Terpestacin inhibits tumor angiogenesis by targeting UQCRB of mitochondrial complex III and suppressing hypoxia-induced reactive oxygen species production and cellular oxygen sensing.

Cellular oxygen sensing is required for hypoxia-inducible factor-1alpha stabilization, which is important for tumor cell survival, proliferation, and angiogenesis. Here we find that terpestacin, a small molecule previously identified in a screen of microbial extracts, binds to the 13.4-kDa subunit (UQCRB) of mitochondrial Complex III, resulting in inhibition of hypoxia-induced reactive oxygen species generation. Consequently, such inhibition blocks hypoxia-inducible factor activation and tumor angiogenesis in vivo, without inhibiting mitochondrial respiration. Overexpression of UQCRB or its suppression using RNA interference demonstrates that it plays a crucial role in the oxygen sensing mechanism that regulates responses to hypoxia. These findings provide a novel molecular basis of terpestacin targeting UQCRB of Complex III in selective suppression of tumor progression.

PMFF: Development of a Physics-Based Molecular Force Field for Protein Simulation and Ligand Docking.

The physics-based molecular force field (PMFF) was developed by integrating a set of potential energy functions in which each term in an intermolecular potential energy function is derived based on experimental values, such as the dipole moments, lattice energy, proton transfer energy, and X-ray crystal structures. The term "physics-based" is used to emphasize the idea that the experimental observables that are considered to be the most relevant to each term are used for the parameterization rather than parameterizing all observables together against the target value. PMFF uses MM3 intramolecular potential energy terms to describe intramolecular interactions and includes an implicit solvation model specifically developed for the PMFF. We evaluated the PMFF in three ways. We concluded that the PMFF provides reliable information based on the structure in a biological system and interprets the biological phenomena accurately by providing more accurate evidence of the biological phenomena.

IDMap: facilitating the detection of potential leads with therapeutic targets.

UNLABELLED: Pharmaceutical industry has been striving to reduce the costs of drug development and increase productivity. Among the many different attempts, drug repositioning (retargeting existing drugs) comes into the spotlight because of its financial efficiency. We introduce IDMap which predicts novel relationships between targets and chemicals and thus is capable of repositioning the marketed drugs by using text mining and chemical structure information. Also capable of mapping commercial chemicals to possible drug targets and vice versa, IDMap creates convenient environments for identifying the potential lead and its targets, especially in the field of drug repositioning. AVAILABILITY: IDMap executable and its user manual including color images are freely available to non-commercial users at http://www.equispharm.com/idmap

Identification of novel inhibitors of HCV RNA-dependent RNA polymerase by pharmacophore-based virtual screening and in vitro evaluation.

Hepatitis C virus (HCV) is the major etiological agent of non-A, non-B hepatitis where no effective treatment is available. The HCV NS5B with RNA-dependent RNA polymerase (RdRp) activity is a key target for the treatment of HCV infection. Here we report novel NS5B polymerase inhibitors identified by virtual screening and in vitro evaluation of their inhibitory activities. On the basis of a newly identified binding pocket of NS5B, distinct from the nucleotide binding site but highly conserved among various HCV isolates, we performed virtual screening of compounds that fit this binding pocket from the available chemical database of 3.5 million compounds. The inhibitory activities of the in silico selected 119 compounds were estimated with in vitro RdRp assay. Three compounds with IC50 values of about 20 microM were identified, and their kinetic analyses suggest that these compounds are noncompetitive inhibitors with respect to the ribonucleotide substrate. Furthermore, the single-point mutations of the conserved residues in the binding pocket of NS5B resulted in the significant decrease of the RdRp activity, indicating that the binding pocket presented here might be important for the therapeutic intervention of HCV. These novel inhibitors would be useful for the development of effective anti-HCV agents.

Quinazolines as potent and highly selective PDE5 inhibitors as potential therapeutics for male erectile dysfunction.

In an effort to minimize side effects associated with low selectivity against PDE isozymes, we have successfully identified a series of 6,7,8-substituted quinzaolines as potent inhibitors of PDE5 with high level of isozyme selectivity, especially against PDE6 and PDE11. PDE5 potency and isozyme selectivity of quinazolines were greatly improved with substitutions both at 6- and 8-position. The synthesis, structure-activity relationships and in vivo efficacy of this novel series of potent PDE5 inhibitors are described.

Design and biological evaluation of novel tubulin inhibitors as antimitotic agents using a pharmacophore binding model with tubulin.

Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as potent destabilizer for microtubule formation, very little is known about MDL-27048, a competitive inhibitor for colchicine and podophyllotoxin. The structural basis for the interaction of antimitotic agents with tubulin was investigated by molecular modeling, and we propose binding models for MDL-27048 against tubulin. The proposed model was not only consistent with previous competition experiment data between colchicine and MDL-27048, but further suggested an additional binding cavity on tubulin. Based on this finding from the proposed MDL-tubulin complex, we performed molecular design studies to identify new antimitotic agents. These new chalcone derivatives exerted growth inhibitory effects on all four human hepatoma and one renal epithelial cell lines tested and induced strong cell cycle arrest at G2/M phase. Furthermore, these compounds exhibited a strong inhibitory effect on tubulin polymerization in vitro. Therefore, we suggest that the validated MDL-27048 model would serve as a potent platform for designing new molecular entities for anticancer agents targeted to microtubules.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Structural modeling of V299L and E459K Bcr-Abl mutation, and sequential therapy of tyrosine kinase inhibitors for the compound mutations.

Sequential treatment with different tyrosine kinase inhibitors (TKIs) is one of the strategies for handling chronic myeloid leukemia (CML) in which dynamic change in Bcr-Abl kinase domain mutation is often an obstacle faced during TKI therapy. Here we report successful sequential therapy with different TKIs for the CML patient harboring V299L and E459K compound mutations. Molecular monitoring including quantitative analysis of BCR-ABL transcript level and mutation analysis were performed regularly for successful treatment. Additionally a drug-target complex was structurally modeled to investigate influence of amino acid substitutions on drug resistance, and to choose alternative TKI in sequential therapy, suggesting protein structural modeling can be useful approach in selecting alternative TKIs.

Identification and validation of calmodulin as a binding protein of an anti-proliferative small molecule 3,4-dihydroisoquinolinium salt.

IHY-153 (2-(2,5-difluorobenzyl)-3,4-dihydro-5-(10-hydroxydecyl)-6-methoxy-1-undecylisoquinolinium bromide) was recently discovered as a small molecule that potently inhibits proliferation of tumor cells by inducing cell-cycle arrest at G0-G1 phase. To investigate the basis of anti-proliferative activity of IHY-153, cellular binding proteins of biotinyl-IHY-153 were screened using T7 phage displayed human cDNA libraries. Calmodulin-expressing phage specifically bound to immobilized IHY-153 in a Ca(2+) -dependent manner. The interaction between IHY-153 and Ca(2+) /CaM was validated through phage competition binding assays, surface plasmon resonance analysis, and molecular modeling. IHY-153 induced sustained phosphorylation of extracellular signal-regulated kinase (ERK) 1/2 and subsequently increased p21(WAF1) expression in colon cancer cells. These results demonstrate that IHY-153, a novel small molecule, targets Ca(2+) /CaM and indicate that this compound functions as an anti-proliferative agent by influencing Ca(2+) /CaM-dependent signal transduction.

Novel inhibitors targeted to methionine aminopeptidase 2 (MetAP2) strongly inhibit the growth of cancers in xenografted nude model.

Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In our study reported here, the effects of 4 highly potent methionine aminopeptidase 2 (MetAP2) inhibitors, IDR-803, IDR-804, IDR-805 and CKD-732 (designed by structure-based molecular modeling), on angiogenesis and tumor growth were assessed. Concentrations of these inhibitors as low as 2.5 nM were able to inhibit the growth of human umbilical vein endothelial cells (HUVEC) by as much as 50%, arresting growth in the G1 stage of mitosis. An intracellular accumulation of p21(WAF1/Cip1) protein was also observed. Furthermore, at higher concentrations (25 nM) of these 4 MetAP2 inhibitors, a significant induction of apoptosis was apparent in the same HUVEC cultures. As a result of these findings, the possible anticancer effects of these inhibitors were examined, utilizing the SNU-398 hepatoma cell line. Interestingly, pretreatment with these inhibitors led to an increased number of apoptotic cells of up to 60% or more, compared to untreated controls. Moreover, utilizing an in vivo xenografted murine model, these inhibitors suppressed the growth of engrafted tumor. In conclusion, these 4 inhibitory compounds potently exert an antiangiogenic effect to inhibit the growth of cancers in vivo and could potentially be useful for the treatment of a variety of cancers.

Structure-based virtual screening and biological evaluation of potent and selective ADAM12 inhibitors.

We describe a series of potent and selective inhibitors of ADAM12 that were discovered using computational screening of a focused virtual library. The initial structure-based virtual screening selected 64 compounds from a 3D database of 67,062 molecules. Being evaluated by a cell-based ADAM12 activity assay, compounds 5, 11, 14, 16 were further identified as the potent and selective inhibitors of ADAM12 with low nanomolar IC50 values. The mechanism underlying the potency and selectivity of a representative compound, 5, was investigated through molecular docking studies.

A dipalmitoyl peptide that binds SH3 domain, disturbs intracellular signal transduction, and inhibits tumor growth in vivo.

The Src homology 3 (SH3) domain plays a crucial role in protein-protein interactions during intracellular signal transduction. Blocking the SH3-mediated protein binding may inhibit the corresponding signal transduction, and thus, block the cellular functions. In this study, a peptide that specifically binds to SH3 domain could be introduced into the intracellular region when the peptides were conjugated with dipalmitic acid and appeared to disturb intracellular signaling. The dipalmitoyl peptide appeared to inhibit the phosphorylation of ZAP-70, Lck, and T-cell antigen receptor zeta in Jurkat. Mobilization of the intracellular free calcium induced by anti-CD3 antibody was reduced after treatment with the dipalmitoyl peptide. It was also observed that the dipalmitoyl peptide inhibited cancer cell growth both in vitro and in vivo. These results suggest that the dipalmitoyl peptide that presumably disturbs SH3-mediated signal transduction may have a potent anti-proliferative activity, which would be useful as a potential anti-tumor agent.