Integrated profiling identifies DXS253E as a potential prognostic marker in colorectal cancer.

BACKGROUND: Increasing evidence suggests that DXS253E is critical for cancer development and progression, but the function and potential mechanism of DXS253E in colorectal cancer (CRC) remain largely unknown. In this study, we evaluated the clinical significance and explored the underlying mechanism of DXS253E in CRC. METHODS: DXS253E expression in cancer tissues was investigated using the Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. The Kaplan-Meier plot was used to assess the prognosis of DXS253E. The cBioPortal, MethSurv, and Tumor Immune Estimation Resource (TIMER) databases were employed to analyze the mutation profile, methylation, and immune infiltration associated with DXS253E. The biological functions of DXS253E in CRC cells were determined by CCK-8 assay, plate cloning assay, Transwell assay, flow cytometry, lactate assay, western blot, and qRT-PCR. RESULTS: DXS253E was upregulated in CRC tissues and high DXS253E expression levels were correlated with poor survival in CRC patients. Our bioinformatics analyses showed that high DXS253E gene methylation levels were associated with the favorable prognosis of CRC patients. Furthermore, DXS253E levels were linked to the expression levels of several immunomodulatory genes and an abundance of immune cells. Mechanistically, the overexpression of DXS253E enhanced proliferation, migration, invasion, and the aerobic glycolysis of CRC cells through the AKT/mTOR pathway. CONCLUSIONS: We demonstrated that DXS253E functions as a potential role in CRC progression and may serve as an indicator of outcomes and a therapeutic target for regulating the AKT/mTOR pathway in CRC.

Tandem Mass Tag-Based Proteomic Profiling Identifies Biomarkers in Drainage Fluid for Early Detection of Anastomotic Leakage after Rectal Cancer Resection.

Anastomotic leakage (AL), one of the most severe complications in rectal surgery, is often diagnosed late because of the low specificity of the clinical symptoms and limitations of current clinical investigations. Identification of patients with early AL remains challenging. Here, we explored the protein expression profiles of AL patients to provide potential biomarkers to identify AL in patients who undergo surgery for rectal cancer. We screened differentially expressed proteins (DEPs) in drainage fluid from AL and non-AL patients using a tandem mass tag method. A total of 248 DEPs, including 98 upregulated and 150 downregulated proteins, were identified between AL and non-AL groups. Gene ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses suggested that DEPs were enriched in neutrophil degranulation, bacterial infection, proteolysis, hemostasis, and complement and coagulation cascades. The results of enzyme-linked immunosorbent assay validated that the expression of the top three upregulated DEPs, AMY2A, RETN, and CELA3A, was significantly increased in the drainage fluid of AL patients, compared with that of non-AL patients (AMY2A, P = 0.001; RETN, P < 0.0001; and CELA3A, P = 0.023). Thus, our findings provide several potential biomarkers for the early diagnosis of AL after rectal cancer resection.

Design, synthesis and bioactivity evaluations of 8-substituted-quinoline-2-carboxamide derivatives as novel histone deacetylase (HDAC) inhibitors.

The inhibition of histone deacetylases (HDACs) has been considered a promising therapeutic strategy for treatment of many diseases, especially cancer. In the current study, a series of 8-substituted quinoline-2-carboxamide derivatives were designed and synthesized as potent HDAC inhibitors. The most potent compound 21 g (IC50 = 0.050 µM) exhibited 3-fold greater HDAC inhibitory activity compared to the known HDAC inhibitor Vorinostat (IC50 = 0.137 µM). Additionally, compound 21g exhibited low toxicity against normal cells(IC50 in HUVEC cell > 50 µM) and showed good liver microsomal stability, therefore, may serve as a new lead compound for further development.

Design, synthesis and biological evaluations of novel farnesoid X receptor (FXR) agonists.

As a member of the nuclear receptor superfamily, the farnesoid X receptor (FXR) is a bile acid activated transcription factor. FXR is involved in many important metabolic processes and serves as a promising therapeutic target for nonalcoholic steatohepatitis (NASH). Since discovered, the first non-steroidal FXR agonist GW4064 has been widely used to explore the biological functions of FXR, however, the low pharmacokinetic limited its further clinical application. In current study, we designed a series of substituted isothiazoles as new FXR agonists. Among them, five compounds exhibited better FXR agonistic activity than GW4064. Specially, the most potent compound S5 possessed better pharmacokinetic profile and in vivo potency than lead compound.

Complete genome sequence of Edgeworthia chrysantha mosaic-associated virus, a tentative new member of the genus Coguvirus (family Phenuiviridae).

A new negative-strand RNA (nsRNA) virus genome was discovered in Edgeworthia chrysantha Lindl. This virus, tentatively named "Edgeworthia chrysantha mosaic-associated virus" (ECMaV), has a bipartite genome that comprises (i) a nsRNA1, encoding the viral RNA-dependent RNA polymerase (RdRp), and (ii) an ambisense RNA2, coding for the putative movement protein (MP) and nucleocapsid protein (NP), with the open reading frames separated by a long AU-rich intergenic region (IR). Sequence comparisons and phylogenetic analysis showed that the RdRp is closely related to those of other recently discovered plant-infecting nsRNA viruses in the new genus Coguvirus and that ECMaV can be classified as a member of a novel species.

Design, synthesis and biological evaluation of hydantoin derivatives as Mcl-1 selective inhibitors.

As a member of Bcl-2 protein family, myeloid cell leukemia-1 (Mcl-1) plays a critical role in cell apoptosis and has become a promising anti-cancer drug target. Herein, we designed and synthesized a series of hydantoin derivatives as novel Mcl-1 inhibitors based on our previously developed lead compound. Among them, compound M23 and M24 exhibited good binding affinities against Mcl-1 with Ki values of 0.49 µM and 0.33 µM respectively. Especially, compound M23 exhibited good selectivity over Bcl-xL, whereas compound M24 possessed good selectivity over both Bcl-2 and Bcl-xL. Furthermore, we also investigated the effects of these new Mcl-1 inhibitors on cell proliferation, apoptosis and mitochondrial membrane potential, as well as the stability in plasma.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

[Analysis of IQSEC2 gene variant in a child with X-linked mental retardation].

OBJECTIVE: To analyze the clinical phenotype and genetic variants of a child with X-linked mental retardation caused by IQSEC2 gene mutation, and provide reference for the diagnosis of the disease. METHODS: The child was subjected to next generation sequencing (NGS), and the diagnosis was made by taking consideration of her clinical characteristics. RESULTS: The child has presented with global developmental delay, particularly in fine motor skill and language development, in addition with intellectual disability. Genetic testing revealed that she has harbored a heterozygous c.1861dup variant of the IQSEC2 gene, which was not detected in either parent. CONCLUSION: The de novo c.186ldup variant of the IQSEC2 gene probably underlay the X-linked mental retardation in this child. Above finding has, expanded the spectrum of IQSEC2 gene mutations and provide a basis for the diagnosis of similar cases.

Synthesis and evaluation of a UMI-77-based fluorescent probe for selective detecting Mcl-1 protein and imaging in living cancer cells.

Development of efficient fluorescent probes for detecting the overexpressed Mcl-1 protein in living cells is imperative for the diagnosis and treatment of cancers. In this paper, a new UMI-77 based fluorescent probe (DNSH), was synthesized and characterized. DNSH bound to the hydrophobic pockets of Mcl-1 protein tightly and the binding affinity was 20-fold higher than that of previous developed Mcl-1 probe. DNSH exhibited specific fluorescence response to Mcl-1 protein rather than other proteins. In the presence of Mcl-1 protein, fluorescence emission of DNSH can be switched on. Furthermore, fluorescence colocalization experiment demonstrated that DNSH can be successfully used for imaging mitochondrial Mcl-1 protein in human prostate cancer cells without a washing process. These results showed that DNSH may find useful applications in biological research such as tracking Mcl-1 protein in living biological specimens.

Early chest computed tomography to diagnose COVID-19 from suspected patients: A multicenter retrospective study.

Objective: The purpose of this study was to distinguish the imaging features of COVID-19 from those of other infectious pulmonary diseases and evaluate the diagnostic value of chest CT for suspected COVID-19 patients. Methods: Adult patients suspected of COVID-19 aged >18 years who underwent chest CT scans and reverse-transcription polymerase chain reaction (RT-PCR) tests within 14 days of symptom onset were enrolled. The enrolled patients were confirmed and grouped according to the results of the RT-PCR tests. The basic demographics, single chest CT features, and combined chest CT features were analyzed for the confirmed and nonconfirmed groups. Results: A total of 130 patients were enrolled, with 54 testing positive and 76 testing negative. The typical CT imaging features of the positive group were ground glass opacities (GGOs), the crazy-paving pattern and air bronchogram. The lesions were mostly distributed bilaterally and close to the lower lungs or the pleura. When features were combined, GGOs with bilateral pulmonary distribution and GGOs with pleural distribution were more common among the positive patients, found in 31 (57.4%) and 30 patients (55.6%), respectively. The combinations were almost all statistically significant (P < .05), except for the combination of GGOs with consolidation. Most combinations presented relatively low sensitivity but extremely high specificity. The average specificity of these combinations was approximately 90%. Conclusions: The combinations with GGOs could be useful in the identification and differential diagnosis of COVID-19, alerting clinicians to isolate patients for prompt treatment and repeat RT-PCR tests until the end of incubation.

Transcriptome characterization of candidate genes related to chromium uptake, transport and accumulation in Miscanthus sinensis.

Miscanthus sinensis is a C4 perennial grass species that is widely used as forage, ornamental grass and bioenergy crop due to its broad adaption and great biological traits. Recent studies indicated that M. sinensis could also grow in marginal lands which were contaminated with heavy metals, and exhibited important ecological restoration potential. In this study, transcriptome characterization of candidate genes related to chromium (Cr) uptake, transport and accumulation in M. sinensis were employed to investigate the molecular mechanism of plant tolerance to heavy metal stress. The result showed that following treatment of 200 mg/L of Cr, plant roots could accumulate most Cr and localize mainly in cell walls and soluble fractions, whereas Cr in stems and leaves was primarily in soluble fractions. A total of 83,645 differentially expressed genes (DEGs) were obtained after the treatment. Many genes involved in heavy metal transport, metal ion chelation and photosynthesis were found to be Cr-induced DEGs. Co-expression and weighted correlation network analysis revealed that Glutathion metabolism and ABC transporters pathways play an important role in Cr tolerance of M. sinensis. A hypothesis schematic diagram for the Cr uptake, transport and accumulation of M. sinensis cells were suggested, which could provide a molecular and genetic basis for future candidate genes validation and breeding of such crops.

Genome-wide investigation of the NAC transcript factor family in perennial ryegrass (Lolium perenne L.) and expression analysis under various abiotic stressor.

NAC is one of the largest family of plant-specific transcription factors, and it plays important roles in plant development and stress responses. The study identified 72 LpNACs genes from the perennial ryegrass genome database. Gene length, MW and pI of NAC family transcription factors varied, but the gene structure and motifs were relatively conserved in bioinformatics analysis. Phylogenetic analyses of perennial ryegrass, rice and Arabidopsis were performed to study the evolutionary and functional relationships in various species. The expression of LpNAC genes that respond to various abiotic stresses including high salinity, ABA, high temperature, polyethylene glycol (PEG) and heavy metal was comprehensively analyzed. The present study provides a basic understanding of the NAC gene family in perennial ryegrass for further abiotic stress studies and improvements in breeding.

Programmed death-ligand 1 triggers PASMCs pyroptosis and pulmonary vascular fibrosis in pulmonary hypertension.

Pyroptosis is a pro-inflammatory form of programmed cell death, whose genesis directly depended on caspase-1 activation. Pulmonary hypertension (PH) is a disease characterized, in part, by vascular fibrosis. Up to now, there is no report on the relationship between pyroptosis and vascular fibrosis in PH. Here, we confirmed that pyroptosis had occurred in the media of pulmonary arteries in two PH rat models and hypoxic human pulmonary arterial smooth muscle cells (hPASMCs). Caspase-1 inhibition attenuated the pathogenesis of PH, as assessed by vascular remodeling, right ventricular systolic pressure, right ventricle hypertrophy and hemodynamic parameters of pulmonary vasculature. Moreover, caspase-1 inhibition suppressed pulmonary vascular fibrosis as demonstrated by Masson staining, as well as immunohistochemistry and Western blot analysis of fibrillar collagen. In addition, Programmed death-ligand 1 (PD-L1) was markedly increased in PH, which was regulated by the transcription factor STAT1. Furthermore, PD-L1 knockdown in hPASMCs repressed the onset of hypoxia-induced pyroptosis and fibrosis. Overall, these data identify a critical STAT1-dependent posttranscriptional modification that promotes PD-L1 expression in the pyroptosis of PASMCs to modulate pulmonary vascular fibrosis and accelerate the progression of PH.

S100a8/a9 Signaling Causes Mitochondrial Dysfunction and Cardiomyocyte Death in Response to Ischemic/Reperfusion Injury.

BACKGROUND: Myocardial ischemia-reperfusion (MI/R) injury is a significant clinical problem without effective therapy. Unbiased omics approaches may reveal key MI/R mediators to initiate MI/R injury. METHODS: We used a dynamic transcriptome analysis of mouse heart exposed to various MI/R periods to identify S100a8/a9 as an early mediator. Using loss/gain-of-function approaches to understand the role of S100a8/a9 in MI/R injury, we explored the mechanisms through transcriptome and functional experiment. Dynamic serum S100a8/a9 levels were measured in patients with acute myocardial infarction before and after percutaneous coronary intervention. Patients were prospectively followed for the occurrence of major adverse cardiovascular events. RESULTS: S100a8/a9 was identified as the most significantly upregulated gene during the early reperfusion stage. Knockout of S100a9 markedly decreased cardiomyocyte death and improved heart function, whereas hematopoietic overexpression of S100a9 exacerbated MI/R injury. Transcriptome/functional studies revealed that S100a8/a9 caused mitochondrial respiratory dysfunction in cardiomyocytes. Mechanistically, S100a8/a9 downregulated NDUF gene expression with subsequent mitochondrial complex I inhibition via Toll-like receptor 4/Erk-mediated Pparg coactivator 1 alpha/nuclear respiratory factor 1 signaling suppression. Administration of S100a9 neutralizing antibody significantly reduced MI/R injury and improved cardiac function. Finally, we demonstrated that serum S100a8/a9 levels were significantly increased 1 day after percutaneous coronary intervention in patients with acute myocardial infarction, and elevated S100a8/a9 levels were associated with the incidence of major adverse cardiovascular events. CONCLUSIONS: Our study identified S100a8/a9 as a master regulator causing cardiomyocyte death in the early stage of MI/R injury via the suppression of mitochondrial function. Targeting S100a8/a9-intiated signaling may represent a novel therapeutic intervention against MI/R injury. CLINICAL TRIAL REGISTRATION: URL: https://www.clinicaltrials.gov. Unique identifier: NCT03752515.

Identification of candidate reference genes for quantitative RT-PCR in Miscanthus sinensis subjected to various abiotic stresses.

Quantitative real-time PCR (qRT-PCR) has been widely used for studying gene expression at the transcript level. Its accuracy usually relies on the reference genes that are utilized for data normalization. Miscanthus sinensis, a perennial C4 grass with high biomass and strong resistance to adversities, is often utilized as a high value energy crop. However, no reliable reference genes have been investigated for normalizing gene expression for this species. In this study, 12 candidate reference genes were selected to identify their stability under five different abiotic stress treatments (drought, salt, cadmium, chromium and arsenic) by using geNorm, NormFinder, BestKeeper and RefFinder softwares. The results showed that 18S rRNA and Unigene33312 were the best reference genes under drought treatments. Unigene33312 and Unigene33024 were found to be the most stably expressed genes under salt stress and Cd stress. Moreover, Unigene33024 and PP2A were the most suitable reference genes under Cr stress and Unigene33024 and Sb09g019750 were deemed more suitable reference genes under As stress. In total, considering all the samples, Unigene33024 and PP2A were the most stable genes while ACTIN and Unigene26576 were the least stable reference genes for internal control. The expression patterns of two target genes (Cu/Zn SOD and CAT) were used to further verify those selected reference genes under different conditions. The results showed that the most and the least stable reference genes had clearly different expression patterns. This work comprehensively estimated the stability of reference genes in M. sinensis which may give insight to the reference genes selection in other tissues as well as other related varieties. These suggested reference genes would assist in further putative gene expression validation in M. sinensis.

[Clinical effect of tacrolimus in the treatment of myasthenia gravis in children].

OBJECTIVE: To evaluate the efficacy and safety of tacrolimus in the treatment of children with myasthenia gravis (MG). METHODS: A total of 28 children with MG were treated with tacrolimus. MG-Activities of Daily Living (MG-ADL) scale was used to assess clinical outcome and safety after 1, 3, 6, 9, and 12 months of treatment. RESULTS: After tacrolimus treatment, the MG-ADL score at 1, 3, 6, 9 and 12 months was lower than that at baseline (P<0.05), and the MG-ADL score showed a gradually decreasing trend. The response rates to tacrolimus treatment at 1, 3, 6, 9, and 12 months were 59%, 81%, 84%, 88%, and 88% respectively. At 6, 9, 12, and 18 months of treatment, 4, 13, 14, and 15 children respectively were withdrawn from prednisone. No recurrence was observed during treatment. Major adverse reactions/events were asymptomatic reduction in blood magnesium in 5 children and positive urine occult blood in 1 child, which turned negative without special treatment, and tacrolimus was not stopped due to such adverse reactions/events. One child was withdrawn from tacrolimus due to recurrent vomiting. According to CYP3A5 genotypes, all of the patients were divided into two groups: slow metabolic type (n=19) and non-slow metabolic type (fast metabolic type + intermediate type; n=9). The non-slow metabolism group received a higher dose of tacrolimus, but had a lower trough concentration of tacrolimus than the slow metabolism group (P<0.05). The slow metabolism group had a higher response rates to tacrolimus treatment than the non-slow metabolism group (P<0.05). CONCLUSIONS: Tacrolimus appears to be effective and safe in the treatment of children with MG and is thus an option for immunosuppressive therapy. CYP3A5 genotyping has a certain guiding significance for determining the dosage of tacrolimus.

Design, synthesis and preliminary bioactivity studies of indomethacin derivatives as Bcl-2/Mcl-1 dual inhibitors.

Bcl-2 family proteins, which divides into pro-apoptosis proteins and anti-apoptosis proteins, are involved in cell apoptosis progression. As numerous studies illustrated, targeting Bcl-2 family proteins is more and more attractive and practicable to cancer treatment. In this work, we designed and synthesized a series of indomethacin derivatives as new inhibitors for Bcl-2 family proteins. Our results of binding assay to Bcl-2 proteins, MTT assay and apoptotic assay indicated that some compounds had potent binding affinity to Bcl-2/Mcl-1 but not Bcl-XL. Furthermore, compound 8j showed improved anti-proliferative activity than known Bcl-2 inhibitor WL-276.

Puerarin prevents progression of experimental hypoxia-induced pulmonary hypertension via inhibition of autophagy.

Pulmonary arterial hypertension (PAH) is defined as elevation of mean pulmonary arterial pressure to ≥25 mmHg within the low pressure pulmonary circulatory system. PAH is characterized by obstructive vascular remodeling, partially due to excessive pulmonary arterial smooth muscle cell (PASMC) proliferation. Puerarin is a natural flavonoid isolated from the herb Radix puerariae, which has been widely used for the treatment of cardiovascular and cerebrovascular disorders and diabetes. However, how puerarin mediates autophagy in the progression of pulmonary vascular remodeling is unclear. In this study, we explored the effects of puerarin in a hypoxic pulmonary hypertension (PH) rat model using immunohistochemistry, and morphometric analyses of right ventricle. In addition, cell counting kit 8 assay, western blotting and flow cytometry were employed to test cell proliferation in PASMCs, and then autophagy was tested with mRFP-GFP-LC3 fluorescence microscopy and Western blot. We found that puerarin could alleviate hypoxia-induced PH in rats and improved pulmonary histopathology, and also reduced the expression of autophagy markers in vivo and in vitro. Moreover, puerarin also ameliorated hypoxia-induced PASMC proliferation in an autophagy-dependent manner. Overall, these findings demonstrated that puerarin could prevent hypoxia-induced PH in rats, possibly via reducing autophagy and suppressing cell proliferation.

Discovery and development of 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid derivatives as Bcl-2/Mcl-1 inhibitors.

Bcl-2 family proteins play a vital role for cancer cell in escaping apoptosis, and small-molecule anti-apoptotic Bcl-2 protein inhibitors have been developed as new anticancer therapies. In current study, a series of substituted 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid derivatives were developed based on the lead compound 1 (Ki = 5.2 µM against Bcl-2 protein). The fluorescence polarization assays suggested that active compounds possessed potent binding affinities to both Bcl-2 and Mcl-1 protein, but had minor or no binding affinities to Bcl-XL protein. MTT assays showed that these compounds had certain anti-proliferative activities against cancer cells. Furthermore, it was found that active compound 11t could induce cell apoptosis and caspase-3 activation in a dose-dependent manner in Jurkat cells.

Polymeric immunoglobulin receptor promotes tumor growth in hepatocellular carcinoma.

Deregulation of the immune system is believed to contribute to cancer malignancy, which has led to recent therapeutic breakthroughs facilitating antitumor immunity. In a malignant setting, immunoglobulin receptors, which are fundamental components of the human immune system, fulfill paradoxical roles in cancer pathogenesis. This study describes a previously unrecognized pro-oncogenic function of polymeric immunoglobulin receptor (pIgR) in the promotion of cell transformation and proliferation. Mechanistically, pIgR overexpression is associated with YES proto-oncogene 1, Src family tyrosine kinase (Yes) activation, which is required for pIgR-induced oncogenic growth. Specifically, pIgR activates the Yes-DNAX-activating protein of 12 kDa-spleen tyrosine kinase-Rac1/CDC42-MEK (extracellular signal-regulated kinase kinase)/ERK (extracellular signal-regulated kinase) cascade in an immunoreceptor tyrosine-based activating motif (ITAM)-dependent manner to promote cell transformation and tumor growth, although pIgR itself does not contain an ITAM sequence. Additionally, the combination of pIgR and phosphorylated Yes (p-Yes) levels serves as a prognostic biomarker for hepatitis B surface antigen-positive and early-stage hepatocellular carcinoma (HCC) patients. Moreover, pharmacological targeting of MEK/ERK or Yes represents a therapeutic option for the subgroup of patients with pIgR/p-Yes-positive HCC based on our results with both cancer cell-line-based xenografts and primary patient-derived xenografts. CONCLUSION: Our findings reveal the molecular mechanism by which pIgR promotes cancer malignancy, suggest the clinical potential of targeting this pathway in HCC, and provide new insight into the oncogenic role of immunoglobulin receptors. (Hepatology 2017;65:1948-1962).