Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 47
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Hum Genet ; 142(3): 407-418, 2023 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-36566310

RESUMO

OBJECTIVE: This retrospective study aimed to investigate the value of whole exome sequencing (WES) for clubfoot (CF) fetuses with or without other structural abnormalities and to further explore the genetic causes of fetal CF. METHODS: this study included 83 singleton pregnancies diagnosed with fetal CF referred to our center between January 2016 and March 2022; cases were divided into two groups: isolated CF and non-isolated CF. After excluding cases with positive karyotyping and chromosomal microarray analysis results, WES was performed for the eligible fetuses and parents. Monogenic variants detected by WES and perinatal outcomes were recorded and evaluated at postnatal follow-up. RESULTS: overall, clinically significant variations were identified in 12.0% (10/83) of fetuses, and the detection rate was significantly higher in the non-isolated than in the isolated CF group (8/36, 22.2% vs. 2/47, 4.3%, p = 0.031). We additionally detected eight (9.6%) fetuses harboring variants of unknown significance. We identified 11 clinically significant variations correlating with clinical phenotypes in nine genes from ten fetuses, with KLHL40 being the most frequent (n = 2). Furthermore, we observed a significant difference in termination and survival rates between isolated and non-isolated CF cases (27.6 vs. 77.8% and 59.6 vs. 19.4%, p < 0.001 for both). CONCLUSION: our data indicate that WES has a high additional diagnostic yield for the molecular diagnosis of fetal CF, markedly enhancing existing prenatal diagnostic capabilities and expanding our understanding of intrauterine genetic disorders, thus assisting us to better interpret fetal phenotype in the future.


Assuntos
Pé Torto Equinovaro , Gravidez , Feminino , Humanos , Estudos Retrospectivos , Sequenciamento do Exoma , Feto , Cariotipagem , Diagnóstico Pré-Natal/métodos , Proteínas Musculares
2.
Hum Genet ; 142(6): 835-847, 2023 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-37095353

RESUMO

Fetal hyperechogenic kidneys (HEK) is etiologically a heterogeneous disorder. The aim of this study was to identify the genetic causes of HEK using prenatal chromosomal microarray analysis (CMA) and exome sequencing (ES). From June 2014 to September 2022, we identified 92 HEK fetuses detected by ultrasound. We reviewed and documented other ultrasound anomalies, microscopic and submicroscopic chromosomal abnormalities, and single gene disorders. We also analyzed the diagnostic yield of CMA and ES and the clinical impact the diagnosis had on pregnancy management. In our cohort, CMA detected 27 pathogenic copy number variations (CNVs) in 25 (25/92, 27.2%) fetuses, with the most common CNV being 17q12 microdeletion syndrome. Among the 26 fetuses who underwent further ES testing, we identified 7 pathogenic/likely pathogenic variants and 8 variants of uncertain significance in 9 genes in 12 fetuses. Four novel variants were first reported herein, expanding the mutational spectra for HEK-related genes. Following counseling, 52 families chose to continue the pregnancy, and in 23 of them, postnatal ultrasound showed no detectable renal abnormalities. Of these 23 cases, 15 had isolated HEK on prenatal ultrasound. Taken together, our study showed a high rate of detectable genetic etiologies in cases with fetal HEK at the levels of chromosomal (aneuploidy), sub-chromosomal (microdeletions/microduplications), and single gene (point mutations). Therefore, we speculate that combined CMA and ES testing for fetal HEK is feasible and has good clinical utility. When no genetic abnormalities are identified, the findings can be transient, especially in the isolated HEK group.


Assuntos
Variações do Número de Cópias de DNA , Diagnóstico Pré-Natal , Gravidez , Feminino , Humanos , Sequenciamento do Exoma , Aberrações Cromossômicas , Feto/diagnóstico por imagem , Feto/anormalidades , Análise em Microsséries , Rim/diagnóstico por imagem
3.
J Clin Lab Anal ; 34(7): e23265, 2020 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-32141654

RESUMO

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.


Assuntos
Proteínas Culina/genética , Nanismo/genética , Hipotonia Muscular/genética , Coluna Vertebral/anormalidades , Povo Asiático/genética , Criança , Simulação por Computador , Nanismo/etiologia , Feminino , Mutação da Fase de Leitura , Homozigoto , Humanos , Lactente , Masculino , Hipotonia Muscular/etiologia , Mutação de Sentido Incorreto , Linhagem , Gravidez , Sequenciamento do Exoma
4.
Lab Invest ; 99(1): 58-71, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-30353129

RESUMO

Mesenchymal stem cells (MSCs) are multipotent progenitors that can differentiate into multiple lineages including osteoblastic lineage. Osteogenic differentiation of MSCs is a cascade that recapitulates most, if not all, of the molecular events occurring during embryonic skeletal development, which is regulated by numerous signaling pathways including bone morphogenetic proteins (BMPs). Through a comprehensive analysis of the osteogenic activity, we previously demonstrated that BMP9 is the most potent BMP for inducing bone formation from MSCs both in vitro and in vivo. However, as one of the least studied BMPs, the essential mediators of BMP9-induced osteogenic signaling remain elusive. Here we show that BMP9-induced osteogenic signaling in MSCs requires intact Notch signaling. While the expression of Notch receptors and ligands are readily detectable in MSCs, Notch inhibitor and dominant-negative Notch1 effectively inhibit BMP9-induced osteogenic differentiation in vitro and ectopic bone formation in vivo. Genetic disruption of Notch pathway severely impairs BMP9-induced osteogenic differentiation and ectopic bone formation from MSCs. Furthermore, while BMP9-induced expression of early-responsive genes is not affected by defective Notch signaling, BMP9 upregulates the expression of Notch receptors and ligands at the intermediate stage of osteogenic differentiation. Taken together, these results demonstrate that Notch signaling may play an essential role in coordinating BMP9-induced osteogenic differentiation of MSCs.


Assuntos
Fatores de Diferenciação de Crescimento/fisiologia , Células-Tronco Mesenquimais/fisiologia , Osteogênese , Receptores Notch/metabolismo , Diferenciação Celular , Fator 2 de Diferenciação de Crescimento , Células HEK293 , Humanos , Transdução de Sinais , Regulação para Cima
5.
J Cell Biochem ; 119(11): 8872-8886, 2018 11.
Artigo em Inglês | MEDLINE | ID: mdl-30076626

RESUMO

Human mesenchymal stem cells (MSCs) are a heterogeneous subset of nonhematopoietic multipotent stromal stem cells and can differentiate into mesodermal lineage, such as adipocytes, osteocytes, and chondrocytes, as well as ectodermal and endodermal lineages. Human umbilical cord (UC) is one of the most promising sources of MSCs. However, the molecular and cellular characteristics of UC-derived MSCs (UC-MSCs) require extensive investigations, which are hampered by the limited lifespan and the diminished potency over passages. Here, we used the piggyBac transposon-based simian virus 40 T antigen (SV40T) immortalization system and effectively immortalized UC-MSCs, yielding the iUC-MSCs. A vast majority of the immortalized lines are positive for MSC markers but not for hematopoietic markers. The immortalization phenotype of the iUC-MSCs can be effectively reversed by flippase recombinase-induced the removal of SV40T antigen. While possessing long-term proliferation capability, the iUC-MSCs are not tumorigenic in vivo. Upon bone morphogenetic protein 9 (BMP9) stimulation, the iUC-MSC cells effectively differentiate into osteogenic, chondrogenic, and adipogenic lineages both in vitro and in vivo, which is indistinguishable from that of primary UC-MSCs, indicating that the immortalized UC-MSCs possess the characteristics similar to that of their primary counterparts and retain trilineage differentiation potential upon BMP9 stimulation. Therefore, the engineered iUC-MSCs should be a valuable alternative cell source for studying UC-MSC biology and their potential utilities in immunotherapies and regenerative medicine.


Assuntos
Adipogenia/fisiologia , Diferenciação Celular/fisiologia , Fator 2 de Diferenciação de Crescimento/metabolismo , Células-Tronco Mesenquimais/metabolismo , Osteogênese/fisiologia , Cordão Umbilical/citologia , Análise de Variância , Animais , Antígenos Transformantes de Poliomavirus/metabolismo , Técnicas de Cultura de Células/métodos , Proliferação de Células , Condrogênese/fisiologia , Feminino , Vetores Genéticos , Células HEK293 , Humanos , Recém-Nascido , Camundongos Nus , Transposon Resolvases/metabolismo
6.
Cell Physiol Biochem ; 47(3): 957-971, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29843133

RESUMO

BACKGROUND/AIMS: As the most lethal urological cancers, renal cell carcinoma (RCC) comprises a heterogeneous group of cancer with diverse genetic and molecular alterations. There is an unmet clinical need to develop efficacious therapeutics for advanced, metastatic and/or relapsed RCC. Here, we investigate whether anthelmintic drug Niclosamide exhibits anticancer activity and synergizes with targeted therapy Sorafenib in suppressing RCC cell proliferation. METHODS: Cell proliferation and migration were assessed by Crystal violet staining, WST-1 assay, cell wounding and cell cycle analysis. Gene expression was assessed by qPCR. In vivo anticancer activity was assessed in xenograft tumor model. RESULTS: We find that Niclosamide effectively inhibits cell proliferation, cell migration and cell cycle progression, and induces apoptosis in human renal cancer cells. Mechanistically, Niclosamide inhibits the expression of C-MYC and E2F1 while inducing the expression of PTEN in RCC cells. Niclosamide is further shown to synergize with Sorafenib in suppressing RCC cell proliferation and survival. In the xenograft tumor model, Niclosamide is shown to effectively inhibit tumor growth and suppress RCC cell proliferation. CONCLUSIONS: Niclosamide may be repurposed as a potent anticancer agent, which can potentiate the anticancer activity of the other agents targeting different signaling pathways in the treatment of human RCC.


Assuntos
Carcinoma de Células Renais/tratamento farmacológico , Neoplasias Renais/tratamento farmacológico , Niacinamida/análogos & derivados , Niclosamida/farmacologia , Compostos de Fenilureia/farmacologia , Carcinoma de Células Renais/metabolismo , Carcinoma de Células Renais/patologia , Ciclo Celular/efeitos dos fármacos , Sinergismo Farmacológico , Regulação Enzimológica da Expressão Gênica/efeitos dos fármacos , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Humanos , Neoplasias Renais/metabolismo , Neoplasias Renais/patologia , Proteínas de Neoplasias/biossíntese , Niacinamida/agonistas , Niacinamida/farmacologia , Niclosamida/agonistas , PTEN Fosfo-Hidrolase/biossíntese , Compostos de Fenilureia/agonistas , Sorafenibe
7.
J Cell Mol Med ; 21(11): 2782-2795, 2017 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-28470873

RESUMO

The cranial suture complex is a heterogeneous tissue consisting of osteogenic progenitor cells and mesenchymal stem cells (MSCs) from bone marrow and suture mesenchyme. The fusion of cranial sutures is a highly coordinated and tightly regulated process during development. Craniosynostosis is a congenital malformation caused by premature fusion of cranial sutures. While the progenitor cells derived from the cranial suture complex should prove valuable for studying the molecular mechanisms underlying suture development and pathogenic premature suture fusion, primary human cranial suture progenitors (SuPs) have limited life span and gradually lose osteoblastic ability over passages. To overcome technical challenges in maintaining sufficient and long-term culture of SuPs for suture biology studies, we establish and characterize the reversibly immortalized human cranial suture progenitors (iSuPs). Using a reversible immortalization system expressing SV40 T flanked with FRT sites, we demonstrate that primary human suture progenitor cells derived from the patent sutures of craniosynostosis patients can be efficiently immortalized. The iSuPs maintain long-term proliferative activity, express most of the consensus MSC markers and can differentiate into osteogenic and adipogenic lineages upon BMP9 stimulation in vitro and in vivo. The removal of SV40 T antigen by FLP recombinase results in a decrease in cell proliferation and an increase in the endogenous osteogenic and adipogenic capability in the iSuPs. Therefore, the iSuPs should be a valuable resource to study suture development, intramembranous ossification and the pathogenesis of craniosynostosis, as well as to explore cranial bone tissue engineering.


Assuntos
Suturas Cranianas/metabolismo , Craniossinostoses/genética , Efeito Fundador , Fatores de Diferenciação de Crescimento/genética , Células-Tronco Mesenquimais/metabolismo , Osteogênese/genética , Adipócitos/citologia , Adipócitos/metabolismo , Diferenciação Celular , Linhagem Celular Transformada , Proliferação de Células , Suturas Cranianas/patologia , Craniossinostoses/metabolismo , Craniossinostoses/patologia , Expressão Gênica , Fator 2 de Diferenciação de Crescimento , Fatores de Diferenciação de Crescimento/metabolismo , Humanos , Lactente , Masculino , Células-Tronco Mesenquimais/citologia , Osteoblastos/citologia , Osteoblastos/metabolismo , Vírus 40 dos Símios/genética , Vírus 40 dos Símios/metabolismo , Transformação Genética
8.
Cell Physiol Biochem ; 41(6): 2383-2398, 2017.
Artigo em Inglês | MEDLINE | ID: mdl-28463838

RESUMO

BACKGROUND/AIMS: While recombinant adenoviruses are among the most widely-used gene delivery vectors and usually propagated in HEK-293 cells, generating recombinant adenoviruses remains time-consuming and labor-intense. We sought to develop a rapid adenovirus production and amplification (RAPA) line by assessing human Ad5 genes (E1A, E1B19K/55K, pTP, DBP, and DNA Pol) and OCT1 for their contributions to adenovirus production. METHODS: Stable transgene expression in 293T cells was accomplished by using piggyBac system. Transgene expression was determined by qPCR. Adenoviral production was assessed with titering, fluorescent markers and/or luciferase activity. Osteogenic activity was assessed by measuring alkaline phosphatase activity. RESULTS: Overexpression of both E1A and pTP led to a significant increase in adenovirus amplification, whereas other transgene combinations did not significantly affect adenovirus amplification. When E1A and pTP were stably expressed in 293T cells, the resultant RAPA line showed high efficiency in adenovirus amplification and production. The produced AdBMP9 infected mesenchymal stem cells with highest efficiency and induced most effective osteogenic differentiation. Furthermore, adenovirus production efficiency in RAPA cells was dependent on the amount of transfected DNA. Under optimal transfection conditions high-titer adenoviruses were obtained within 5 days of transfection. CONCLUSION: The RAPA cells are highly efficient for adenovirus production and amplification.


Assuntos
Adenoviridae/fisiologia , Biotecnologia/métodos , Engenharia Genética , Vetores Genéticos/metabolismo , Adenoviridae/genética , Proteínas E1A de Adenovirus/genética , Proteínas E1A de Adenovirus/metabolismo , Diferenciação Celular , Linhagem Celular , Citometria de Fluxo , Vetores Genéticos/genética , Fator 2 de Diferenciação de Crescimento/genética , Fator 2 de Diferenciação de Crescimento/metabolismo , Células HEK293 , Humanos , Células-Tronco Mesenquimais/citologia , Células-Tronco Mesenquimais/metabolismo , Osteogênese , Fosfoproteínas/genética , Fosfoproteínas/metabolismo , Precursores de Proteínas/genética , Precursores de Proteínas/metabolismo , Proteínas Virais/genética , Proteínas Virais/metabolismo , Replicação Viral
9.
Cell Physiol Biochem ; 41(5): 1905-1923, 2017.
Artigo em Inglês | MEDLINE | ID: mdl-28384643

RESUMO

BACKGROUND/AIMS: Mesenchymal stem cells (MSCs) are multipotent progenitors that can differentiate into several lineages including bone. Successful bone formation requires osteogenesis and angiogenesis coupling of MSCs. Here, we investigate if simultaneous activation of BMP9 and Notch signaling yields effective osteogenesis-angiogenesis coupling in MSCs. METHODS: Recently-characterized immortalized mouse adipose-derived progenitors (iMADs) were used as MSC source. Transgenes BMP9, NICD and dnNotch1 were expressed by adenoviral vectors. Gene expression was determined by qPCR and immunohistochem¡stry. Osteogenic activity was assessed by in vitro assays and in vivo ectopic bone formation model. RESULTS: BMP9 upregulated expression of Notch receptors and ligands in iMADs. Constitutively-active form of Notch1 NICD1 enhanced BMP9-induced osteogenic differentiation both in vitro and in vivo, which was effectively inhibited by dominant-negative form of Notch1 dnNotch1. BMP9- and NICD1-transduced MSCs implanted with a biocompatible scaffold yielded highly mature bone with extensive vascularization. NICD1 enhanced BMP9-induced expression of key angiogenic regulators in iMADs and Vegfa in ectopic bone, which was blunted by dnNotch1. CONCLUSION: Notch signaling may play an important role in BMP9-induced osteogenesis and angiogenesis. It's conceivable that simultaneous activation of the BMP9 and Notch pathways should efficiently couple osteogenesis and angiogenesis of MSCs for successful bone tissue engineering.


Assuntos
Fator 2 de Diferenciação de Crescimento/metabolismo , Células-Tronco Mesenquimais/metabolismo , Neovascularização Fisiológica , Osteogênese , Receptor Notch1/metabolismo , Transdução de Sinais , Animais , Linhagem Celular , Fator 2 de Diferenciação de Crescimento/genética , Células-Tronco Mesenquimais/citologia , Camundongos , Receptor Notch1/genética
10.
Tumour Biol ; 37(3): 3479-88, 2016 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-26449831

RESUMO

Osteosarcoma (OS) is the most common primary malignant bone tumor in young patients. However, treatment paradigms and survival rates have not improved in decades. MicroRNAs have been shown to be critical regulators of physiological homeostasis and pathological process, including bone disease. Nearly half of the microRNA (miRNA) genes are located at genomic regions and fragile sites known to be frequently deleted or amplified in various kinds of cancers. In this study, we investigated the role miR-30a in OS. A negative correlation between miR-30a expression and malignant grade was observed in OS cell lines. The overexpression of miR-30a reduced proliferation, migration, and invasion in 143B cells and the inhibitor of miR-30a increased proliferation, migration, and invasion in Saos2 cells. Further studies revealed that runt-related transcription factors 2 (Runx2) was a regulative target gene of miR-30a. Rescue assay significantly reversed the effects of overexpressing or inhibiting miR-30a. miR-30a also suppressed tumor formation and pulmonary metastasis in vivo. All the results suggest a critical role of miR-30a in suppressing proliferation, migration, and invasion of OS by targeting Runx2.


Assuntos
Neoplasias Ósseas/patologia , Movimento Celular , Proliferação de Células , Subunidade alfa 1 de Fator de Ligação ao Core/genética , MicroRNAs/fisiologia , Osteossarcoma/patologia , Animais , Linhagem Celular Tumoral , Humanos , Masculino , Camundongos , Invasividade Neoplásica
11.
Zhonghua Yu Fang Yi Xue Za Zhi ; 48(6): 484-90, 2014 Jun.
Artigo em Zh | MEDLINE | ID: mdl-25219437

RESUMO

OBJECTIVE: To understand the age-specific and cause-specific mortality rate among children under 5 years old in Beijing from 2003 to 2012. METHODS: Death surveillance data of children under the age of 5 were obtained from Beijing children mortality surveillance network from 2003 to 2012. Neonatal mortality rate (NMR), infant mortality rate (IMR), under 5-year old children mortality rate (U5MR) and the leading cause of death for under 5-year old children in urban, suburbs, and outer suburbs in Beijing were analyzed. RESULTS: The NMR, IMR and U5MR in Beijing were 2.08 (253/121 747), 3.11 (379/121 747) and 3.57 (435/121 747) per 1000 live births in 2012, respectively, which declined 54.88%, 50.24% and 54.75% compared with the level in 2003 respectively. The children mortality rates showed a decreasing trend in urban, suburb, and outer suburbs during 2003 and 2012 (NMR was decreased from 0.53%, 0.42%, and 0.48% in 2003 to 0.20%, 0.19%, and 0.23% in 2012; IMR was decreased from 0.73%, 0.58%, and 0.63% in 2003 to 0.30%, 0.29%, and 0.35% in 2012; U5MR was decreased from 0.90%, 0.72%, and 0.82% to 0.33%, 0.34%, and 0.39% in 2012, P < 0.01). There was a steady decline in the U5MR due to congenital heart disease, birth asphyxia, premature birth or low birth weight and traffic accident in Beijing from 2003 to 2012. The mortality rate of congenital heart disease declined from 140.63 to 41.89 per 100 000 live births, birth asphyxia declined from 109.38 to 59.96 per 100 000 live births, premature birth or low birth weight declined from 85.94 to 52.57 per 100 000 live births, traffic accident declined from 26.04 to 6.57 per 100 000 live births (P < 0.01). The mortality rate of congenital heart disease declined remarkably from 216.56 to 52.47, from 119.75 to 23.50, and from 134.58 to 63.11 per 100 000 live births in urban, suburb, and outer suburbs(P < 0.01). Six of the top 8 leading causes of death among children under 5 years old declined remarkably in rural areas. They were congenital heart disease, birth asphyxia, premature birth or low birth weight, traffic accident, drowning, and septicemia, and the mortality rate of them declined from 134.58 to 63.11, from 127.85 to 65.54, from 100.94 to 60.69, from 33.65 to 12.14, from 33.65 to 0.00, and from 26.92 to 4.85 per 100 000 live births, respectively (P < 0.05). There was no drowning death case in rural areas in recent 4 years. The top 5 leading causes of death among children under 5 years old in Beijing in 2012 were birth asphyxia, premature birth or low birth weight, congenital heart disease, pneumonia, and accidental suffocation. The mortality rate of these top 5 leading causes were 59.96, 52.57, 41.89, 24.64, and 15.61 per 100 000 live births in 2012. CONCLUSION: From 2003 to 2012, the NMR, IMR, U5MR and mortality rate of congenital heart disease declined remarkably in urban, suburb, and outer suburb areas in Beijing. There was a decrease trend for the six of the top 8 leading causes of death among children under 5 years old. The mortality rate of drowning dropped markedly in outer suburbs.


Assuntos
Causas de Morte , Mortalidade da Criança , Mortalidade Infantil , Acidentes de Trânsito , Asfixia , Asfixia Neonatal , Pré-Escolar , China , Afogamento , Feminino , Cardiopatias Congênitas , Humanos , Lactente , Morte do Lactente , Pneumonia , Gravidez , Nascimento Prematuro , População Rural , Sepse , População Suburbana , População Urbana
12.
Mol Genet Genomic Med ; 12(1): e2317, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37962265

RESUMO

BACKGROUND: Acid ceramidase (ACDase) deficiency is an ultrarare autosomal recessive lysosomal disorder caused by pathogenic N-acylsphingosine amidohydrolase (ASAH1) variants. It presents with either Farber disease (FD) or spinal muscular atrophy with progressive myoclonic epilepsy (SMA-PME). OBJECTIVE: The study aims to identify a novel splice site variant in a hydrops fetus that causes ASAH1-related disorder, aid genetic counseling, and accurate prenatal diagnosis. METHODS: We report a case of hydrops fetalis with a novel homozygous mutation in ASAH1 inherited from non-consanguineous parents. We performed copy number variation sequencing (CNV-Seq) and whole exome sequencing (WES) on the fetus and family, respectively. Minigene splicing analyses were conducted to confirm the pathogenic variants. RESULTS: WES data revealed a splice site variant of the ASAH1 (c.458-2A>T), which was predicted to affect RNA splicing. Minigene splicing analyses found that the c.458-2A>T variant abolished the canonical splicing of intron 6, thereby activating two cryptic splicing products (c.456_458ins56bp and c.458_503del). CONCLUSIONS: Overall, we identified a novel splice site variant in the mutational spectrum of ASAH1 and its aberrant effect on splicing. These findings highlight the importance of ultrasonic manifestation and family history of fetal hydrops during ASAH1-related disorders and could also aid genetic counseling and accurate prenatal diagnosis. To the best of our knowledge, this is the shortest-lived account of ASAH1-related disorders in utero with severe hydrops fetalis.


Assuntos
Atrofia Muscular Espinal , Feminino , Gravidez , Humanos , Atrofia Muscular Espinal/genética , Variações do Número de Cópias de DNA , Hidropisia Fetal/genética , Mutação , Íntrons , Ceramidase Ácida/genética
13.
Anal Methods ; 16(8): 1281-1287, 2024 02 22.
Artigo em Inglês | MEDLINE | ID: mdl-38327233

RESUMO

MiRNAs are critical regulators of target gene expression in many biological processes and are considered promising biomarkers for diseases. In this study, we developed a simple, specific, and sensitive miRNA detection method based on proximity ligation reaction, which is easy to operate. The method uses a pair of target-specific DNA probes immobilized on the same gold nanoparticles (AuNPs), which hybridize to the target miRNA. Hybridization brings the probes close together, allowing the formation of a continuous DNA sequence that can be amplified by Quantitative Real-time PCR (qPCR). This method eliminates the need for complex reverse transcription design and achieves high specificity for discriminating single base mismatches between miRNAs through a simple procedure. This method can sensitively measure three different miRNAs with a detection limit of 20 aM, providing high versatility and sensitivity, even distinguishing single-base variations among members of the miR-200 family with high selectivity. Due to its high selectivity and sensitivity, this method has important implications for the investigation of miRNA biological functions and related biomedical research.


Assuntos
Nanopartículas Metálicas , MicroRNAs , MicroRNAs/genética , MicroRNAs/análise , Ouro , Ácidos Nucleicos Imobilizados , Limite de Detecção
14.
J Cancer Res Clin Oncol ; 150(2): 82, 2024 Feb 06.
Artigo em Inglês | MEDLINE | ID: mdl-38319412

RESUMO

A meta-analysis was performed to assess the benefits and safety profile of approved immune checkpoint inhibitors in hepatocellular carcinoma patients. Eligible studies were searched from Cochrane, Embase, and PubMed databases based on a well-established strategy. Following the exclusion of ineligible studies, 12 studies were included in this meta-analysis. Compared with control group, immune checkpoint inhibitors were associated with improved ORR (OR 3.03, 95% CI 2.26-4.05, P < 0.00001), SD (OR 0.77, 95% CI 0.62-0.95, P = 0.02), OS (HR 0.75, 95% CI 0.68-0.83, P < 0.00001), and PFS (HR 0.74, 95% CI 0.63-0.87, P < 0.0003). However, no significant differences were observed in DCR (OR 1.33, 95% CI 0.97-1.81, P = 0.07), PD (OR 0.90, 95% CI 0.67-1.21, P = 0.48), and all caused any-grade adverse events (OR 1.22, 95% CI 0.62-2.39, P = 0. 57), all caused ≥ grade 3 adverse events (OR 1.10, 95% CI 0.97-1.25, P = 0.14), treatment-related any-grade adverse events (OR 1.13, 95% CI 0.55-2.32, P = 0.73), and treatment-related ≥ grade 3 events (OR 0.82, 95% CI 0.34-1.97, P = 0.65) between the two groups. After subgroup analysis conducted, patients in the immune checkpoint inhibitor group compared with targeted drug group showed significant improvements in OS (HR 0.74, 95% CI 0.66-0.84, P < 0.00001) and PFS (HR 0.75, 95% CI 0.61-0.91, P = 0.004). Immune checkpoint inhibitors have demonstrated peculiar benefits in the treatment of HCC with an acceptable safety profile. Compared to targeted drugs, immune checkpoint inhibitors still offer advantages in the treatment of hepatocellular carcinoma. However, there is still considerable room for further improvement.


Assuntos
Carcinoma Hepatocelular , Inibidores de Checkpoint Imunológico , Neoplasias Hepáticas , Humanos , Carcinoma Hepatocelular/tratamento farmacológico , Carcinoma Hepatocelular/imunologia , Carcinoma Hepatocelular/patologia , Inibidores de Checkpoint Imunológico/uso terapêutico , Inibidores de Checkpoint Imunológico/efeitos adversos , Neoplasias Hepáticas/tratamento farmacológico , Neoplasias Hepáticas/imunologia , Neoplasias Hepáticas/patologia
15.
Am J Obstet Gynecol MFM ; 6(1): 101228, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37984685

RESUMO

BACKGROUND: Polycystic renal disease is a frequent congenital anomaly of the kidneys, but research using chromosomal microarray analysis and exome sequencing in fetuses with polycystic renal disease remains sparse, with most studies focusing on the multisystem or genitourinary system. OBJECTIVE: This study aimed to assess the detection rate of detectable genetic causes of fetal polycystic renal disease at different levels, novel disease-causing variants, and genotype-phenotype correlations. STUDY DESIGN: This study included 220 fetal polycystic renal disease cases from January 2014 to June 2022. Cases were divided into the following 3 groups: isolated multicystic dysplastic kidneys, nonisolated multicystic dysplastic kidneys, and suspected polycystic kidney disease group. We reviewed data on maternal demographics, ultrasonographic results, chromosomal microarray analysis/exome sequencing results, and pregnancy outcomes. RESULTS: In our cohort, chromosomal microarray analysis identified 19 (8.6%) fetuses carrying chromosomal abnormalities, and the most common copy number variation was 17q12 microdeletion (7/220; 3.2%). Furthermore, 94 families chose to perform trio-exome sequencing testing, and 21 fetuses (22.3%) were found to harbor pathogenic/likely pathogenic variants. There was a significant difference in the live birth rate among the 3 groups (91/130 vs 46/80 vs 1/10; P<.001). Among 138 live birth cases, 106 (78.5%) underwent postnatal ultrasound review, of which 95 (89.6%) had a consistent prenatal-postnatal ultrasound diagnosis. CONCLUSION: For both isolated and nonisolated polycystic renal disease, our data showed high detection efficiency with both testing tools. The detection of novel pathogenic variants expands the known disease spectrum of polycystic renal disease-associated genes while enriching our understanding of the genotype-phenotype correlation. Therefore, we consider it feasible to perform chromosomal microarray analysis+exome sequencing testing in fetal polycystic renal disease. Moreover, prenatal-postnatal ultrasound concordance was greater, the live birth rate was higher, and prognosis was better when known genetic disorders were excluded, indicating that genetic testing results significantly influenced pregnancy decisions.


Assuntos
Rim Displásico Multicístico , Doenças Renais Policísticas , Gravidez , Feminino , Humanos , Variações do Número de Cópias de DNA , Diagnóstico Pré-Natal/métodos , Doenças Renais Policísticas/diagnóstico , Doenças Renais Policísticas/epidemiologia , Doenças Renais Policísticas/genética , Feto/anormalidades
16.
Int J Gynaecol Obstet ; 166(1): 353-359, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-38189110

RESUMO

OBJECTIVE: Duplex kidney is a relatively frequent form of urinary system abnormality. This study aimed to elucidate the value of chromosomal microarray analysis (CMA) and whole exome sequencing (WES) for duplex kidney and the perinatal outcomes of duplex kidney fetuses. METHODS: This retrospective cohort study included 63 patients with duplex kidney diagnosed using antenatal ultrasound between August 2013 and January 2023. We reviewed the clinical characteristics, genetic test results, and pregnancy outcomes of the patients. RESULTS: Among the 63 cases based on the inclusion criteria, the CMA detected seven (11.1%) clinically significant variants and nine variants of uncertain significance (VUS), and the pathogenic/likely pathogenic (P/LP) copy number variations (CNVs) in the recurrent region that were associated with prenatal duplex kidney included 17q12, 17p13.3, and 22q11.2. No significant disparity was observed in the CMA detection rate between the unilateral and bilateral groups, or between the isolated and non-isolated groups. WES identified three (50%) P/LP single-gene variants in six fetuses with duplex kidney. We detected the following pathogenic genes in the duplex kidney fetuses: KMT2D, SMPD4, and FANCI. Pregnancy termination in cases where clinically significant variants were detected by genetic testing was different in statistical significance from that in cases with negative results (9/10, 90.0% vs 8/48, 16.7%, P < 0.001). CONCLUSION: This study elucidated the value of CMA and WES for fetal duplex kidney, proving that CMA and WES may be useful tools in prenatal diagnosis and genetic counseling.


Assuntos
Sequenciamento do Exoma , Rim , Ultrassonografia Pré-Natal , Humanos , Feminino , Gravidez , Estudos Retrospectivos , Adulto , Rim/anormalidades , Rim/diagnóstico por imagem , Resultado da Gravidez , Diagnóstico Pré-Natal/métodos , Variações do Número de Cópias de DNA , Anormalidades Urogenitais/genética , Anormalidades Urogenitais/diagnóstico por imagem , Anormalidades Urogenitais/diagnóstico , Testes Genéticos/métodos , Análise em Microsséries
17.
Heliyon ; 10(17): e36558, 2024 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-39286125

RESUMO

Purpose: 17q12 copy number variants (CNVs) have variable presentations and incomplete penetrance, challenging prenatal counseling and management. This study aims to investigate the intrauterine phenotype. Methods: We included 48 fetuses diagnosed with 17q12 microdeletion or microduplication by chromosomal microarray analysis. Results: For 17q12 deletion, renal anomalies were found in 35 fetuses (35/37, 94.6 %), with hyperechogenic kidneys (HEK, 28/37, 75.7 %) and multicystic dysplastic kidneys (17/37, 45.9 %) being the most common findings. Duodenal obstruction (DO) was most frequently combined in 17q12 duplication fetuses. In addition, cardiac abnormalities were the first reported prenatal phenotype in 17q12 duplication fetuses. Conclusion: Our study shows that HEK and DO are the most predominant presentations of 17q12 deletion and duplication, respectively, and cardiac structural abnormalities may be associated with the latter. Although 17q12 CNVs have incomplete penetrance and variable expressivity and may be mainly involved in neurodevelopmental disorders, their short-term prognosis appears positive.

18.
Ital J Pediatr ; 50(1): 152, 2024 Aug 21.
Artigo em Inglês | MEDLINE | ID: mdl-39169438

RESUMO

BACKGROUD: A systematic analysis was conducted to investigate the molecular etiology of fetal cleft lip and/or palate (CL/P) and the association between various types of CL/P and copy number variations (CNVs), as well as their impact on birth outcomes. METHODS: In this retrospective study conducted between January 2016 and July 2022, a cohort of pregnancies diagnosed with fetal CL/P was enrolled and comprehensive clinical data for all cases were extracted from our medical record database, including demographic data about the pregnancies, ultrasound findings, results of Chromosomal microarray (CMA), as well as relevant pregnant and perinatal outcomes. RESULTS: Among the 358 cases, 32 clinically significant variants in 29 (8.1%) fetuses with CL/P were detected by CMA. In 338 singleton pregnancies, the diagnostic yield of CMA in the context of CL/P fetuses was determined to be 7.7% (26/338). CP cases exhibited a relatively higher prevalence of pathogenic/likely pathogenic CNVs at a rate of 25% (3/12), followed by CLP cases at 8.0% (23/288). Notably, the CL group did not demonstrate any pathogenic/likely pathogenic CNV findings among the examined cases (0/38). The diagnostic rate of clinically significant variants was notably higher in the non-isolated CL/P group than in the isolated CL/P group (11/33, 33.3% vs. 15/305, 4.9%, p < 0.001). Within the remaining 20 twin pregnancies, three clinically significant variants (15%) were observed. CONCLUSIONS: This study provides powerful evidence supporting the efficacy of CMA as a valuable tool for facilitating the prenatal genetic diagnosis of fetal CL/P. The presence of CP and CLP in fetal cases demonstrated a relatively higher incidence of pathogenic/likely pathogenic CNVs. Moreover, when these cases were accompanied by additional ultrasound abnormalities, the likelihood of identifying diagnostic CNVs significantly increased. Conversely, cases of CL alone might not be associated with positive CNVs. The present data may significantly enhance prenatal diagnosis accuracy and facilitate informed genetic counseling for cases of fetal CL/P.


Assuntos
Fenda Labial , Fissura Palatina , Variações do Número de Cópias de DNA , Ultrassonografia Pré-Natal , Humanos , Fenda Labial/genética , Fenda Labial/diagnóstico por imagem , Feminino , Estudos Retrospectivos , Fissura Palatina/genética , Fissura Palatina/diagnóstico por imagem , Gravidez , China/epidemiologia , Adulto , Centros de Atenção Terciária , População do Leste Asiático
19.
Int J Med Sci ; 10(9): 1181-92, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-23935395

RESUMO

Mesenchymal progenitor stem cells (MPCs) are a group of bone marrow stromal progenitor cells processing osteogenic, chondrogenic, adipogenic and myogenic lineages differentiations. Previous studies have demonstrated that bone morphogeneic protein 9(BMP9) is one of the most osteogenic BMPs both in vitro and in vivo, however, the underlying molecular mechanism of osteogenesis induced by BMP9 is needed to be deep explored. Here, we used the recombinant adenoviruses assay to introduce BMP9 into C3H10T1/2 mesenchymal stem cells to elucidate the role of CXCL12/CXCR4 signal axis during BMP9-incuced osteogenic differentiation. The results showed that CXCL12 and CXCR4 expressions were down-regulated at the stage of BMP9-induced osteogenic differentiation, in a dose- and time-dependent. Pretreatment of C3H10T1/2 cells with CXCL12/CXCR4 could significantly affect the early and mid osteogenic markers alkaline phosphatase (ALP), osteocalcin (OCN), the transcription factors of Runx2, Osx, Plzf and Dlx5 expression, through activating the Smad, MAPK signaling pathway. Addition of exogenous CXCL12 did not affect the changes of the late osteogenic marker calcium deposition. Thus, our findings suggest a co-requirement of the CXCL12/CXCR4 signal axis in BMP9-induced the early- and mid-process of osteogenic differentiation of MSCs.


Assuntos
Quimiocina CXCL12/metabolismo , Fator 2 de Diferenciação de Crescimento/metabolismo , Células-Tronco Mesenquimais/citologia , Células-Tronco Mesenquimais/metabolismo , Osteogênese/fisiologia , Receptores CXCR4/metabolismo , Fosfatase Alcalina/metabolismo , Diferenciação Celular/genética , Diferenciação Celular/fisiologia , Linhagem Celular , Quimiocina CXCL12/genética , Quimiocina CXCL12/farmacologia , Subunidade alfa 1 de Fator de Ligação ao Core/metabolismo , Fator 2 de Diferenciação de Crescimento/genética , Células HCT116 , Proteínas de Homeodomínio/metabolismo , Humanos , Fatores de Transcrição Kruppel-Like/metabolismo , Osteocalcina/metabolismo , Osteogênese/genética , Proteína com Dedos de Zinco da Leucemia Promielocítica , Receptores CXCR4/genética , Fator de Transcrição Sp7 , Fatores de Transcrição/metabolismo
20.
Artigo em Inglês | MEDLINE | ID: mdl-36396591

RESUMO

OBJECTIVE: Ephrin receptor A2 (EphA2) was reported to be related to the tumorigenesis of salivary adenoid cystic carcinoma (SACC), which is a rare malignancy accounting for less than 1% of all oral and maxillofacial tumors. This research aimed to assess the molecular mechanisms of EphA2 in SACC. STUDY DESIGN: The expression of long non-coding RNA human leukocyte antigen complex group 11 (HCG11), microRNA-1297 (miR-1297), and EphA2 in SACC cell lines compared with normal human salivary gland (HSG) cell line was measured by reverse transcription-quantitative polymerase chain reaction. EphA2 protein level was detected by western blot. 5-ethynyl-2'-deoxyuridine (EdU), colony formation, Transwell, and wounding healing experiments were applied to evaluate SACC cell proliferation, migration, and invasion. The relationship among HCG11, miR-1297, and EphA2 was confirmed by luciferase reporter, RNA pulldown, and RNA immunoprecipitation experiments. RESULTS: HCG11 and EphA2 were downregulated while miR-1297 was upregulated in SACC cells. EphA2 overexpression suppressed SACC cell proliferation, migration, and invasion. HCG11 bound to miR-1297 to reduce the inhibition of miR-1297 on EphA2 expression. EphA2 knockdown reversed the suppression of HCG11 overexpression on SACC cell phenotypes. CONCLUSION: This study identified the HCG11/miR-1297/EphA2 regulatory axis in SACC, which might provide novel therapeutic targets for SACC.


Assuntos
Carcinoma Adenoide Cístico , MicroRNAs , Neoplasias das Glândulas Salivares , Humanos , Carcinoma Adenoide Cístico/patologia , MicroRNAs/genética , MicroRNAs/metabolismo , Neoplasias das Glândulas Salivares/patologia , Linhagem Celular Tumoral , Invasividade Neoplásica/genética , Invasividade Neoplásica/patologia , Proliferação de Células/genética , Movimento Celular/genética , Regulação Neoplásica da Expressão Gênica
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA