Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 29
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
País de afiliação
Intervalo de ano de publicação
1.
Mol Med ; 30(1): 102, 2024 Jul 15.
Artigo em Inglês | MEDLINE | ID: mdl-39009982

RESUMO

BACKGROUND: Acute monocytic leukemia-M5 (AML-M5) remains a challenging disease due to its high morbidity and poor prognosis. In addition to the evidence mentioned earlier, several studies have shown that programmed cell death (PCD) serves a critical function in treatment of AML-M5. However, the role and relationship between ferroptosis and necroptosis in AML-M5 remains unclear. METHODS: THP-1 cells were mainly treated with Erastin and IMP-366. The changes of ferroptosis and necroptosis levels were detected by CCK-8, western blot, quantitative real-time PCR, and electron microscopy. Flow cytometry was applied to detect the ROS and lipid ROS levels. MDA, 4-HNE, GSH and GSSG were assessed by ELISA kits. Intracellular distribution of FSP1 was studied by immunofluorescent staining and western blot. RESULTS: The addition of the myristoylation inhibitor IMP-366 to erastin-treated acute monocytic leukemia cell line THP-1 cell not only resulted in greater susceptibility to ferroptosis characterized by lipid peroxidation, glutathione (GSH) depletion and mitochondrial shrinkage, as the FSP1 position on membrane was inhibited, but also increased p-RIPK1 and p-MLKL protein expression, as well as a decrease in caspase-8 expression, and triggered the characteristic necroptosis phenomena, including cytoplasmic translucency, mitochondrial swelling, membranous fractures by FSP1 migration into the nucleus via binding importin α2. It is interesting to note that ferroptosis inhibitor fer-1 reversed necroptosis. CONCLUSION: We demonstrated that inhibition of myristoylation by IMP-366 is capable of switching ferroptosis and ferroptosis-dependent necroptosis in THP-1 cells. In these findings, FSP1-mediated ferroptosis and necroptosis are described as alternative mechanisms of PCD of THP-1 cells, providing potential therapeutic strategies and targets for AML-M5.


Assuntos
Ferroptose , Necroptose , Humanos , Acrilamidas , Apoptose , Membrana Celular/metabolismo , Núcleo Celular/metabolismo , Complexo de Proteínas Formadoras de Poros Nucleares , Piperazinas/farmacologia , Espécies Reativas de Oxigênio/metabolismo , Proteínas de Ligação a RNA , Sulfonamidas , Células THP-1
2.
J Transl Med ; 22(1): 236, 2024 03 04.
Artigo em Inglês | MEDLINE | ID: mdl-38439097

RESUMO

BACKGROUND: Spontaneous intracerebral hemorrhage (sICH) is associated with significant mortality and morbidity. Predicting the prognosis of patients with sICH remains an important issue, which significantly affects treatment decisions. Utilizing readily available clinical parameters to anticipate the unfavorable prognosis of sICH patients holds notable clinical significance. This study employs five machine learning algorithms to establish a practical platform for the prediction of short-term prognostic outcomes in individuals afflicted with sICH. METHODS: Within the framework of this retrospective analysis, the model underwent training utilizing data gleaned from 413 cases from the training center, with subsequent validation employing data from external validation center. Comprehensive clinical information, laboratory analysis results, and imaging features pertaining to sICH patients were harnessed as training features for machine learning. We developed and validated the model efficacy using all the selected features of the patients using five models: Support Vector Machine (SVM), Logistic Regression (LR), Random Forest (RF), XGboost and LightGBM, respectively. The process of Recursive Feature Elimination (RFE) was executed for optimal feature screening. An internal five-fold cross-validation was employed to pinpoint the most suitable hyperparameters for the model, while an external five-fold cross-validation was implemented to discern the machine learning model demonstrating the superior average performance. Finally, the machine learning model with the best average performance is selected as our final model while using it for external validation. Evaluation of the machine learning model's performance was comprehensively conducted through the utilization of the ROC curve, accuracy, and other relevant indicators. The SHAP diagram was utilized to elucidate the variable importance within the model, culminating in the amalgamation of the above metrics to discern the most succinct features and establish a practical prognostic prediction platform. RESULTS: A total of 413 patients with sICH patients were collected in the training center, of which 180 were patients with poor prognosis. A total of 74 patients with sICH were collected in the external validation center, of which 26 were patients with poor prognosis. Within the training set, the test set AUC values for SVM, LR, RF, XGBoost, and LightGBM models were recorded as 0.87, 0.896, 0.916, 0.885, and 0.912, respectively. The best average performance of the machine learning models in the training set was the RF model (average AUC: 0.906 ± 0.029, P < 0.01). The model still maintains a good performance in the external validation center, with an AUC of 0.817 (95% CI 0.705-0.928). Pertaining to feature importance for short-term prognostic attributes of sICH patients, the NIHSS score reigned supreme, succeeded by AST, Age, white blood cell, and hematoma volume, among others. In culmination, guided by the RF model's variable importance weight and the model's ROC curve insights, the NIHSS score, AST, Age, white blood cell, and hematoma volume were integrated to forge a short-term prognostic prediction platform tailored for sICH patients. CONCLUSION: We constructed a prediction model based on the results of the RF model incorporating five clinically accessible predictors with reliable predictive efficacy for the short-term prognosis of sICH patients. Meanwhile, the performance of the external validation set was also more stable, which can be used for accurate prediction of short-term prognosis of sICH patients.


Assuntos
Hemorragia Cerebral , Hematoma , Humanos , Prognóstico , Estudos Retrospectivos , Hemorragia Cerebral/diagnóstico por imagem , Aprendizado de Máquina
3.
Environ Res ; 245: 118017, 2024 Mar 15.
Artigo em Inglês | MEDLINE | ID: mdl-38157965

RESUMO

As the largest beer producer and consumer in the world, China's endeavors to reduce solid waste generation (SWG) and carbon emissions (CEs) in the course of beer production assume paramount significance. This study aims to assess the SWG and CEs in beer production within China at both national and provincial levels, and further delves into the spatial distribution characteristics and evolving patterns across the country. Key findings of the study include:(1) Peak SWG and CEs were recorded in 2013, reaching 861.62 million tons and 2315.10 tCO2e, respectively, followed by a consistent decline. (2) Among the three types of solid waste, spent grain exhibited the highest generation rate, contributing to 94.38% of the total. (3) The emergence of China's beer industry dates back to the 1980s in the northeastern region, expanding to the southeastern and the Yangtze River Basin during the 1990s, ultimately extending nationwide. (4) The spatial distribution of beer production revealed significant regional disparities and notable industry concentration. Notably, many provinces witnessed reduced CEs from beer production starting in 2015, although the extent of reduction varied in different provinces. These findings serve as a scientific foundation for formulating emission reduction strategies in beer producing and offer insights for other food industries in China.


Assuntos
Carbono , Resíduos Sólidos , Resíduos Sólidos/análise , Carbono/análise , Cerveja/análise , Indústrias , China , Dióxido de Carbono/análise , Desenvolvimento Econômico
4.
Dis Colon Rectum ; 66(1): 148-154, 2023 01 01.
Artigo em Inglês | MEDLINE | ID: mdl-36515517

RESUMO

BACKGROUND: The effect of anterograde lavage in patients with rectal cancer who underwent anterior resection and plan to receive stoma closure is unclear. OBJECTIVE: This study aimed to investigate the effect of anterograde lavage on postoperative bowel function recovery in patients who underwent temporary loop ileostomy and stoma closure. DESIGN: This was a hospital-based retrospective cohort study. SETTINGS: This study was conducted at a tertiary referral center. PATIENTS: All consecutive patients who underwent anterior resection for rectal cancer and were planning to receive stoma closure from March through December 2019 were included. INTERVENTIONS: The enrolled patients were divided into 2 groups according to whether they received anterograde lavage before stoma closure. MAIN OUTCOME MEASURES: Short-term functional outcomes, including time to first passing of flatus, first defecation time, and recovery time to first meal, were compared between the groups. Secondary outcomes included length of hospital stay, total cost of hospitalization, and postoperative complications. RESULTS: A total of 222 eligible participants were included in the analysis, including 114 in the lavage group and 108 in the nonlavage group. No statistically significant differences were found in age, sex ratio, or distance between the anastomotic line and dentate line. In the lavage group, patients' time to first passing of flatus (38 vs 42 h; p = 0.006), first defecation time (42 vs 48 h; p < 0.001), recovery time to first meal (48 vs 55.5 h; p < 0.001), and length of hospital stay (5 vs 7 d; p < 0.001) were significantly shorter than those in the nonlavage group, and the total cost of hospitalization was significantly lower than that of the nonlavage group (25,000 vs 28,000 RMB; p < 0.001). No significant difference was found in the incidence of postoperative complications between the 2 groups (p = 0.067). LIMITATIONS: This study is limited by its relatively small sample size and retrospective design with single-center participants. CONCLUSIONS: Anterograde lavage before stoma closure is safe and noninvasive. For patients receiving anterior resection and planning to have stoma closure, this procedure can potentially help recover bowel function more rapidly. See Video Abstract at http://links.lww.com/DCR/C51. EFECTO DEL LAVADO ANTERGRADO MEDIANTE ILEOSTOMA TEMPORAL EN ASA SOBRE LA RECUPERACIN DE LA FUNCIN INTESTINAL EN PACIENTES QUE RECIBEN CIERRE DE ESTOMA UN ESTUDIO DE COHORTE RETROSPECTIVO: ANTECEDENTES:No está claro el efecto del lavado anterógrado en pacientes con cáncer de recto con resección anterior que planean recibir el cierre del estoma.OBJETIVO:Investigar el efecto del lavado anterógrado en la recuperación de la función intestinal posoperatoria en pacientes que se sometieron a ileostomía en asa temporal y cierre de estoma.DISEÑO:Estudio de cohorte retrospectivo basado en el hospital.AJUSTES:Centro de referencia terciario.PACIENTES:Todos los pacientes que se sometieron a una resección anterior por cáncer de recto y que planeaban recibir el cierre del estoma desde marzo hasta diciembre de 2019.INTERVENCIONES:Los pacientes inscritos se dividieron en dos grupos según si recibieron lavado anterógrado antes del cierre del estoma.PRINCIPALES MEDIDAS DE RESULTADO:Los resultados funcionales a corto plazo, incluido el tiempo de la primera evacuación de flatos, tiempo de la primera defecación y tiempo de recuperación hasta la primera comida, se compararon entre los grupos. Resultados secundarios incluyeron duración de la estancia hospitalaria, costo total de la hospitalización y complicaciones posoperatorias.RESULTADOS:Se incluyeron en el análisis un total de 222 participantes elegibles, incluidos 114 en el grupo de lavado y 108 en el grupo de no lavado. No hubo diferencias estadísticamente significativas en la edad, la proporción de sexos o la distancia entre la línea de anastomosis y la línea dentada. En el grupo de lavado, el tiempo de la primera evacuación de flatos de los pacientes (38 vs 42 h; p = 0,006), el tiempo de la primera defecación (42 vs 48 h; p < 0,001), el tiempo de recuperación hasta la primera comida (48 vs 55,5 h; p < 0,001) y la duración de la estancia hospitalaria (5 vs 7 días; p < 0,001) fueron significativamente más cortos que los del grupo de no lavado, y el costo total de la hospitalización fue significativamente menor que el del grupo de no lavado (25000 vs 28000 RMB; p < 0,001). No hubo diferencia significativa en la incidencia de complicaciones postoperatorias entre los dos grupos (p = 0,067).LIMITACIONES:Este estudio está limitado por su tamaño de muestra relativamente pequeño y su diseño retrospectivo con participantes de un solo centro.CONCLUSIONES:El lavado anterógrado antes del cierre del estoma es seguro y no invasivo. Para los pacientes que se someten a una resección anterior y planean cerrar el estoma, este procedimiento puede ayudar potencialmente a recuperar la función intestinal más rápidamente. Consulte Video Resumen en http://links.lww.com/DCR/C51. (Traducción-Dr. Francisco M. Abarca-Rendon).


Assuntos
Defecação , Neoplasias Retais , Humanos , Estudos Retrospectivos , Irrigação Terapêutica , Flatulência , Neoplasias Retais/cirurgia , Complicações Pós-Operatórias/epidemiologia
5.
BMC Gastroenterol ; 19(1): 70, 2019 May 09.
Artigo em Inglês | MEDLINE | ID: mdl-31072341

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.


Assuntos
Síndrome de Peutz-Jeghers/diagnóstico por imagem , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Criança , Endoscopia Gastrointestinal , Humanos , Masculino , Mutação , Síndrome de Peutz-Jeghers/cirurgia , Conduta Expectante
6.
BMC Med Genet ; 19(1): 141, 2018 08 09.
Artigo em Inglês | MEDLINE | ID: mdl-30092773

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.


Assuntos
Mutação/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Transdução de Sinais/genética , Proteína Supressora de Tumor p53/genética , Quinases Proteína-Quinases Ativadas por AMP , Adolescente , Adulto , Criança , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Fenótipo , Adulto Jovem
7.
BMC Surg ; 18(1): 24, 2018 Apr 23.
Artigo em Inglês | MEDLINE | ID: mdl-29685139

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.


Assuntos
Síndrome de Peutz-Jeghers/genética , Pólipos , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Povo Asiático , Criança , Feminino , Heterozigoto , Humanos , Intussuscepção/complicações , Mutação , Síndrome de Peutz-Jeghers/complicações
8.
BMC Med Genet ; 18(1): 130, 2017 11 15.
Artigo em Inglês | MEDLINE | ID: mdl-29141581

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.


Assuntos
Povo Asiático/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Sequência de Aminoácidos , China , Éxons , Mutação da Fase de Leitura , Mutação em Linhagem Germinativa , Humanos , Masculino , Pessoa de Meia-Idade , Neoplasias/diagnóstico , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Conformação Proteica , Fatores de Risco , Análise de Sequência de DNA
9.
Dig Dis Sci ; 62(11): 3014-3020, 2017 11.
Artigo em Inglês | MEDLINE | ID: mdl-28986664

RESUMO

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.


Assuntos
Biomarcadores Tumorais/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Deleção de Sequência , Quinases Proteína-Quinases Ativadas por AMP , Adulto , Povo Asiático/genética , Sequência de Bases , Biomarcadores Tumorais/química , Biomarcadores Tumorais/metabolismo , China , Análise Mutacional de DNA , Éxons , Feminino , Predisposição Genética para Doença , Hereditariedade , Heterozigoto , Humanos , Modelos Moleculares , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Síndrome de Peutz-Jeghers/enzimologia , Síndrome de Peutz-Jeghers/etnologia , Fenótipo , Conformação Proteica , Proteínas Serina-Treonina Quinases/química , Proteínas Serina-Treonina Quinases/metabolismo , Relação Estrutura-Atividade
11.
ACS Synth Biol ; 13(4): 1100-1104, 2024 04 19.
Artigo em Inglês | MEDLINE | ID: mdl-38587465

RESUMO

A proline-based artificial enzyme is prepared by grafting the l-proline moieties onto the surface of bovine serum albumin (BSA) protein through atom transfer radical polymerization (ATRP). The artificial enzyme, the BSA-PolyProline conjugate, prefers to catalyze the formation of unsaturated ketones rather than ß-hydroxy ketones in the reaction between acetone and aldehydes, which is difficult to achieve in free-proline catalysis. The altered reaction selectivity is ascribed to the locally concentrated l-proline moieties surrounding the BSA molecule, indicating a microenvironmental effect-induced switching of the reaction mechanism. Taking advantage of this selectivity, we used this artificial enzyme in conjunction with a natural enzyme, old yellow enzyme 1 (OYE1), to demonstrate a simple synthesis of different aliphatic ketones from acetone and aldehydes via tandem catalysis.


Assuntos
Acetona , Cetonas , Prolina , Aldeídos , Catálise , Estereoisomerismo
12.
Artigo em Inglês | MEDLINE | ID: mdl-39225224

RESUMO

Ferritin, as an iron storage protein, has the potential to inhibit ferroptosis by reducing excess intracellular free iron concentrations and lipid reactive oxygen species (ROS). An insufficient amount of ferritin is one of the conditions that can lead to ferroptosis through the Fenton reaction mediated by ferrous iron. Consequently, upregulation of ferritin at the transcriptional or posttranscriptional level may inhibit ferroptosis. In this review, we have discussed the essential role of ferritin in ferroptosis and the regulatory mechanism of ferroptosis in ferritin-deficient individuals. The description of the regulatory factors governing ferritin and its properties in regulating ferroptosis as underlying mechanisms for the pathologies of diseases will allow potential therapeutic approaches to be developed.

13.
Heliyon ; 10(12): e32799, 2024 Jun 30.
Artigo em Inglês | MEDLINE | ID: mdl-38975093

RESUMO

Background: Repetitive transcranial magnetic stimulation (rTMS) is an effective noninvasive neuromodulation technique for Parkinson's disease (PD). However, the efficacy of rTMS varies widely between individuals. This study aimed to investigate the factors related to the response to rTMS in PD patients. Methods: We retrospectively analyzed the response of 70 idiopathic PD patients who underwent rTMS for 14 consecutive days targeting the supplementary motor area (SMA) in either an open-label trail (n = 31) or a randomized, double-blind, placebo-controlled trial (RCT) (n = 39). The motor symptoms of PD patients were assessed by the United Parkinson's Disease Rating Scale Part III (UPDRSIII). Based on previous studies, the UPDRSIII were divided into six symptom clusters: axial dysfunction, resting tremor, rigidity, bradykinesia affecting right and left extremities, and postural tremor. Subsequently, the efficacy of rTMS to different motor symptom clusters and clinical predictors were analyzed in these two trails. Results: After 14 days of treatment, only the total UPDRSIII scores and rigidity scores improved in both the open-label trial and the RCT. The results of multiple linear regression analysis indicated that baseline rigidity scores (ß = 0.37, p = 0.047) and RMT (ß = 0.30, P = 0.02) positively predicted the improvement of UPDRSIII. The baseline rigidity score (ß = 0.55, P < 0.0001) was identified as an independent factor to predict the improvement of rigidity. Conclusion: This study demonstrated significant improvements in total UPDRSIII scores and rigidity after 14-day treatment, with baseline rigidity scores and RMT identified as predictors of treatment response, underscoring the need for individualized therapy.

15.
Medicine (Baltimore) ; 102(34): e34806, 2023 Aug 25.
Artigo em Inglês | MEDLINE | ID: mdl-37653767

RESUMO

BACKGROUND: Although colonoscopic retroflexion has been proved effective in reducing missed adenomas, there is still a lack of comprehensive and in-depth research focused on the ascending colon. We aimed to conduct a randomized controlled trial and tandem colonoscopy to investigate whether cecal retroflexion observed during colonoscopy can reduce missed adenomas in the ascending colon. METHODS: Men and women required to be between 45 and 80 years of age were screened for enrollment in the trial. Patients were randomly assigned according to a 1:1 ratio to either the trial group or control group. Patients in the trial group underwent 2 forward examination and a cecal retroflexion observed in the ascending colon, while patients in the control group underwent only 2 forward examinations in the ascending colon. The primary outcome was adenoma miss rate. The secondary outcomes contained adenoma detection rate, polyp miss rate, polyp detection rate, insertion time and withdrawal time. Differences between groups in the primary outcome and in the other categorical indicators were tested using chi-squared test and Fisher exact test. For the comparison of continuous outcomes, the Student t test was applied. RESULTS: A total of 60 subjects were eligible for the study between April to June 2020, of which 55 were randomized and eligible for analysis (26 to the control group and 29 to the trial group). The characteristics of patients were no significant differences statistically between the trial group and the control group. Similarly, the characteristics of the colonoscopy procedures included cecal insertion distance, the length of cecum and ascending colon, insertion time, withdrawal time, quality of bowel preparation, numerical rating scale for pain, polyps detected, and adenomas detected, and there were no significant differences statistically between the 2 groups (P = .864, P = .754, P = .700, P = .974, P = .585, P = .835, P = .373, P = .489). The characteristics of the polyps were also no significant differences statistically between the 2 groups. CONCLUSION: This pilot trial failed to show benefit of cecal retroflexion observed on adenoma missing of ascending colon during colonoscopy; however, further conclusions require a prospective study with a higher level of evidence. (NCT03355443).


Assuntos
Adenoma , Colo Ascendente , Masculino , Humanos , Feminino , Estudos Prospectivos , Projetos Piloto , Ceco , Colonoscopia , Adenoma/diagnóstico
16.
Gastroenterol Rep (Oxf) ; 11: goac082, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36632626

RESUMO

Background: Bone morphogenetic protein receptor type 1A (BMPR1A) is responsible for two individual Mendelian diseases: juvenile polyposis syndrome and hereditary mixed polyposis syndrome 2, which have overlapping phenotypes. This study aimed to elucidate whether these two syndromes are just two subtypes of a single syndrome rather than two isolated syndromes. Methods: We sequenced the BMPR1A gene in 186 patients with polyposis and colorectal cancer, and evaluated the clinicopathological features and phenotypes of the probands and their available relatives with BMPR1A mutations. Results: BMPR1A germline mutations were found in six probands and their three available relatives. The numbers of frameshift, nonsense, splice-site, and missense mutations were one, one, two, and two, respectively; two of the six mutations were novel. Typical juvenile polyps were found in only three patients. Two patients had colorectal cancer rather than any polyps. Conclusions: Diseases in BMPR1A germline mutation carriers vary from mixed polyposis to sole colorectal cancer, and typical juvenile polyps do not always occur in these carriers. The variety of phenotypes reflected the features of BMPR1A-mutation carriers, which should be recognized as a spectrum of one syndrome. Genetic testing may be a good approach to identifying BMPR1A-related syndromes.

17.
Front Genet ; 12: 821996, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-35154264

RESUMO

The exploration of DNA-binding proteins (DBPs) is an important aspect of studying biological life activities. Research on life activities requires the support of scientific research results on DBPs. The decline in many life activities is closely related to DBPs. Generally, the detection method for identifying DBPs is achieved through biochemical experiments. This method is inefficient and requires considerable manpower, material resources and time. At present, several computational approaches have been developed to detect DBPs, among which machine learning (ML) algorithm-based computational techniques have shown excellent performance. In our experiments, our method uses fewer features and simpler recognition methods than other methods and simultaneously obtains satisfactory results. First, we use six feature extraction methods to extract sequence features from the same group of DBPs. Then, this feature information is spliced together, and the data are standardized. Finally, the extreme gradient boosting (XGBoost) model is used to construct an effective predictive model. Compared with other excellent methods, our proposed method has achieved better results. The accuracy achieved by our method is 78.26% for PDB2272 and 85.48% for PDB186. The accuracy of the experimental results achieved by our strategy is similar to that of previous detection methods.

18.
Orphanet J Rare Dis ; 16(1): 261, 2021 06 08.
Artigo em Inglês | MEDLINE | ID: mdl-34103092

RESUMO

OBJECTIVE: To report Peutz-Jeghers syndrome (PJS) cases with non-definitive clues in the family or personal history and finally diagnosed through pathological examination and STK11 gene mutation test. CLINICAL PRESENTATION AND INTERVENTION: PJS was suspected in 3 families with tortuous medical courses. Two of them had relatives departed due to polyposis or colon cancer without pathological results, and the other one had been diagnosed as hyperplastic polyposis before. Diagnosis of PJS was confirmed by endoscopy and repeated pathological examinations, and the STK11 mutation test finally confirmed the diagnosis at genetic level, during which 3 novel mutation were detected (536C > A, 373_374insA, 454_455insGGAGAAGCGTTTCCCAGTGTGCC). CONCLUSION: Early diagnosis of PJS is important and may be based on a family history with selective features among family members, and the pathological information is the key. The novel mutations also expand the STK11 variant spectrum.


Assuntos
Síndrome de Peutz-Jeghers , Diagnóstico Tardio , Família , Humanos
19.
Cancer Genet ; 230: 47-57, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-30528796

RESUMO

BACKGROUND: The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. AIMS: To test the efficacy of the combination in Chinese patients with PJS. METHODS: PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. RESULTS: We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. CONCLUSION: The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance.


Assuntos
Povo Asiático/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Splicing de RNA/genética , Quinases Proteína-Quinases Ativadas por AMP , Adolescente , Adulto , Criança , Pré-Escolar , Análise Mutacional de DNA , Éxons/genética , Feminino , Estudos de Associação Genética , Humanos , Masculino , Pessoa de Meia-Idade , Síndrome de Peutz-Jeghers/complicações , Mutação Puntual , Deleção de Sequência , Adulto Jovem
20.
Medicine (Baltimore) ; 97(38): e12297, 2018 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-30235675

RESUMO

Adenoma miss rate (AMR) has been calculated in several tandem colonoscopy studies, but it costs overmuch to carry out a clinical trial.We aimed to put forward AMR by taking advantage of retrospective data, and to judge the comparability between AMRs from prospective and retrospective data.Data of the patients accepting repeated colonoscopies during January to September 2016 was retrospectively collected and analyzed. Information was recorded, including bowel preparation quality of the first colonoscopy, size, location, histology and whether missed within the first colonoscopy of each single adenoma. AMR was compared by different risk factors through χ test and multivariable logistic regression.Around 267 adenomas were detected during 309 pairs of repeated colonoscopies, of which 66 were missed during the first colonoscopies. AMRs of the lesions small in size, nonadvanced in histology, in poor bowel preparation context and located in the proximal colon, were significantly higher than the opposite ones, and old age and male were related to adenoma missing (P < .05). In multivariable logistic regression analysis, adenoma-related factors (diminutive in size, poor bowel preparation and located in ascending colon, transverse colon or sigmoid colon), and patient-related factors (older than 60 years, male and poor bowel preparation) were found to be independently associated with missing adenomas (P < .05).AMR of retrospective data is comparable to that of tandem studies. Several risk factors influence AMR dramatically, which should be paid attention to.


Assuntos
Adenoma/diagnóstico , Adenoma/patologia , Colonoscopia/estatística & dados numéricos , Erros de Diagnóstico/estatística & dados numéricos , Adulto , Fatores Etários , Idoso , Idoso de 80 Anos ou mais , Catárticos , China , Feminino , Humanos , Modelos Logísticos , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Fatores Sexuais , Centros de Atenção Terciária , Adulto Jovem
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA