Children and young people's understanding of inherited conditions and their attitudes towards genetic testing: A systematic review.

Children and young people are increasingly likely to receive information regarding inherited health risks relevant to their genetic relatives and themselves. We reviewed the literature to determine what children and young people (21 years and younger) understand about inherited conditions and their attitudes towards genetic testing. We screened 1815 abstracts to identify 20 studies representing the perspectives of 1811 children and young people between the ages of 6 and 21 years (1498 children or young people at general population-level risk from 9 studies, 313 affected/at risk from 15 studies). Children and young people at general population-level risk demonstrated a basic understanding that disease predisposition can be inherited within families. Those affected by or at risk of genetic conditions inferred their genetic status from observable, relational characteristics within their family and the results of personal genetic testing if it had occurred, but some misunderstandings of important genetic concepts were evident. Children and young people expressed interest in and a willingness to undertake personal genetic testing, but also articulated concerns about the limitations and risks of testing. Paediatric patients require developmentally-sensitive genetic counselling and support in navigating the unique landscape of their condition.

Evaluating the association of single-nucleotide polymorphisms with tenofovir exposure in a diverse prospective cohort of women living with HIV.

Higher exposure to tenofovir (TFV) increases the risk for kidney function decline, but the impact of genetic factors on TFV exposure is largely unknown. We investigated whether single-nucleotide polymorphisms (SNPs, n=211) in 12 genes are potentially involved in TFV exposure. Participants (n=91) from the Women's Interagency HIV Study, underwent a 24 h intensive pharmacokinetic sampling of TFV after witnessed dose and TFV area under the time-concentration curves (AUCs) were calculated for each participant. SNPs were assayed using a combination of array genotyping and Sanger sequencing. Linear regression models were applied to logarithmically transformed AUC. Those SNPs that met an a priori threshold of P<0.001 were considered statistically associated with TFV AUC. ABCG2 SNP rs2231142 was associated with TFV AUC with rare allele carriers displaying 1.51-fold increase in TFV AUC (95% confidence interval: 1.26, 1.81; P=1.7 × 10-5). We present evidence of a moderately strong effect of the rs2231142 SNP in ABCG2 on a 24 h TFV AUC.

Sociodemographic, psychosocial and clinical factors associated with uptake of genetic counselling for hereditary cancer: a systematic review.

Evidence suggests that a significant proportion of individuals referred to cancer genetic counselling (GC) do not attend, and thus may not be engaged in adequate cancer risk management. We aimed to review the literature to better understand barriers to accessing GC and how they may be overcome. We conducted a systematic literature search for articles examining factors influencing cancer GC uptake as well as motivators and barriers to GC attendance. Factors were categorised as sociodemographic, psychosocial or clinical. The literature search identified 1413 citations, 35 of which met the inclusion criteria. GC uptake ranged from 19% to 88%. With the exceptions of education level, socioeconomic status, cancer-specific distress, personal cancer diagnosis and actual and perceived risk of cancer, support was lacking for most sociodemographic, clinical and psychosocial factors as predictors of GC uptake. Cost and logistical barriers, emotional concerns, family concerns and low perceived personal relevance were reported as important considerations for those declining GC. We conclude that there is poor understanding of GC and a lack of decision support among those referred to GC. Research into ways of providing education and support to referred individuals will be important as the scope and availability of GC and genetic testing broaden.

Effects of obeticholic acid on lipoprotein metabolism in healthy volunteers.

The bile acid analogue obeticholic acid (OCA) is a selective farnesoid X receptor (FXR) agonist in development for treatment of several chronic liver diseases. FXR activation regulates lipoprotein homeostasis. The effects of OCA on cholesterol and lipoprotein metabolism in healthy individuals were assessed. Two phase I studies were conducted to evaluate the effects of repeated oral doses of 5, 10 or 25 mg OCA on lipid variables after 14 or 20 days of consecutive administration in 68 healthy adults. Changes in HDL and LDL cholesterol levels were examined, in addition to nuclear magnetic resonance analysis of particle sizes and sub-fraction concentrations. OCA elicited changes in circulating cholesterol and particle size of LDL and HDL. OCA decreased HDL cholesterol and increased LDL cholesterol, independently of dose. HDL particle concentrations declined as a result of a reduction in medium and small HDL. Total LDL particle concentrations increased because of an increase in large LDL particles. Changes in lipoprotein metabolism attributable to OCA in healthy individuals were found to be consistent with previously reported changes in patients receiving OCA with non-alcoholic fatty liver disease or non-alcoholic steatohepatitis.

Pharmacokinetic indices for cefovecin after single-dose administration to adult sea otters (Enhydra lutris).

Seven sea otters received a single subcutaneous dose of cefovecin at 8 mg/kg body weight. Plasma samples were collected at predetermined time points and assayed for total cefovecin concentrations using ultra-performance liquid chromatography and tandem mass spectrometry. The mean (±SD) noncompartmental pharmacokinetic indices were as follows: CMax (obs) 70.6 ± 14.6 µg/mL, TMax (obs) 2.9 ± 1.5 h, elimination rate constant (kel ) 0.017 ± 0.002/h, elimination half-life (t1/2kel) 41.6 ± 4.7 h, area under the plasma concentration-vs.-time curve to last sample (AUClast) 3438.7 ± 437.7 h·µg/mL and AUC extrapolated to infinity (AUC0→∞ ) 3447.8 ± 439.0 h·µg/mL. The minimum inhibitory concentrations (MIC) for select isolates were determined and used to suggest possible dosing intervals of 10 days, 5 days, and 2.5 days for gram-positive, gram-negative, and Vibrio parahaemolyticus bacterial species, respectively. This study found a single subcutaneous dose of cefovecin sodium in sea otters to be clinically safe and a viable option for long-acting antimicrobial therapy.

Relation of HLA class I and II supertypes with spontaneous clearance of hepatitis C virus.

Human leukocyte antigen (HLA) genotype has been associated with the probability of spontaneous clearance of hepatitis C virus (HCV). However, no prior studies have examined whether this relationship may be further characterized by grouping HLA alleles according to their supertypes, defined by their binding capacities. There is debate regarding the most appropriate method to define supertypes. Therefore, previously reported HLA supertypes (46 class I and 25 class II) were assessed for their relation with HCV clearance in a population of 758 HCV-seropositive women. Two HLA class II supertypes were significant in multivariable models that included: (i) supertypes with significant or borderline associations with HCV clearance after adjustment for multiple tests, and (ii) individual HLA alleles not part of these supertypes, but associated with HCV clearance in our prior study in this population. Specifically, supertype DRB3 (prevalence ratio (PR)=0.4; P=0.004) was associated with HCV persistence, whereas DR8 (PR=1.8; P=0.01) was associated with HCV clearance. Two individual alleles (B*57:01 and C*01:02) associated with HCV clearance in our prior study became nonsignificant in analysis that included supertypes, whereas B*57:03 (PR=1.9; P=0.008) and DRB1*07:01 (PR=1.7; P=0.005) retained their significance. These data provide epidemiologic support for the significance of HLA supertypes in relation to HCV clearance.

Genetic counseling training and certification in Australasia.

The development of standards for training and certification is essential to the credibility and integrity of a developing profession. Training and certification of genetic counselors in Australasia has undergone a detailed review during the past few years, resulting in changes to the way certification is obtained. This paper presents an overview of the process of developing a robust training and certification program which reflects the social and cultural environment of genetic counselors working in Australasia. A brief history of the development of the profession in Australasia is provided, followed by a detailed discussion of the recent development of Masters programs and a portfolio of work required for certification. The importance of consultation within the profession and with our colleagues in the field of human genetics is considered, and we provide a discussion of defining moments that occurred during the review. This paper is intended to provide a detailed description of genetic counselor training and certification in Australasia. We anticipate that our insights into the process of redevelopment of training and certification guidelines may be helpful for genetic counselors working in countries where certification requirements are being developed.

Use of the ACTH challenge test to identify the predominant glucocorticoid in the southern sea otter (Enhydra lutris nereis).

After nearly being hunted to extinction during the fur trade of the late 20th Century, sea otter (Enhydra lutris) populations have recovered to varying degrees of their historical range. While overall population numbers and range have increased, there are regions in which expansion has occurred at a slower rate and/or animal numbers have decreased, which may be a result of chronic stress from a variety of sources. Some have employed glucocorticoid analysis in their attempts to validate these explanations. Our goal was to conduct a controlled study using sea otters managed under human care to validate the use of serum glucocorticoid analysis to monitor stress physiology in the sea otter. We used a standard ACTH challenge test to compare cortisol and corticosterone responses, thereby identifying the primary glucocorticoid in the sea otter. Fourteen sea otters of both sexes (five males, nine females), including juveniles, sub-adults and adults, participated in the study. The results of the testing supported cortisol as the primary glucocorticoid in the sea otter. Sex and age did not affect how the individual responded to the ACTH or saline injection. Interestingly, the saline injection not only confirmed the effects of the ACTH on glucocorticoid release from the adrenal glands but also provided information on how long it takes the sea otter's glucocorticoid levels to return to baseline after capture and sedation. The insight gained from this study will aid in future efforts to better understand the role of stress in free-ranging sea otter populations. Recognition of the primary glucocorticoid will facilitate evaluation of more stable biological material, such as fur or whiskers, which tend to be less affected by the diurnal cycling of glucocorticoids.

Women's responses and understanding of polygenic breast cancer risk information.

It is estimated that polygenic factors can explain up to 18% of familial breast cancer. Clinical implementation of polygenic testing has begun, with several commercial laboratories now testing. Despite commercial implementation, there is little research investigating how women respond and understand polygenic risk information. This study aimed to explore women's experience receiving their personalised polygenic risk score (PRS) and compare responses of women at different levels of polygenic risk. Eligible participants were affected and unaffected women from families clinically assessed to be at high risk for breast cancer who had received their personalised PRS as part of the Variants in Practice Psychosocial Study (ViPPs). In-depth semi-structured interviews were conducted with 21 women (mean age 53.4 years) up to four weeks after receiving their PRS. Interviews were transcribed verbatim and analysed using thematic analysis. Eleven women received a PRS that was in the top quartile of PRS distribution and 10 in the lowest quartile. Women's lived experience with breast cancer informed how they responded to their PRS, constructed and made sense of breast cancer risk following receipt of their PRS, and integrated this new information into their breast cancer risk management. Regardless of polygenic risk level, all participants demonstrated broad knowledge of concepts related to polygenic information and were able to accurately describe the implications of their PRS. Receiving PRS did not appear to negatively impact women's reported distress levels. Our findings suggest polygenic breast cancer information is well received and understood by women at high-risk for breast cancer.

CO-MP4, a polyethylene glycol-conjugated haemoglobin derivative and carbon monoxide carrier that reduces myocardial infarct size in rats.

BACKGROUND AND PURPOSE: MP4 (Hemospan) is a Hb-based oxygen therapeutic agent, based on polyethylene-glycol (PEG) conjugation to Hb, undergoing clinical trials as an oxygen carrier. This study describes the functional interaction between MP4 and carbon monoxide (CO), as a CO delivery agent, and the effects of CO-MP4 on myocardial infarct size following ischaemia and reperfusion in rats. EXPERIMENTAL APPROACH: Kinetic measurements of CO-MP4 binding were used to evaluate the effects of PEG modification on Hb subunit structure/function and to calculate CO-MP4 equilibrium constants. CO transport by CO-MP4 was shown by ligand (O2/CO) partitioning between MP4 and red blood cell (RBC)-Hb. Pharmacological effects of CO-MP4 were studied on myocardial infarction in rats. KEY RESULTS: CO binding kinetics show primary structural/functional effects on beta chains in MP4, with alpha chains maintaining the ability to undergo tertiary conformational transition. CO confers long-term, room-temperature stability and is able to rapidly re-equilibrate between MP4 and RBCs. In a rat model of myocardial infarct, in contrast to oxy-MP4, CO-MP4 reduced infarct size when administered prior to the induction of ischaemia. CONCLUSIONS AND IMPLICATIONS: MP4 PEGylation chemistry modifies the individual function of Hb subunits, but results in an overall CO equilibrium constant similar to that for unmodified Hb. CO-MP4 is able to deliver CO to the circulation and reduces ischaemia/reperfusion injury in rats, providing the first evidence for this drug as a CO therapeutic agent.

Adenosine-mediated inhibition of platelet aggregation by acadesine. A novel antithrombotic mechanism in vitro and in vivo.

Inhibition of platelet aggregation by acadesine was evaluated both in vitro and ex vivo in human whole blood using impedance aggregometry, as well as in vivo in a canine model of platelet-dependent cyclic coronary flow reductions. In vitro, incubation of acadesine in whole blood inhibited ADP-induced platelet aggregation by 50% at 240 +/- 60 microM. Inhibition of platelet aggregation was time dependent and was prevented by the adenosine kinase inhibitor, 5'-deoxy 5-iodotubercidin, which blocked conversion of acadesine to its 5'-monophosphate, ZMP, and by adenosine deaminase. Acadesine elevated platelet cAMP in whole blood, which was also prevented by adenosine deaminase. In contrast, acadesine had no effect on ADP-induced platelet aggregation or platelet cAMP levels in platelet-rich plasma, but inhibition of aggregation was restored when isolated erythrocytes were incubated with acadesine before reconstitution with platelet-rich plasma. Acadesine (100 mg/kg i.v.) administered to human subjects also inhibited platelet aggregation ex vivo in whole blood. In the canine Folts model of platelet thrombosis, acadesine (0.5 mg/kg per min, i.v.) abolished coronary flow reductions, and this activity was prevented by pretreatment with the adenosine receptor antagonist, 8-sulphophenyltheophylline. These results demonstrate that acadesine exhibits antiplatelet activity in vitro, ex vivo, and in vivo through an adenosine-dependent mechanism. Moreover, the in vitro studies indicate that inhibition of platelet aggregation requires the presence of erythrocytes and metabolism of acadesine to acadesine monophosphate (ZMP).

Incorporation of somatic BRAF mutation testing into an algorithm for the investigation of hereditary non-polyposis colorectal cancer.

Patients suspected on clinical grounds to have hereditary non-polyposis colorectal cancer (HNPCC) may be offered laboratory testing in order to confirm the diagnosis and to facilitate screening of pre-symptomatic family members. Tumours from an affected family member are usually pre-screened for microsatellite instability (MSI) and/or loss of immunohistochemical expression of mismatch repair (MMR) genes prior to germline MMR gene mutation testing. The efficiency of this triage process is compromised by the more frequent occurrence of sporadic colorectal cancer (CRC) showing high levels of MSI (MSI-H) due to epigenetic loss of MLH1 expression. Somatic BRAF mutations, most frequently V600E, have been described in a significant proportion of sporadic MSI-H CRC but not in HNPCC-associated cancers. BRAF mutation testing has therefore been proposed as a means to more definitively identify and exclude sporadic MSI-H CRC cases from germline MMR gene testing. However, the clinical validity and utility of this approach have not been previously evaluated in a familial cancer clinic setting. Testing for the V600E mutation was performed on MSI-H CRC samples from 68 individuals referred for laboratory investigation of suspected HNPCC. The V600E mutation was identified in 17 of 40 (42%) tumours showing loss of MLH1 protein expression by immunohistochemistry but in none of the 28 tumours that exhibited loss of MSH2 expression (P < 0.001). The assay was negative in all patients with an identified germline MMR gene mutation. Although biased by the fact that germline testing was not pursued beyond direct sequencing in many cases lacking a high clinical index of suspicion of HNPCC, BRAF V600E detection was therefore considered to be 100% specific and 48% sensitive in detecting sporadic MSI-H CRC amongst those cases showing loss of MLH1 protein expression, in a population of patients with MSI-H CRC and clinical features suggestive of HNPCC. Accordingly, we recommend the incorporation of BRAF V600E mutation testing into the laboratory algorithm for pre-screening patients with suspected HNPCC, whose CRCs show loss of expression of MLH1. In such tumours, the presence of a BRAF V600E mutation indicates the tumour is not related to HNPCC and that germline testing of MLH1 in that individual is not warranted. We also recommend that in families where the clinical suspicion of HNPCC is high, germline testing should not be performed on an individual whose CRC harbours a somatic BRAF mutation, as this may compromise identification of the familial mutation.

A Systems Model for Ursodeoxycholic Acid Metabolism in Healthy and Patients With Primary Biliary Cirrhosis.

A systems model was developed to describe the metabolism and disposition of ursodeoxycholic acid (UDCA) and its conjugates in healthy subjects based on pharmacokinetic (PK) data from published studies in order to study the distribution of oral UDCA and potential interactions influencing therapeutic effects upon interruption of its enterohepatic recirculation. The base model was empirically adapted to patients with primary biliary cirrhosis (PBC) based on current understanding of disease pathophysiology and clinical measurements. Simulations were performed for patients with PBC under two competing hypotheses: one for inhibition of ileal absorption of both UDCA and conjugates and the other only of conjugates. The simulations predicted distinctly different bile acid distribution patterns in plasma and bile. The UDCA model adapted to patients with PBC provides a platform to investigate a complex therapeutic drug interaction among UDCA, UDCA conjugates, and inhibition of ileal bile acid transport in this rare disease population.

Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.

A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending.

Molecular dynamics studies of axis bending in d(G5-(GA4T4C)2-C5) and d(G5-(GT4A4C)2-C5): effects of sequence polarity on DNA curvature.

Gel retardation studies and other experiments indicate that DNA sequences containing the d(GA4T4C)n motif are curved, whereas those of identical composition but with a reverse sequence polarity, the d(GT4A4C)n motif, are straight. Hydroxyl radical cleavage experiments show that d(GA4T4C)n shows a unique signature, whereas d(GT4A4C)n behaves normally. To explain these results at a molecular level, molecular dynamics (MD) simulations were performed on the DNA duplexes d(G5-(GA4T4C)2-C5) and d(G5-(GT4A4C)2-C5) to 3.0 and 2.5 ns, respectively. The MD simulations are based on the Cornell force field implemented in the AMBER 4.1 modeling package and performed in a neutral solution of anionic DNA with K+, Cl- and Mg2+ at concentrations roughly comparable to a ligase buffer. Long range interactions were treated by the particle mesh Ewald method. Analysis of the results shows that the calculated dynamical structure of d(G5-(GA4T4C)2-C5) exhibits strong gross curvature, consistent with the observed behavior. The most significant locus of curvature in the MD structure is found at the central C15-G16 step, with an average roll angle of 12.8(+/-6.40)deg. The d(G5-(GT4A4C)2-C5) MD structure exhibited significantly less gross curvature. Analysis of results indicates that the reduction in gross curvature in the d(G5-(GT4A4C)2-C5) trajectory originates from the effect of the T10-A11 and T20-A21 steps, which showed average roll angles of 12.5(+/-5)deg. These three steps, T10-A11, C15-G16 and T20-A21, are half-helix turns away from one another, and their contributions to concerted bending cancel out. The A-tracts in the MD structure are essentially straight. The dynamical structure of d(G5-(GA4T4C)2-C5) exhibited minor groove deformation comprised of expansion at the 5' end of A-tracts and progressive narrowing towards the 3' end, consistent with and elaborating the interpretation of hydroxyl radical chemical probing results.

Bright light treatment of winter depression: a placebo-controlled trial.

BACKGROUND: Bright light therapy is the recommended treatment for winter seasonal affective disorder (SAD). However, the studies with the best placebo controls have not been able to demonstrate that light treatment has a benefit beyond its placebo effect. METHODS: Ninety-six patients with SAD completed the study. Patients were randomly assigned to 1 of 3 treatments for 4 weeks, each 1.5 hours per day: morning light (average start time about 6 AM), evening light (average start about 9 PM), or morning placebo (average start about 6 AM). The bright light (approximately 6000 lux) was produced by light boxes, and the placebos were sham negative-ion generators. Depression ratings using the Structured Interview Guide for the Hamilton Depression Rating Scale, SAD version (SIGH-SAD) were performed weekly. RESULTS: There were no differences among the 3 groups in expectation ratings or mean depression scores after 4 weeks of treatment. However, strict response criteria revealed statistically significant differences; after 3 weeks of treatment morning light produced more of the complete or almost complete remissions than placebo. By 1 criterion (24-item SIGH-SAD score <50% of baseline and < or =8), 61% of the patients responded to morning light, 50% to evening light, and 32% to placebo after 4 weeks of treatment. CONCLUSIONS: Bright light therapy had a specific antidepressant effect beyond its placebo effect, but it took at least 3 weeks for a significant effect to develop. The benefit of light over placebo was in producing more of the full remissions.

Eccentric decline squat protocol offers superior results at 12 months compared with traditional eccentric protocol for patellar tendinopathy in volleyball players.

BACKGROUND: Conservative treatment of patellar tendinopathy has been minimally investigated. Effective validated treatment protocols are required. OBJECTIVES: To investigate the immediate (12 weeks) and long term (12 months) efficacy of two eccentric exercise programmes for the treatment of patellar tendinopathy. METHODS: This was a prospective randomised controlled trial of 17 elite volleyball players with clinically diagnosed and imaging confirmed patellar tendinopathy. Participants were randomly assigned to one of two treatment groups: a decline group and a step group. The decline group were required to perform single leg squats on a 25 degrees decline board, exercising into tendon pain and progressing their exercises with load. The step group performed single leg squats on a 10 cm step, exercising without tendon pain and progressing their exercises with speed then load. All participants completed a 12 week intervention programme during their preseason. Outcome measures used were the Victorian Institute of Sport Assessment (VISA) score for knee function and 100 mm visual analogue scale (VAS) for tendon pain with activity. Measures were taken throughout the intervention period and at 12 months. RESULTS: Both groups had improved significantly from baseline at 12 weeks and 12 months. Analysis of the likelihood of a 20 point improvement in VISA score at 12 months revealed a greater likelihood of clinical improvements in the decline group than the step group. VAS scores at 12 months did not differ between the groups. CONCLUSIONS: Both exercise protocols improved pain and sporting function in volleyball players over 12 months. This study indicates that the decline squat protocol offers greater clinical gains during a rehabilitation programme for patellar tendinopathy in athletes who continue to train and play with pain.

Apc and p53 interaction in DNA damage and genomic instability in hepatocytes.

Disruption of Apc (adenomatous polyposis coli) within hepatocytes activates Wnt signalling, perturbs differentiation and ultimately leads to neoplasia. Apc negatively regulates Wnt signalling but is also involved in organizing the cytoskeleton and may have a role in chromosome segregation. In vitro studies have implicated Apc in the control of genomic stability. However, the relevance of this data has been questioned in vivo as Apc is lost earlier than the onset of genomic instability. Here we analyse the relationship between immediate loss of Apc and the acquisition of genomic instability in hepatocytes. We used Cre-lox technology to inactivate Apc and in combination with p53 in vivo, to define the consequences of gene loss on cell cycle regulation, proliferation, death and aneuploidy. We show that, although Apc loss leads to increased proliferation, it also leads to increased apoptosis, the accumulation of p53, p21 and markers of double-strand breaks and DNA repair. Flow cytometry revealed an increased 4N DNA content, consistent with a G2 arrest. Levels of anaphase bridges were also elevated, implicating failed chromosome segregation. This was accompanied by an increase in centrosome number, which demonstrates a role for Apc in maintaining euploidy. To address the role of p53 in these processes, we analysed combined loss of Apc and p53, which led to a further increase in proliferation, cell death, DNA damages and repair and a bypass of G2 arrest than was observed with Apc loss. However, we observed only a marginal effect on anaphase bridges and centrosome number, which could be due to increased cell death. Our data therefore establishes, in an in vivo setting, that APC loss leads to a DNA damage signature and genomic instability in the liver and that additional loss of p53 leads to an increase in the DNA damage signal but not to an immediate increase in the genomic instability phenotype.

Epigenomic analysis of the HOX gene loci reveals mechanisms that may control canonical expression patterns in AML and normal hematopoietic cells.

HOX genes are highly expressed in many acute myeloid leukemia (AML) samples, but the patterns of expression and associated regulatory mechanisms are not clearly understood. We analyzed RNA sequencing data from 179 primary AML samples and normal hematopoietic cells to understand the range of expression patterns in normal versus leukemic cells. HOX expression in AML was restricted to specific genes in the HOXA or HOXB loci, and was highly correlated with recurrent cytogenetic abnormalities. However, the majority of samples expressed a canonical set of HOXA and HOXB genes that was nearly identical to the expression signature of normal hematopoietic stem/progenitor cells. Transcriptional profiles at the HOX loci were similar between normal cells and AML samples, and involved bidirectional transcription at the center of each gene cluster. Epigenetic analysis of a subset of AML samples also identified common regions of chromatin accessibility in AML samples and normal CD34(+) cells that displayed differences in methylation depending on HOX expression patterns. These data provide an integrated epigenetic view of the HOX gene loci in primary AML samples, and suggest that HOX expression in most AML samples represents a normal stem cell program that is controlled by epigenetic mechanisms at specific regulatory elements.