not receiving steroid therapy or had an underlying illness. In all subjects we compared: HbA(1c) levels (%), fasting and 2-hours glucose OGTT (mg/dl) and glucose CGMS values (overall, fasting, 2-hours post mean-meals and excursions >140mg/dl at any time). Furthermore, body mass index, forced expiratory volume in the first second (%) and forced vital capacity (%) were evaluated in the previous year and at the time of the study. We also analysed exocrine pancreatic function and CF-mutation. RESULTS: Mean age at diagnosis of glucose disturbance was 16.4 years. All patients had insufficient exocrine pancreatic function and 11/13 presented DeltaF508 CF-mutation. Only one patient was diagnosed with DM using OGGT and 7/13 (53.8%) with CGMS. A total 77% of patients had poor nutritional status and/or pulmonary function at time of diagnosing the glucose disorder. Only 4 patients had abnormal HbA(1c) levels. CONCLUSIONS: CGMS allows a better detection of glucose disorders than OGTT. Glucose homeostasis abnormalities are associated with a decrease in nutritional status and/or pulmonary function. HbA(1c) does not aid in the early diagnose of glucose disorders.

Technical challenges of endoscopic treatment for vesicoureteral reflux after Cohen reimplantation. / Consideraciones técnicas en el tratamiento endoscópico del reflujo vesicoureteral tras reimplante tipo Cohen.

INTRODUCTION: The range of indications for endoscopic treatment of vesicoureteral reflux opens more and more until including correction of secondary reflux (VUR) after ureteral reimplantation. However these cases suppose a technical challenge due to postoperative changes. The aim of this work is to present our experience on endoscopic treatment for VUR in ureteral units with Cohen reimplantation surgery, with special interest in the technical peculiarities of the procedure. MATERIAL AND METHODS: A retrospective study of cases of secondary VUR after reimplantation surgery treated by subureteral injection. TECHNIQUE: We put the needle perpendicular to submucous tunnel and inject medially to hole forming a wheal on the anterior face that occludes the meatus RESULTS: During the 1993-2016 period 21 injections were performed in 15 ureteral units. The ureteral pathology included primary VUR (4), duplex system with lower pole reflux (4), megaureter (3) and ureterocele (2). Average patient age was 5.7 years old (2-12). Succesful outcome had been got in 10 ureteral units (66.67%), a decrease of VUR grade in 4 (26.67%) and perseverance/no resolution of grade IV VUR in 1 (6.67%) DISCUSSION: The anti-reflux mechanism of reimplantation depends on optimizing the submucosous tunnel. This subgroup of pacients is small and there are few studies, hindering the agreement on the most appropiate technique. CONCLUSION: Endoscopic treatment of secondary reflux after reimplantation surgery is a procedure with certain technical feature, but safe and effective offering an alternative prior to surgical reoperation.

Dataset on growth curves of Boer goats fitted by ten non-linear functions.

Data on the description of growth of female Boer goats from the Mexican national breeding flock are presented. Goat meat is highly appreciated for the preparation of traditional dishes of Mexican cuisine, and its demand is on the rise. Boer goats are of relatively recent arrival in Mexico and the size of the performance-recorded flock has been increasing steadily in the last ten years. Repeated measures of body weight at different ages from birth to adulthood of Boer goats are scarce. When available, such data can be used to describe the growth pattern and the meat production potential of goat meat breeds such as the Boer. This paper presents data on estimators of growth curve parameters, plots of average predicted growth curves, plots of residuals on age, and data on goodness of fit statistics of ten non-linear functions fitted to describe the growth curve of Boer goats.

Solving matrix effects exploiting the second-order advantage in the resolution and determination of eight tetracycline antibiotics in effluent wastewater by modelling liquid chromatography data with multivariate curve resolution-alternating least squares and unfolded-partial least squares followed by residual bilinearization algorithms II. Prediction and figures of merit.

A new powerful algorithm (unfolded-partial least squares followed by residual bilinearization (U-PLS/RBL)) was applied for first time on second-order liquid chromatography with diode array detection (LC-DAD) data and compared with a well-known established method (multivariate curve resolution-alternating least squares (MCR-ALS)) for the simultaneous determination of eight tetracyclines (tetracycline, oxytetracycline, meclocycline, minocycline, metacycline, chlortetracycline, demeclocycline and doxycycline) in wastewaters. Tetracyclines were pre-concentrated using Oasis Max C18 cartridges and then separated on a Thermo Aquasil C18 (150 mm x 4.6mm, 5 microm) column. The whole method was validated using Milli-Q water samples and both univariate and multivariate analytical figures of merit were obtained. Additionally, two data pre-treatment were applied (baseline correction and piecewise direct standardization), which allowed to correct the effect of breakthrough and to reduce the total interferences retained after pre-concentration of wastewaters. The results showed that the eight tetracycline antibiotics can be successfully determined in wastewaters, the drawbacks due to matrix interferences being adequately handled and overcome by using U-PSL/RBL.

Inferring genetic parameters of lactation in Tropical Milking Criollo cattle with random regression test-day models.

This study inferred genetic and permanent environmental variation of milk yield in Tropical Milking Criollo cattle and compared 5 random regression test-day models using Wilmink's function and Legendre polynomials. Data consisted of 15,377 test-day records from 467 Tropical Milking Criollo cows that calved between 1974 and 2006 in the tropical lowlands of the Gulf Coast of Mexico and in southern Nicaragua. Estimated heritabilities of test-day milk yields ranged from 0.18 to 0.45, and repeatabilities ranged from 0.35 to 0.68 for the period spanning from 6 to 400 d in milk. Genetic correlation between days in milk 10 and 400 was around 0.50 but greater than 0.90 for most pairs of test days. The model that used first-order Legendre polynomials for additive genetic effects and second-order Legendre polynomials for permanent environmental effects gave the smallest residual variance and was also favored by the Akaike information criterion and likelihood ratio tests.