Excessive apoptosis of Rip1-deficient T cells leads to premature aging.

In mammals, the most remarkable T cell variations with aging are the shrinking of the naïve T cell pool and the enlargement of the memory T cell pool, which are partially caused by thymic involution. However, the mechanism underlying the relationship between T-cell changes and aging remains unclear. In this study, we find that T-cell-specific Rip1 KO mice show similar age-related T cell changes and exhibit signs of accelerated aging-like phenotypes, including inflammation, multiple age-related diseases, and a shorter lifespan. Mechanistically, Rip1-deficient T cells undergo excessive apoptosis and promote chronic inflammation. Consistent with this, blocking apoptosis by co-deletion of Fadd in Rip1-deficient T cells significantly rescues lymphopenia, the imbalance between naïve and memory T cells, and aging-like phenotypes, and prolongs life span in T-cell-specific Rip1 KO mice. These results suggest that the reduction and hyperactivation of T cells can have a significant impact on organismal health and lifespan, underscoring the importance of maintaining T cell homeostasis for healthy aging and prevention or treatment of age-related diseases.

Natural variation in Fatty Acid 9 is a determinant of fatty acid and protein content.

Soybean is one of the most economically important crops worldwide and an important source of unsaturated fatty acids and protein for the human diet. Consumer demand for healthy fats and oils is increasing, and the global demand for vegetable oil is expected to double by 2050. Identification of key genes that regulate seed fatty acid content can facilitate molecular breeding of high-quality soybean varieties with enhanced fatty acid profiles. Here, we analysed the genetic architecture underlying variations in soybean seed fatty acid content using 547 accessions, including mainly landraces and cultivars from northeastern China. Through fatty acid profiling, genome re-sequencing, population genomics analyses, and GWAS, we identified a SEIPIN homologue at the FA9 locus as an important contributor to seed fatty acid content. Transgenic and multiomics analyses confirmed that FA9 was a key regulator of seed fatty acid content with pleiotropic effects on seed protein and seed size. We identified two major FA9 haplotypes in 1295 resequenced soybean accessions and assessed their phenotypic effects in a field planting of 424 accessions. Soybean accessions carrying FA9H2 had significantly higher total fatty acid contents and lower protein contents than those carrying FA9H1 . FA9H2 was absent in wild soybeans but present in 13% of landraces and 26% of cultivars, suggesting that it may have been selected during soybean post-domestication improvement. FA9 therefore represents a useful genetic resource for molecular breeding of high-quality soybean varieties with specific seed storage profiles.

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Real-world evidence on treatment pattern, effectiveness, and safety of blinatumomab in Chinese patients with B-cell acute lymphoblastic leukemia.

Blinatumomab is efficacious in patients with B-cell acute lymphoblastic leukemia (B-ALL), yet limited real-world data exists in this context. This retrospective study provided real-world data on the treatment pattern, effectiveness, and safety of blinatumomab in Chinese patients with newly diagnosed (ND) and relapsed/refractory (R/R) B-ALL. Patients with B-ALL who received at least one dose of blinatumomab in frontline or R/R settings between August 2021 and June 2023 were included. The primary outcome was the treatment pattern of blinatumomab. Key secondary outcomes included complete remission (CR)/CR with incomplete blood cell recovery (CRi) rate, minimal residual disease (MRD) negativity, median event-free survival (EFS), and safety. The study included 96 patients with B-ALL; 53 (55.2%) patients were in the ND group and 43 (44.8%) patients were in the R/R group. The median treatment duration was one cycle (range: 1-5). Most patients underwent chemotherapies, allo-HSCT, or experimental CAR-T following blinatumomab. The ND patients using blinatumomab induction therapy achieved 100% CR/CRi rate; 87.2% achieved MRD negativity within two cycles of blinatumomab. In R/R re-induction patients, the CR/CRi rate was 50%; MRD negativity rate was 64.2%. In R/R patients using blinatumomab for consolidation, MRD negativity rate was 90.9%. The median EFS was not reached in both ND and R/R patients; 1-year EFS rate was 90.8% (95% CI: 67%, 97%) and 55.1% (95% CI: 30%, 74%), respectively. Grade ≥ 3 adverse events were observed in 12.5% patients. Blinatumomab was found to be effective with a tolerable safety profile in real world setting.

Aberrant Fetal Brain Sulcus Formation: A Clue to the Diagnosis of Sotos Syndrome.

OBJECTIVE: This study aims to elucidate two distinct fetal ultrasound features associated with aberrant brain sulcus formation as potential prenatal markers for Sotos syndrome caused by mutations in the NSD1 gene. METHOD: This retrospective study investigated three fetuses across two pregnancies, including a pair of monochorionic diamniotic twins, all diagnosed with Sotos syndrome via whole exome sequencing (WES). Comprehensive clinical and laboratory data were collected and analyzed. Each fetus underwent a series of specialized neurosonographic assessments to evaluate the development of the cerebral cortex. RESULTS: All three fetuses exhibited aberrant brain sulcus formation characterized by Sylvian fissure (SF) abnormalities and shallow parietooccipital sulcus (POS). WES revealed the presence of two de novo NSD1 variants in these fetuses. CONCLUSIONS: Fetal aberrant brain sulcus formation may represent a distinctive ultrasound feature indicative of Sotos syndrome, thereby offering additional diagnostic insights for the identification of this condition.

Clinical Application of CT Imaging Grading System in Upper Urinary Tract Calculi with Kidney Infection.

PURPOSE: This study aimed to establish a CT imaging grading system and explore its value in evaluating upper urinary tract calculi associated with kidney infections. METHODS: CT images of 126 patients with kidney infections caused by upper urinary tract calculi were retrospectively analyzed. The CT grading system was developed based on CT images. CT images were classified into 4 grades. General information, symptoms, and clinical findings of patients in different CT grades were analyzed. With the occurrence of systemic inflammatory response syndrome (SIRS) as the endpoint, univariate and multivariate analysis was conducted to analyze the risk factors of SIRS. RESULTS: Patients with fever or diabetes had higher CT grades, and the following examination data revealed significant differences across the various CT grades (P < 0.05): the white blood cell count, urine leucocytes count, CT1, CT2, maximum body temperature, duration of disease, the proportion of blood neutrophils, the size of stones, and levels of the C-reactive protein and procalcitonin. Only CT grading was statistically significant after multivariate analysis. According to the values of the partial regression coefficient (B), the higher the CT grade, the greater the risk of SIRS. The risk of SIRS was 4.472 times higher with each increment of the CT grade. CONCLUSIONS: The CT grade is directly associated with clinical symptoms and the risk of SIRS.

Characteristics and significance of programmed cell death-related gene expression signature in skin cutaneous melanoma.

BACKGROUND: Programmed cell death (PCD) pathways play crucial roles in the pathogenesis of skin cutaneous melanoma (SKCM). Understanding their prognostic significance and clinical implications is imperative for the development of personalized treatment strategies. METHODS: A total of 1466 PCD-related genes were analyzed using data from The Cancer Genome Atlas (TCGA)-SKCM cohort (n = 353). Prognostic cell death index (CDI) was established and validated through survival analysis and predictive modeling. Functional enrichment, protein-protein interaction (PPI), consensus clustering, and tumor microenvironment assessment and drug sensitivity analysis were performed to elucidate the biological and clinical relevance of CDI. RESULTS: CDI effectively stratified SKCM patients into high and low-risk groups, demonstrating significant differences in survival outcomes. It exhibited predictive value for survival at 1, 3, and 5 years. The concordance index (C-index) was 0.794 in the training set, and 0.792 and 0.821 in the internal and external validation sets, respectively. The corresponding area under curve (AUC) was all above 0.75 in these data sets. Functional enrichment analysis revealed significant associations with immune response and inflammatory processes. PPI analysis identified key molecular modules associated with apoptosis and chemokine signaling. Consensus clustering unveiled three discernible subtypes demonstrating notable disparities in survival outcomes based on CDI expression profiles. Assessment of the tumor microenvironment highlighted correlations with immune cell infiltration such as M1 macrophages and T cells. Drug sensitivity analysis indicated tight correlations between CDI levels and response to immunotherapy. CONCLUSION: Our comprehensive analysis establishes the prognostic significance of PCD-related genes in SKCM. CDI emerges as a promising prognostic biomarker, offering insights into tumor biology and potential implications for personalized treatment strategies. Further validation and clinical integration of CDI are warranted to improve SKCM management and patient outcomes.

Mechanism of biliary atresia caused by T follicular helper cells-induced immune injury.

BACKGROUND: Biliary atresia (BA) has diverse and unclear pathogenesis, which may be related to immune response in response to a foreign stimulus. T follicular helper (Tfh) cells have been found to play an important role in various immune diseases. AIMS: To investigate the expression of Tfh cells in BA and non-BA cholestatic diseases in children. METHODS: Transcriptome sequencing and Gene Ontology (GO) enrichment analysis were performed to investigate the differences in gene expression between the BA group and the non-BA cholestasis group. Study the distribution of Tfh cells in liver tissues of the BA and non-BA cholestatic groups through single sample gene set enrichment analysis (ssGSEA). Tfh cells (CD3+Bcl6+) in liver tissues from BA patients were labeled by double immunofluorescent staining to verify their distribution in the liver. RESULTS: Transcriptome sequencing showed differences in gene expression between the BA group and the non-BA cholestasis group. A total of 808 genes were up-regulated and 405 genes were down-regulated in BA, suggesting that there might be a specific immune response in BA. GO enrichment analysis showed that BA group had augmented response to foreign stimulus and increased metabolic process compared to the non-BA cholestatic group. The relative proportion of immune cells was analyzed by ssGSEA method. The proportions of Tfh cells, activated B cells, CD4+ T cells, memory B cells and Th2 cells were higher in the BA group than in the non-BA cholestatic group. Fluorescence immunostaining showed that Tfh cells were significantly increased in liver tissue samples of the BA group compared to the non-BA cholestasis group, which was consistent with the transcriptome sequencing results. CONCLUSION: Tfh cells share in immune cascade involvement in BA. Our work support immune pathogenesis of the in response to a stimulus that might be foreign in BA.

Synthesis of 2-phenylnaphthalenoid amide derivatives and their topoisomerase IIα inhibitory and antiproliferative activities.

Topoisomerases are highly associated with cell proliferation, becoming an important target for the development of antitumor drugs. 2-Phenylnaphthalenoids (2PNs) have been identified as human DNA topoisomerase IIα (TopoIIα) inhibitors. In this study, based on the 2PN scaffold, 20 amide derivatives (J1-J10, K1-K10) were synthesized. Among them, K10 showed high TopoIIα inhibitory activity and stronger antiproliferation activity against HepG-2 and MDA-MB-231 cells (IC50 0.33 and 0.63 µM, respectively) than the positive control VP-16 (IC50 9.19 and 10.86 µM) and the lead F2 (IC50 0.64 and 1.51 µM). Meanwhile, K10 could also inhibit migration and promote apoptosis of HepG-2 and MDA-MB-231 cells. Therefore, K10 can be developed into a potent TopoIIα inhibitor as an antitumor agent. The structure-activity relationship was also discussed.

GmANKTM21 Positively Regulates Drought Tolerance and Enhanced Stomatal Response through the MAPK Signaling Pathway in Soybean.

Drought stress is one of the significant abiotic stresses that limit soybean (Glycine max [L.] Merr.) growth and production. Ankyrin repeat (ANK) proteins, being highly conserved, occupy a pivotal role in diverse biological processes. ANK genes were classified into nine subfamilies according to conserved domains in the soybean genome. However, the function of ANK-TM subfamily proteins (Ankyrin repeat proteins with a transmembrane domain) in the abiotic-stress response to soybean remains poorly understood. In this study, we first demonstrated the subcellular localization of GmANKTM21 in the cell membrane and nucleus. Drought stress-induced mRNA levels of GmANKTM21, which encodes proteins belonging to the ANK-TM subfamily, Transgenic 35S:GmANKTM21 soybean improved drought tolerance at the germination and seedling stages, with higher stomatal closure in soybean, lower water loss, lower malondialdehyde (MDA) content, and less reactive oxygen species (ROS) production compared with the wild-type soybean (Dongnong50). RNA-sequencing (RNA-seq) and RT-qPCR analysis of differentially expressed transcripts in overexpression of GmANKTM21 further identified potential downstream genes, including GmSPK2, GmSPK4, and GmCYP707A1, which showed higher expression in transgenic soybean, than those in wild-type soybean and KEGG enrichment analysis showed that MAPK signaling pathways were mostly enriched in GmANKTM21 overexpressing soybean plants under drought stress conditions. Therefore, we demonstrate that GmANKTM21 plays an important role in tolerance to drought stress in soybeans.

A highly efficient soybean transformation system using GRF3-GIF1 chimeric protein.

Expression of GRF3-GIF1 chimera significantly enhanced regeneration and transformation efficiency in soybean, increasing the number of transformable cultivars. Moreover, GmGRF3-GIF1 can be combined with CRISPR/Cas9 for highly effective gene editing.

Amorphous Nitrogen-Doped Carbon Nanocages with Excellent SERS Sensitivity and Stability for Accurate Identification of Tumor Cells.

The surface-enhanced Raman scattering (SERS) bioprobe's strategy for identifying tumor cells always depended on the intensity difference of the Raman signal compared with that of normal cells. Hence, exploring novel SERS nanostructure with excellent spectra stability, a high enhancement factor (EF), and good biocompatibility is a primary premise for boosting SERS signal reliability and accuracy of tumor cells. Here, high SERS EF (5.52 × 106) is acquired by developing novel amorphous nitrogen-doped carbon (NDC) nanocages (NCs), whose EF value was in a leading position among carbon-based SERS substrates. In addition, a uniform SERS signal was obtained on NDC NCs due to homogeneous morphology and size. The delocalized carbon-conjugated systems of graphitic-N, pyrrole-N, and pyridine-N with lone pair electrons increase the electronic density of states and reduce the electron localization function of NDC NCs, thereby promoting the charge transfer process. The electron-donor platform of the NDC NCs facilitates the thermodynamic process of charge transfer, resulting in multimode vibrational coupling in the surface complexes, which greatly amplifies the molecular polarizability. Importantly, the good biocompatibility and signal stability endow these NDC NC SERS bioprobes unique superiority in distinguishing tumor cells, and quantitative recognition of two triple-negative breast cancer cells based on SERS detection mode has been successfully realized.

Boosting the oxygen reduction reaction activity of dual-atom catalysts on N-doped graphene by regulating the N coordination environment.

Development of low-cost and high-efficiency oxygen reduction reaction (ORR) catalysts is of significance for fuel cells and metal-air batteries. Here, by regulating the N environment, a series of dual-atom embedded N5-coordinated graphene catalysts, namely M1M2N5 (M1, M2 = Fe, Co, and Ni), were constructed and systematically investigated by DFT calculations. The results reveal that all M1M2N5 configurations are structurally and thermodynamically stable. The strong adsorption of *OH hinders the proceeding of ORR on the surface of M1M2N5, but M1M2N5(OH2) complexes are formed to improve their catalytic activity. In particular, FeNiN5(OH2) and CoNiN5(OH2) with the overpotentials of 0.33 and 0.41 V, respectively, possess superior ORR catalytic activity. This superiority should be attributed to the reduced occupation of d-orbitals of Fe and Co atoms in the Fermi level and the apparent shift of dyz and dz2 orbitals of Ni atoms towards the Fermi level after adsorbing *OH, thus regulating the active sites and exhibiting appropriate adsorption strength for reaction intermediates. This work provides significant insight into the ORR mechanism and theoretical guidance for the discovery and design of low-cost and high-efficiency graphene-based dual-atom ORR catalysts.

Mediation effect of maternal triglyceride and fasting glucose level on the relationship between maternal overweight/ obesity and fetal growth: a prospective cohort study.

BACKGROUND: Previous studies have suggested that maternal overweight/obesity is asscociated with macrosomia. The present study aimed to investigate the mediation effects of fasting plasma glucose (FPG) and maternal triglyceride (mTG) in the relationship between maternal overweight/obesity and large for gestational age (LGA) among non-diabetes pregnant women. METHODS: This prospective cohort study was conducted in Shenzhen from 2017 to 2021. A total of 19,104 singleton term non-diabetic pregnancies were enrolled form a birth cohort study. FPG and mTG were measured at 24-28 weeks. We analyzed the association of maternal prepregancy overweight/obesity with LGA and mediation effects of FPG and mTG. Multivariable logistic regression analysis and serial multiple mediation analysis were performed. The odds ratio (OR) and 95% confidence intervals (CIs) were calculated. RESULTS: Mothers who were overweight or obese had higher odds of giving birth to LGA after adjusting potential confounders (OR:1.88, 95%CI: 1.60-2.21; OR:2.72, 95%CI: 1.93-3.84, respectively). The serial multiple mediation analysis found prepregnancy overweight can not only have a direct positive effect on LGA (effect = 0.043, 95% CI: 0.028-0.058), but also have an indirect effect on the LGA through two paths: the independent mediating role of FPG (effect = 0.004, 95% CI: 0.002-0.005); the independent mediating role of mTG (effect = 0.003,95% CI: 0.002-0.005). The chain mediating role of FPG and mTG has no indirect effect. The estimated proportions mediated by FPG and mTG were 7.8% and 5.9%. Besides, the prepregnancy obesity also has a direct effect on LGA (effect = 0.076; 95%CI: 0.037-0.118) and an indirect effect on LGA through three paths: the independent mediating role of FPG (effect = 0.006; 95%CI: 0.004-0.009); the independent mediating role of mTG (effect = 0.006; 95%CI: 0.003-0.008), and the chain mediating role of FPG and mTG (effect = 0.001; 95%CI: 0.000-0.001). The estimated proportions were 6.7%, 6.7%, and 1.1%, respectively. CONCLUSION: This study found that in nondiabetic women, maternal overweight/obesity was associated with the occurence of LGA, and this positive association was partly mediated by FPG and mTG, suggesting that FPG and mTG in overweight/obese nondiabetic mothers deserve the attention of clinicians.

Maternal BMI changes from the prepregnancy to postpartum period are associated with postpartum cardiometabolic risk factors: a longitudinal study.

PURPOSE: This study aimed at investigating the associations between the total body mass index (BMI) change at 3 or 4 years postpartum compared to the prepregnancy and cardiometabolic risk factors. METHODS: This longitudinal study included 1305 participants. Based on the total postpartum BMI changes, they were divided into < 0 units, 0-1.7 units, and > 1.7 units groups using the interquartile range. Multiple linear regression models were used to analyze the associations. RESULTS: Compared to the reference group, there was a progressive increase in the ßcoefficient (ßcoef) of homeostasis model assessment of insulin resistance (HOMA-IR) of cardiometabolic risk in the following groups: the '0-1.7 units' group with the 'overweight traj' [ßcoef 0.33; 95% confidence intervals (CI) 0.22, 0.44)] or the 'obesity traj' [0.66; (0.45, 0.88)] and the '> 1.7 units' group with the 'normal traj' [0.33; (0.22, 0.44)], the 'overweight traj' [0.54; (0.41, 0.67)] or the 'obesity traj' [0.97; (0.79, 1.15)]. The same increasing trend of ßcoef was also found in DBP, FPG, LDL, WHR, BF%. However, the '< 0 units' group with the 'low traj' [0.13; (0.06, 0.21)] and the '0-1.7 units' group with the 'low traj' [0.08; (0.03, 0.13)] had higher high-density lipoprotein cholesterol (HDL-C) level than the reference group. CONCLUSION: Women with a postpartum BMI gain > 1.7 units are positively associated with cardiometabolic risk factors, especially for those in the 'obesity traj' or 'traj D'. Conversely, women with a postpartum BMI loss > 0 units have negative association with cardiometabolic risk factors, especially for those in the 'low traj' or 'traj B'.

Identifying the Soybean microRNAs Related to Phytophthora sojae Based on RNA Sequencing and Bioinformatics Analysis.

Phytophthora root rot in soybeans is caused by a pathogen called Phytophthora sojae (P. sojae), which results in a significant decrease in soybean production within affected regions. MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that play a key post-transcriptional regulatory role in eukaryotes. In this paper, the miRNAs that respond to P. sojae were analyzed from the gene level to complement the study of molecular resistance mechanisms in soybean. The study utilized high-throughput sequencing of soybean data to predict miRNAs that respond to P. sojae, analyze their specific functions, and verify regulatory relationships using qRT-PCR. The results showed that the miRNAs in soybean respond to P. sojae infection. MiRNAs can be transcribed independently, suggesting the presence of transcription factor binding sites in the promoter regions. Additionally, we performed an evolutionary analysis on conserved miRNAs that respond to P. sojae. Finally, we investigated the regulatory relationships among miRNAs, genes, and transcription factors, and identified five regulatory patterns. These findings lay the groundwork for future studies on the evolution of miRNAs responsive to P. sojae.

Examining the Association Between Parental Factors and Childhood Obesity.

PURPOSE: To examine associations between parent's diet and BMI (body mass index) and child's sedentary behavior and physical activity (PA) with child's BMI. DESIGN: A descriptive design. METHODS: Study participants were a parent-child dyad in a subsample of families enrolled in Chicago Heights Early Childhood Center. FINDINGS: Approximately 80% of parents had a BMI classifying as overweight or obese. Associations between children's sedentary behavior, PA, and BMI were insignificant. CONCLUSIONS: Findings highlight the importance of including parents when developing strategies for promoting healthy behavior of children. CLINICAL EVIDENCE: Community health nurses are well-positioned to promote healthy behaviors.

Influence of OTC on OLE for college students: mediating effect of academic emotion and moderating effect of gender.

With the impact of the global epidemic, online learning has become an irreplaceable form of learning for students, and has been widely concerned by the education circles. Based on Noddings' caring theory and social role theory, A survey of 1954 college students was conducted to examine students' on-line teacher care (OTC), online academic emotion (OAE) and online learning engagement (OLE). The results of correlation analysis find that: (1) There are significant positive correlations among the three variables: OTC, OAE and OLE; (2) OAE plays a part of mediating role between OTC and OLE; (3) Gender has a significant moderating effect on the first half of the mediation path in the model of "OTC→ OAE→OLE". OTC has a significant positive predictive effect on OAE, and among them, the positive predictive effect of male college students is stronger. The conclusion of this study contributes to reveal the formation mechanism and individual differences of college students' OLE, which has reference value for the intervention of college students' OLE.

Characteristics of Gram-positive cocci infection and the therapeutic effect after liver transplantation. / è‚ç§»æ¤æœ¯åŽé©å °æ°é˜³æ€§çƒèŒçš„æ„ŸæŸ“ç‰¹ç‚¹åŠé˜²æ²»æ•ˆæžœ.

OBJECTIVES: Gram-positive cocci is the main pathogen responsible for early infection after liver transplantation (LT), posing a huge threat to the prognosis of liver transplant recipients. This study aims to analyze the distribution and drug resistance of Gram-positive cocci, the risk factors for infections and efficacy of antibiotics within 2 months after LT, and to guide the prevention and treatment of these infections. METHODS: In this study, data of pathogenic bacteria distribution, drug resistance and therapeutic efficacy were collected from 39 Gram-positive cocci infections among 256 patients who received liver transplantation from donation after citizens' death in the Third Xiangya Hospital of Central South University from January 2019 to July 2022, and risk factors for Gram-positive cocci infection were analyzed. RESULTS: Enterococcus faecium was the dominant pathogenic bacteria (33/51, 64.7%), followed by Enterococcus faecalis (11/51, 21.6%). The most common sites of infection were abdominal cavity/biliary tract (13/256, 5.1%) and urinary tract (10/256, 3.9%). Fifty (98%) of the 51 Gram-positive cocci infections occurred within 1 month after LT. The most sensitive drugs to Gram-positive cocci were teicoplanin, tigecycline, linezolid and vancomycin. Vancomycin was not used in all patients, considering its nephrotoxicity. Vancomycin was not administered to all patients in view of its nephrotoxicity.There was no significant difference between the efficacy of daptomycin and teicoplanin in the prevention of cocci infection (P>0.05). Univariate analysis indicated that preoperative Model for End-Stage Liver Disease (MELD) score >25 (P=0.005), intraoperative red blood cell infusion ≥12 U (P=0.013) and exposure to more than 2 intravenous antibiotics post-LT (P=0.003) were related to Gram-positive cocci infections. Multivariate logistic regression analysis revealed that preoperative MELD score >25 (OR=2.378, 95% CI 1.124 to 5.032, P=0.024) and intraoperative red blood cell transfusion ≥ 12 U (OR=2.757, 95% CI 1.227 to 6.195, P=0.014) were independent risk factors for Gram-positive cocci infections after LT. Postoperative Gram-positive cocci infections were reduced in LT recipients exposing to more than two intravenous antibiotics post-LT (OR=0.269, 95% CI 0.121 to 0.598, P=0.001). CONCLUSIONS: Gram-positive cocci infections occurring early after liver transplantation were dominated by Enterococcus faecalis infections at the abdominal/biliary tract and urinary tract. Teicoplanin, tigecycline and linezolid were anti-cocci sensitive drugs. Daptomycin and teicoplanin were equally effective in preventing cocci infections due to Gram-positive cocci. Patients with high preoperative MELD score and massive intraoperative red blood cell transfusion were more likely to suffer Gram-positive cocci infection after surgery. Postoperative Gram-positive cocci infections were reduced in recipients exposing to more than two intravenous antibiotics post-LT.

A General Preparation of Solid Solution-Oxide Heterojunction Photocatalysts through Metal-Organic Framework Transformation Induced Pre-nucleation.

Solid solution-oxide heterostructures combine the advantages of solid solution and heterojunction materials to improve electronic structure and optical properties by metal doping, and enhance charge separation and transfer in semiconductor photocatalysts by creating a built-in electric field. Nevertheless, the effective design and synthesis of these materials remains a significant challenge. Here, we develop a generally applicable strategy that leverages the transformable properties of metal-organic frameworks (MOFs) to prepare solid solution-oxide heterojunctions with controllable structural and chemical compositions. The process consists of three main steps. First, MOFs with different topological structures and metal centers are transformed, accompanied by pre-nucleation of a metal oxide. Second, solid solution is prepared through calcination of the transformed MOFs. Finally, a heterojunction is formed by combining solid solution with another metal oxide group through endogenous overflow. DFT calculations and study on carrier dynamics show that the structure of the material effectively prevents electrons from returning to the bulk phase, exhibiting superior photocatalytic reduction performance of CO2 . This study is expected to promote the controllable synthesis and research of MOF-derived heterojunctions.