First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

Genetic diversity and fingerprinting of 33 standard flue-cured tobacco varieties for use in distinctness, uniformity, and stability testing.

BACKGROUND: At present, the distinctness, uniformity, and stability (DUS) testing of flue-cured tobacco (Nicotiana tabacum L.) depends on field morphological identification, which is problematic in that it is labor intensive, time-consuming, and susceptible to environmental impacts. In order to improve the efficiency and accuracy of tobacco DUS testing, the development of a molecular marker-based method for genetic diversity identification is urgently needed. RESULTS: In total, 91 simple sequence repeats (SSR) markers with clear and polymorphic amplification bands were obtained with polymorphism information content, Nei index, and Shannon information index values of 0.3603, 0.4040, and 0.7228, respectively. Clustering analysis showed that the 33 study varieties, which are standard varieties for flue-cured tobacco DUS testing, could all be distinguished from one another. Further analysis showed that a minimum of 25 markers were required to identify the genetic diversity of these varieties. Following the principle of two markers per linkage group, 48 pairs of SSR markers were selected. Correlation analysis showed that the genetic relationships revealed by the 48 SSR markers were consistent with those found using the 91 SSR markers. CONCLUSIONS: The genetic fingerprints of the 33 standard varieties of flue-cured tobacco were constructed using 48 SSR markers, and an SSR marker-based identification technique for new tobacco varieties was developed. This study provides a reliable technological approach for determining the novelty of new tobacco varieties and offers a solid technical basis for the accreditation and protection of new tobacco varieties.

MicroRNA-615-5p Regulates Angiogenesis and Tissue Repair by Targeting AKT/eNOS (Protein Kinase B/Endothelial Nitric Oxide Synthase) Signaling in Endothelial Cells.

Objective- In response to tissue injury, the appropriate progression of events in angiogenesis is controlled by a careful balance between pro and antiangiogenic factors. We aimed to identify and characterize microRNAs that regulate angiogenesis in response to tissue injury. Approach and Results- We show that in response to tissue injury, microRNA-615-5p (miR-615-5p) is rapidly induced and serves as an antiangiogenic microRNA by targeting endothelial cell VEGF (vascular endothelial growth factor)-AKT (protein kinase B)/eNOS (endothelial nitric oxide synthase) signaling in vitro and in vivo. MiR-615-5p expression is increased in wounds of diabetic db/db mice, in plasma of human subjects with acute coronary syndromes, and in plasma and skin of human subjects with diabetes mellitus. Ectopic expression of miR-615-5p markedly inhibited endothelial cell proliferation, migration, network tube formation in Matrigel, and the release of nitric oxide, whereas miR-615-5p neutralization had the opposite effects. Mechanistic studies using transcriptomic profiling, bioinformatics, 3' untranslated region reporter and microribonucleoprotein immunoprecipitation assays, and small interfering RNA dependency studies demonstrate that miR-615-5p inhibits the VEGF-AKT/eNOS signaling pathway in endothelial cells by targeting IGF2 (insulin-like growth factor 2) and RASSF2 (Ras-associating domain family member 2). Local delivery of miR-615-5p inhibitors, markedly increased angiogenesis, granulation tissue thickness, and wound closure rates in db/db mice, whereas miR-615-5p mimics impaired these effects. Systemic miR-615-5p neutralization improved skeletal muscle perfusion and angiogenesis after hindlimb ischemia in db/db mice. Finally, modulation of miR-615-5p expression dynamically regulated VEGF-induced AKT signaling and angiogenesis in human skin organoids as a model of tissue injury. Conclusions- These findings establish miR-615-5p as an inhibitor of VEGF-AKT/eNOS-mediated endothelial cell angiogenic responses and that manipulating miR-615-5p expression could provide a new target for angiogenic therapy in response to tissue injury. Visual Overview- An online visual overview is available for this article.

Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity.

Thrombin-binding aptamer (TBA) is a DNA 15-mer of sequence 5'-GGT TGG TGT GGT TGG-3' that folds into a G-quadruplex structure linked by two T-T loops located on one side and a T-G-T loop on the other. These loops are critical for post-SELEX modification to improve TBA target affinity. With this goal in mind we synthesized a T analog, 5-(indolyl-3-acetyl-3-amino-1-propenyl)-2'-deoxyuridine (W) to substitute one T or a pair of Ts. Subsequently, the affinity for each analog was determined by biolayer interferometry. An aptamer with W at position 4 exhibited about 3-fold increased binding affinity, and replacing both T4 and T12 with W afforded an almost 10-fold enhancement compared to native TBA. To better understand the role of the substituent's aromatic moiety, an aptamer with 5-(methyl-3-acetyl-3-amino-1-propenyl)-2'-deoxyuridine (K; W without the indole moiety) in place of T4 was also synthesized. This K4 aptamer was found to improve affinity 7-fold relative to native TBA. Crystal structures of aptamers with T4 replaced by either W or K bound to thrombin provide insight into the origins of the increased affinities. Our work demonstrates that facile chemical modification of a simple DNA aptamer can be used to significantly improve its binding affinity for a well-established pharmacological target protein.

Evoking picomolar binding in RNA by a single phosphorodithioate linkage.

RNA aptamers are synthetic oligonucleotide-based affinity molecules that utilize unique three-dimensional structures for their affinity and specificity to a target such as a protein. They hold the promise of numerous advantages over biologically produced antibodies; however, the binding affinity and specificity of RNA aptamers are often insufficient for successful implementation in diagnostic assays or as therapeutic agents. Strong binding affinity is important to improve the downstream applications. We report here the use of the phosphorodithioate (PS2) substitution on a single nucleotide of RNA aptamers to dramatically improve target binding affinity by ∼1000-fold (from nanomolar to picomolar). An X-ray co-crystal structure of the α-thrombin:PS2-aptamer complex reveals a localized induced-fit rearrangement of the PS2-containing nucleotide which leads to enhanced target interaction. High-level quantum mechanical calculations for model systems that mimic the PS2 moiety and phenylalanine demonstrate that an edge-on interaction between sulfur and the aromatic ring is quite favorable, and also confirm that the sulfur analogs are much more polarizable than the corresponding phosphates. This favorable interaction involving the sulfur atom is likely even more significant in the full aptamer-protein complexes than in the model systems.

Rutile TiO2 Flocculent Ripples with High Antireflectivity and Superhydrophobicity on the Surface of Titanium under 10 ns Laser Irradiation without Focusing.

We report on the formation of rutile TiO2 flocculent laser-induced periodic surface structures (LIPSSs) with high antireflectivity and superhydrophobicity on the surface of titanium under 10 ns 1064 nm laser irradiation without focusing. The center part of the Gaussian laser beam is used to deposit flocculent structure and the edge part used to produce LIPSSs. The melt and modification thresholds of titanium were determined first, and then, the melt and modification spot-overlap numbers, several responsible for the formation of flocculent structure and LIPSSs, were introduced. It is found that both the melt and modification spot-overlap numbers increase with an increase in laser fluence and spot-overlap number, contributing to the production of flocculent LIPSSs. LIPSSs are obtained with the modification spot-overlap number above 300, and the amount of flocculent structures increases with an increase in the peak laser fluence and spot-overlap number. Then, considering that the fine adjustment of the melt and modification spot-overlop numbers in one-time line scanning is quite difficult, the composite structure, of which both LIPSSs and flocculent structures are distinct, was optimized using laser line scanning twice. On this basis, a characterization test shows the sample full of the flocculent LIPSSs represents best antireflectivity with the value around 10% in the waveband between 260 and 2600 nm (advance 5 times in infrared wavelengths compared to the initial titanium surface), and shows the no-stick hydrophobicity with the contact angle of 160° and roll-off angle of 25° because of the pure rutile phase of TiO2.

Thioflavin T as a fluorescence light-up probe for both parallel and antiparallel G-quadruplexes of 29-mer thrombin binding aptamer.

A wide range of pathologies have been targeted with bimodular aptamers that contain both G-quadruplex (G4) and duplex motifs, while the structures and functions are poorly understood. G4-selective fluorescent dyes have served as facile tools to probe G4s, but not for bimodular aptamers, yet. Here, taking the 29-mer thrombin binding aptamer (TBA29) as an example, we demonstrated that 3,6-dimethyl-2-(4-dimethylaminophenyl)-benzothiazolium (ThT) was the most effective dye compared to NMM and PPIX in recognizing TBA29. Binding studies indicate that ThT recognized TBA29 via distinct buffer-dependent mechanisms. Specifically, ThT induced the formation of a bimolecular parallel G4 in cation-deficient buffer, showing 341-fold fluorescent enhancement. The competitive binding of thrombin disrupted the complex, leading to the monotonic fluorescence decrease. A similar mechanism was previously reported for the interaction between ThT and the 15-mer thrombin binding aptamer (TBA15). However, TBA29 bound with ThT in a more favorable state than TBA15, showing hyperchromic effects and two times stronger fluorescence enhancement. Differently, ThT bound with antiparallel TBA29/TBA15 in an intercalating/groove binding mode in 100 mM KCl, generating 181/28-fold fluorescence enhancement, respectively. These results revealed that ThT recognized both parallel and antiparallel G4s of TBA29 more efficiently than it recognized TBA15. The duplex structure of TBA29 may play an important role in its interaction with ThT. Our study broadens the application of ThT in screening G4 to bimodular aptamers and provides some insights into the structures of TBA29, along with the interaction between ThT and TBA29. Our study also is useful for the development of structure-switching-based biosensors using bimodular aptamers. Graphical abstract The buffer-dependent binding mechanisms of ThT with TBA29, and the competitive (top)/noncompetitive (bottom) binding of thrombin with TBA29-ThT complex.

Antitumor effects of pharmacological EZH2 inhibition on malignant peripheral nerve sheath tumor through the miR-30a and KPNB1 pathway.

BACKGROUND: Enhancer of zeste homolog 2 (EZH2) is a key epigenetic regulator in cancer cell survival, epithelial-mesenchymal transition, and tumorigenesis. Inhibition of EZH2 has become a promising therapeutic option for various human malignancies. Previously, we demonstrated that the EZH2/miR-30d/karyopherin (importin) beta 1 (KPNB1) signaling pathway is critical for malignant peripheral nerve sheath tumor (MPNST) cell survival in vitro and for tumorigenesis in vivo. Here, we sought to determine the antitumor effects of pharmacological inhibition of EZH2 on MPNST in vitro and in vivo. METHODS: We investigated the effects of an EZH2 inhibitor, 3-deazaneplanocin A (DZNep), on MPNST cell cycle, survival and apoptosis in vitro and on MPNST xenograft tumor growth in vivo. RESULTS: We found that DZNep treatment impaired MPNST cell viability and proliferation by inducing apoptosis and cell cycle arrest in vitro. Consistently, DZNep treatment also reduced EZH2 and KPNB1 protein levels and upregulated miR-30d expression in MPNST cells. Intraperitoneal administration of DZNep significantly suppressed MPNST tumor initiation and growth rates in a MPNST xenograft mouse model. Immunoblot and immunohistochemical analyses showed that DZNep downregulated EZH2/KPNB1 signaling in vivo, thereby inhibiting MPNST tumor cell proliferation, and induced cell death. We also found that EZH2 inhibited expression of another miR-30 family member, miR-30a, in MPNST cells. Similar to miR-30d, miR-30a inhibited KPNB1 by targeting the KPNB1 3' untranslated region in MPNST cells. Our data also showed that EZH2 suppressed miR-200b expression and induced epithelial-mesenchymal transition in MPNST cells. CONCLUSION: These findings demonstrated that DZNep, an inhibitor of S-adenosyl-methionine-dependent methyltransferase, suppressed EZH2/miR-30a,d/KPNB1 signaling and blocked MPNST tumor cell growth and survival in vitro and in vivo. More importantly, our study indicated that pharmacological interference of EZH2 is a potential therapeutic approach for MPNST.

Synthesis of Nucleotides Bearing the 2'-O-Trifluoromethyl Group and Their Application in RNA Analogs Preparation.

The integration of fluorine atoms into biologically active organic compounds has proved to be a vital technique in small molecule drugs. This technique can substantially enhance crucial properties, including metabolic stability, lipophilicity, and bioavailability, often with a mere addition of a single fluorine atom or a trifluoromethyl group. Over the past few decades, this concept has also been applied in nucleic acid chemistry. A commonly employed 2'-OH substitution is the introduction of a 2'-deoxy-2'-fluoro (2'-F) group. The strong electronegativity of fluorine prompts the modified siRNA to readily adopt a C3'-endo conformation, resulting in significant advantages in terms of binding affinity. To enrich the toolbox of chemical modification of oligonucleotides, the replacement of the 2'-OH with the 2'-O-trifluoromethyl group has been developed in RNA analog synthesis. Oligodeoxynucleotides containing the 2'-O-trifluoromethyl group can greatly increase the thermal stability of DNA/RNA duplexes depending on the position and amount of the modification. Moreover, 2'-O-trifluoromethylated oligodeoxynucleotide also exhibited a slightly higher resistance to snake venom phosphodiesterase than the unmodified oligodeoxynucleotide. The 2'-O-trifluoromethylated oligonucleotides can emerge as a label to study RNA structure and function as well, or to develop DNA/RNA-based diagnostics. Hence, it is necessary to report an effective method for the synthesis, deprotection, purification, and characterization of oligonucleotides bearing a 2'-O-trifluoromethyl group. © 2024 Wiley Periodicals LLC. Basic Protocol 1: Preparation of 6-N-benzoyl-5'-O-dimethoxytrityl-2'-O-trifluoromethyl adenosine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 2: Preparation of 4-N-acetyl-5'-O-dimethoxytrityl-2'-O-trifluoromethyl cytidine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 3: Preparation of 2-N-isobutyryl-5'-O-dimethoxytrityl-2'-O-trifluoromethyl guanine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 4: Preparation of 5'-O-dimethoxytrityl-2'-O-2-trifluoromethyl uridine 3'-(2-cyanoethyl N,N-diisopropyl) phosphoramidite Basic Protocol 5: Solid-phase synthesis of 2'-O-trifluoromethylated RNA analogs Basic Protocol 6: Deprotection and purification of 2'-O-trifluoromethyl-RNAs.

A Convenient Method for the Synthesis of 2'-O-Cyanoethylated Nucleotides and Their Application in the Solid-Phase Synthesis of Related RNA Analogs.

Although small interfering RNA (siRNA) is a key player among gene inhibition therapeutics, there are many obstacles to the development of siRNA drugs due to inherent properties of oligonucleotides, including the unsatisfactory stability of unmodified siRNA, poor pharmacokinetic distribution, and the toxicity induced by off-target effects. To maximize treatment potency, chemical modification of siRNA has undoubtedly been the most successful strategy by far. Widely applied modifications include phosphorothioate linkages, 2'-O-methyl modifications, and 2'-fluoro modifications, among others. To extend the family of chemical modifications for oligonucleotides, 2'-O-cyanoethylated RNA analogs were developed through the replacement of the 2'-hydroxyl group with a 2'-O-cyanoethyl group (-OCH2 CH2 CN). This modification can provide several advantages over unmodified RNA, such as increased stability, improved binding affinity to complementary DNA or RNA strands, and resistance to degradation by cellular nucleases. The 2'-O-cyanoethyl-modified RNAs not only are applied in RNA silencing machinery but also act as research tools for studying RNA structure and function or for developing RNA-based diagnostics. Therefore, the efficient synthesis, deprotection, purification, and characterization of 2'-O-cyanoethylated RNAs deserves more attention. This protocol describes the chemical synthesis of 2'-O-cyanoethylated nucleotides and the solid-phase synthesis, deprotection, and purification of 2'-O-cyanoethylated RNAs. © 2023 Wiley Periodicals LLC. Basic Protocol 1: Preparation of 6-N-dimethylformamidyl-5'-O-dimethoxytrityl-2'-O-cyanoethyl adenosine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 2: Preparation of 4-N-acetyl-5'-O-dimethoxytrityl-2'-O-cyanoethyl cytidine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 3: Preparation of 2-N-dimethylformamidyl-5'-O-dimethoxytrityl-2'-O-cyanoethyl guanine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 4: Preparation of 5'-O-dimethoxytrityl-2'-O-2-cyanoethyl uridine 3'-(2-cyanoethyl N,N-diisopropyl)phosphoramidite Basic Protocol 5: Solid-phase synthesis of 2'-O-cyanoethylated RNA analogs Basic Protocol 6: Deprotection and purification of synthesized 2'-O-cyanoethyl-RNAs.

Remaining useful life and state of health prediction for lithium batteries based on differential thermal voltammetry and a deep learning model.

The accurate estimation of battery health conditions is a crucial challenge for development of battery management systems due to the degradation of cathode and anode materials. In this paper, a fusion of deep learning model and feature analysis methods is employed to approach accurate estimation for state of health (SOH) and remaining useful life (RUL). The differential thermal voltammetry (DTV) signal analysis is executed to pre-process the datasets from Oxford University. A deep learning model is constructed with LSTM network as the core, combined with Bayesian optimization and dropout technique. This work shows that the deep learning model could approach the SOH and RUL early estimation with the mean absolute error of RUL maintained around 0.5%. It is potential that this deep learning model, combined with DTV signal analysis methods, could approach early prediction and estimation of battery SOH and RUL, contributing to the development of the next-generation high-energy-density and highly safety commercial batteries.

Aptamers as affinity reagents in an integrated electrophoretic lab-on-a-chip platform.

Nucleic acid based affinity reagents (e.g., aptamers) offer several possible advantages over antibodies as specific recognition elements in biochemical assays. Besides offering improved cost and stability, aptamers are ideal for rapid electrophoretic analysis due to their low molecular weight and high negative charge. While aptamers have proven well-suited for affinity-shift electrophoretic analysis, demonstrating a fully integrated aptamer-based assay platform represents an important achievement toward low-cost point-of-care analysis, particularly for remote or resource poor settings where cost and ambient stability of reagents is a key consideration. Here we perform and evaluate the suitability of aptamer-based affinity assays for two clinically relevant target analytes (IgE using a known aptamer and NF-κB using a thio-modified aptamer) in an integrated electrophoretic gel-shift platform. Key steps of (i) mixing sample with aptamer, (ii) buffer exchange, and (iii) preconcentration of sample were successfully integrated on-chip upstream of a fluorescence-based gel-shift analysis step. This approach, utilizing a size-exclusion membrane optimized here for aptamer retention and preconcentration with sample, enables automated sample-to-answer for trace analytes in 10 min or less. We addressed notable nonspecific interference from serum proteins by adding similar nucleic acid competitors to suppress such interactions with the aptamer. Nanomolar sensitivities were demonstrated and integrated preconcentration of sample provides an important means of further improving detection sensitivities. Aptamers proved superior in many respects to antibody reagents, particularly with regard to speed and resolution of gel-shifts associated with specific binding to target.

Identifying and targeting angiogenesis-related microRNAs in ovarian cancer.

Current anti-angiogenic therapy for cancer is based mainly on inhibition of the vascular endothelial growth factor pathway. However, due to the transient and only modest benefit from such therapy, additional approaches are needed. Deregulation of microRNAs (miRNAs) has been demonstrated to be involved in tumor angiogenesis and offers opportunities for a new therapeutic approach. However, effective miRNA-delivery systems are needed for such approaches to be successful. In this study, miRNA profiling of patient data sets, along with in vitro and in vivo experiments, revealed that miR-204-5p could promote angiogenesis in ovarian tumors through THBS1. By binding with scavenger receptor class B type 1 (SCARB1), reconstituted high-density lipoprotein-nanoparticles (rHDL-NPs) were effective in delivering miR-204-5p inhibitor (miR-204-5p-inh) to tumor sites to suppress tumor growth. These results offer a new understanding of miR-204-5p in regulating tumor angiogenesis.

PTGER3 induces ovary tumorigenesis and confers resistance to cisplatin therapy through up-regulation Ras-MAPK/Erk-ETS1-ELK1/CFTR1 axis.

BACKGROUND: Inflammatory mediator prostaglandin E2-prostaglandin E2 receptor EP3 (PTGER3) signaling is critical for tumor-associated angiogenesis, tumor growth, and chemoresistance. However, the mechanism underlying these effects in ovarian cancer is not known. METHODS: An association between higher tumoral expression of PTGER3 and shorter patient survival in the ovarian cancer dataset of The Cancer Genome Atlas prompted investigation of the antitumor effects of PTGER3 downmodulation. PTGER3 mRNA and protein levels were higher in cisplatin-resistant ovarian cancer cells than in their cisplatin-sensitive counterparts. FINDINGS: Silencing of PTGER3 via siRNA in cancer cells was associated with decreased cell growth and less invasiveness, as well as cell-cycle arrest and increased apoptosis, mediated through the Ras-MAPK/Erk-ETS1-ELK1/CFTR1 axis. Furthermore, sustained PTGER3 silencing with multistage vector and liposomal 2'-F-phosphorodithioate-siRNA-mediated silencing of PTGER3 combined with cisplatin resulted in robust antitumor effects in cisplatin-resistant ovarian cancer models. INTERPRETATION: These findings identify PTGER3 as a potential therapeutic target in chemoresistant ovarian cancers expressing high levels of this oncogenic protein. FUND: National Institutes of Health/National Cancer Institute, USA.

Selection of PD1/PD-L1 X-Aptamers.

Specific, chemically modified aptamers (X-Aptamers) were identified against two immune checkpoint proteins, recombinant Programmed Death 1 (PD-1) and Programmed Death Ligand 1 (PD-L1). Selections were performed using a bead-based X-Aptamer (XA) library containing several different amino acid functional groups attached to dU at the 5-position. The binding affinities and specificities of the selected XA-PD1 and XA-PDL1 were validated by hPD-1 and hPD-L1 expression cells, as well as by binding to human pancreatic ductal adenocarcinoma tissue. The selected PD1 and PDL1 XAs can mimic antibody functions in in vitro assays.

ZRANB1 Is an EZH2 Deubiquitinase and a Potential Therapeutic Target in Breast Cancer.

Although EZH2 enzymatic inhibitors have shown antitumor effects in EZH2-mutated lymphoma and ARID1A-mutated ovarian cancer, many cancers do not respond because EZH2 can promote cancer independently of its histone methyltransferase activity. Here we identify ZRANB1 as the EZH2 deubiquitinase. ZRANB1 binds, deubiquitinates, and stabilizes EZH2. Depletion of ZRANB1 in breast cancer cells results in EZH2 destabilization and growth inhibition. Systemic delivery of ZRANB1 small interfering RNA (siRNA) leads to marked antitumor and antimetastatic effects in preclinical models of triple-negative breast cancer (TNBC). Intriguingly, a small-molecule inhibitor of ZRANB1 destabilizes EZH2 and inhibits the viability of TNBC cells. In patients with breast cancer, ZRANB1 levels correlate with EZH2 levels and poor survival. These findings suggest the therapeutic potential for targeting the EZH2 deubiquitinase ZRANB1.

Solid-Phase Synthesis of RNA Analogs Containing Phosphorodithioate Linkages.

The oligoribonucleotide phosphorodithioate (PS2-RNA) modification uses two sulfur atoms to replace two non-bridging oxygen atoms at an internucleotide phosphorodiester backbone linkage. Like a natural phosphodiester RNA backbone linkage, a PS2-modified backbone linkage is achiral at phosphorus. PS2-RNAs are highly stable to nucleases and several in vitro assays have demonstrated their biological activity. For example, PS2-RNAs silenced mRNA in vitro and bound to protein targets in the form of PS2-aptamers (thioaptamers). Thus, the interest in and promise of PS2-RNAs has drawn attention to synthesizing, isolating, and characterizing these compounds. RNA-thiophosphoramidite monomers are commercially available from AM Biotechnologies and this unit describes an effective methodology for solid-phase synthesis, deprotection, and purification of RNAs having PS2 internucleotide linkages. © 2017 by John Wiley & Sons, Inc.

Origins of the enhanced affinity of RNA-protein interactions triggered by RNA phosphorodithioate backbone modification.

The well-characterized interaction between the MS2 coat protein and its cognate RNA hairpin was used to evaluate changes in affinity as a result of phosphorodithioate (PS2) replacing phosphate by biolayer interferometry (BLI). A structure-based analysis of the data provides insights into the origins of the enhanced affinity of RNA-protein interactions triggered by the PS2 moiety.

Selection of thioaptamers for diagnostics and therapeutics.

Thioaptamers offer advantages over normal phosphate ester backbone aptamers due to their enhanced affinity, specificity, and higher stability, largely due to the properties of the sulfur backbone modifications. Over the past several years, in vitro thioaptamer selection and bead-based thioaptamer selection techniques have been developed in our laboratory. Furthermore, several thioaptamers targeting specific proteins such as transcription factor NF-kappaB and AP-1 proteins have been identified. Selected thioaptamers have been shown diagnostic promise in proteome screens. Moreover, some promising thioaptamers have been shown in preliminary animal therapeutic dosing to increase survival in animal models of infection with West Nile virus.