Effects of biogas slurry on hydrothermal carbonization of digestate: Synergistic valorization of hydrochars and aqueous phase.

In this study, livestock manure digestate (LMD) was used as feedstock for hydrothermal carbonization (HTC) at different temperature (180-260 °C) and residence time (0-4 h). Nutrient flow and distribution during the HTC process were evaluated by comparing the effects of livestock manure biogas slurry (LBS) and ultrapure water (UW) to determine the optimal reaction conditions for the synergistic production and application of hydrochars (HC) and aqueous phases (AP). Compared with UW, the HC yields derived from LBS as solvent were increased by 27.05-38.24% under the same conditions. The C content, high heating value (HHV), and energy densification of HC obtained from LMD and UW were higher than those obtained from LMD and LBS, and the ash content was lower. While, LBS circumstance improved the porosity, N content and some trace elements e.g. Ca, Fe and Mg in HC that showed excellent fertility potential. In addition, the recovery rate of K, TOC, NH4+-N, and TN concentrations in AP were significantly higher in the LBS circumstance than in UW. The results show that the addition of UW is more favorable for fuel generation, and the HC obtained from LMD and UW at 220 °C has the potential to be used as a fuel. Whereas, the addition of LBS enhanced the potential of HC and AP for agricultural applications simultaneously. It is recommended to use HC and AP obtained from LMD and LBS at 240 °C for using as fertilizer.

Coordinate-based data analysis of the accuracy of five intraoral scanners for scanning completely dentate and partially edentulous mandibular arches.

STATEMENT OF PROBLEM: Current methods for assessing the accuracy of intraoral scanners (IOSs) that reduce errors and provide comprehensive data compared with previous methods are lacking. PURPOSE: The purpose of this in vitro study was to present a coordinate-based data analysis method to compare the accuracy of 5 IOSs for scanning completely dentate and partially edentulous casts. MATERIAL AND METHODS: Reference scans of 2 complete arch casts (completely and partially dentate) were digitized using a high-precision laboratory scanner (Ceramill Map 600). Each cast was scanned 10 times each using 5 IOSs (3Shape TRIOS 3, Planmeca Emerald, iTero Element 5D, Medit i500, and Shining Aoralscan 3). The dataset of all 10 test groups was analyzed by using a reverse engineering software program (Geomagic Wrap). Each test cast was aligned with the reference cast by 3-dimensional (3D) superimposition to determine the translation and rotation along the x-, y-, and z-axes. The dataset was analyzed using the Kruskal-Wallis and post hoc Bonferroni tests (α=.05). RESULTS: Significant differences were observed in all parameters among all scanners when scanning the same cast (P<.05). Significant differences were observed in at least 1 parameter for all scanners, except Element 5D after scanning different casts using the same scanner. Deviations in the test data generally relocated toward the mesial, buccal, and apical sides, and the casts were almost always rotated clockwise around the y-axis and counterclockwise around the z-axis. For the completely dentate cast, among all IOSs, Element 5D demonstrated the highest accuracy in most of the measured parameters, specifically in the y-axis translation (0.06[0.07] mm), z-axis translation (0.08[0.05] mm), and y-axis rotation (0.21[0.16] degree) (P<.05). For the partially edentulous cast, Element 5D displayed higher accuracy in most of the measured parameters, including the x-axis translation (0.11[0.14] mm) and z-axis rotation (0.12[0.18] degree) (P<.05). Emerald also displayed higher accuracy in most of the measured parameters, including the y-axis translation (0.05[0.08] mm) and y-axis rotation (0.14[0.12] degree) (P<.05). Element 5D exhibited no difference in the scanning accuracy between the 2 types of casts (P>.05). CONCLUSIONS: Element 5D offered a high level of accuracy and was an appropriate scanner for both situations. The method presented in this study provides a good assessment of accuracy deviations in complete arch scans using 3D coordinate-based data analysis.

PIF3 is phosphorylated by MAPK to modulate plant immunity.

Surface-localized pattern recognition receptors perceive pathogen-associated molecular patterns (PAMPs) to activate pattern-triggered immunity (PTI). Activation of mitogen-activated protein kinases (MAPKs) represents a major PTI response. Here, we report that Arabidopsis thaliana PIF3 negatively regulates plant defense gene expression and resistance to Pseudomonas syringae DC3000. PAMPs trigger phosphorylation of PIF3. Further study reveals that PIF3 interacts with and is phosphorylated by MPK3/6. By mass spectrometry and site-directed mutagenesis, we identified the corresponding phosphorylation sites which fit for SP motif. We further show that a phospho-mimicking PIF3 variant (PIF36D /pifq) conferred increased susceptibility to P. syringae DC3000 and caused lower levels of defense gene expression in plants. Together, this study reveals that PIF3 is phosphorylated by MPK3/6 and phosphorylation of the SP motif residues is required for its negative regulation on plant immunity.

Impact of Modified Thoracic Breast Approach Lumpectomy on Prognosis of Recurrence in Radical Thyroid Carcinoma Patients.

Objective: This study aimed to compare the efficacy and safety of endoscopic radical thyroidectomy (ERT) via modified breast approach (MBA) with conventional open thyroidectomy in treating thyroid carcinoma (TC). Methods: One hundred patients with TC were randomized into a research group (treated with modified thoracic breast approach lumpectomy) and a control group (treated with traditional open surgery). Clinical efficacy, adverse effects, operative time, intraoperative bleeding, postoperative drainage, and length of stay (LOS) were compared between the groups. Serum calcium and parathyroid hormone levels were measured preoperatively and on postoperative days 1 and 5. Patients were followed up for 1-year prognosis, including prognostic survival, TC recurrence rate, and factors affecting their prognosis. Results: There was no difference in total treatment efficiency between the groups, but the incidence of adverse effects, intraoperative bleeding, postoperative drainage, and LOS were lower in the research group, while the operative time was higher in the control group. Serum calcium and parathyroid hormone were insufficient in both groups on postoperative day 1 compared to preoperative levels, with higher levels in the research group. On postoperative day 5, there was no difference between the groups. TC recurrence was lower in the research group, and logistic regression analysis showed that age and surgical method were independent factors affecting prognostic recurrence in TC patients. Conclusion: Modified thoracic breast approach lumpectomy for radical TC is a safe and effective technique that can improve patients' prognosis of recurrence. It is recommended for clinical practice.

Pestalotiopsis Species Associated with Blueberry Leaf Spots and Stem Cankers in Sichuan Province of China.

Blueberry leaf spots and stem cankers caused by Pestalotiopsis spp. have become a serious threat for the production of blueberry in Sichuan Province. To characterize the etiology of the diseases connected with these fungi, samples showing leaf spot and stem canker symptoms were collected from the 12 main blueberry-growing areas of Sichuan Province from 2015 to 2020 and used for pathogen isolation. In total, 91 fungal isolates were obtained with preliminary morphological identification and 48 representative strains were selected for further pathogenicity test and molecular identification. Four species, including Pestalotiopsis clavispora (Neopestalotiopsis clavispora) (57.14%), P. trachicarpicola (28.57%), P. chamaeropis (13.19%), and P. adusta (1.10%), were identified based on conidial morphology, cultural characteristics, and phylogenetic analysis of the internal transcribed spacer region, partial sequence of the ß-tubulin gene, and the translation elongation factor 1-α. Pathogenicity tests showed that four species were pathogenic to leaves and stems of blueberry. Among them, P. clavispora (N. clavispora) was the most aggressive as the predominant species to cause both leaf spot and stem canker. P. trachicarpicola and P. chamaeropis were mainly isolated from leaves but also pathogenic to stems. P. adusta was only isolated from stems but also pathogenic to leaves. To the best of our knowledge, this is the first report of P. chamaeropis and P. adusta as pathogens causing leaf spots and stem canker on blueberry. The results provide helpful information in disease diagnosis and management of blueberry.

Identification and Genetic Characterization of Pseudomonas syringae pv. actinidiae from Kiwifruit in Sichuan, China.

Pseudomonas syringae pv. actinidiae causes kiwifruit bacterial canker and poses a major threat to the kiwifruit industry. This study aimed to investigate the genetic characteristics of the P. syringae pv. actinidiae population from kiwifruit in Sichuan, China. Sixty-seven isolates obtained from diseased plants were characterized using morphological features, multiplex-PCR, and multilocus sequence analysis (MLSA). The isolates exhibited the typical colony morphology of P. syringae pv. actinidiae. Multiplex PCR amplification identified every isolate as P. syringae pv. actinidiae biovar 3. MLSA of the three housekeeping genes gapA, gyrB, and pfk, revealed that the reference strains of the five described biovars were clearly distinguished by a combined phylogenetic tree, and all of the tested isolates clustered with the reference strains of P. syringae pv. actinidiae biovar 3. Through a phylogenetic tree constructed from a single gene, it was found that pkf gene alone could distinguish biovar 3 from the other biovars. Furthermore, all P. syringae pv. actinidiae isolates analyzed by BOX-A1R-based repetitive extragenic palindromic (BOX)-PCR and enterobacterial repetitive intergenic consensus (ERIC)-PCR clustered into four groups. The clustering results of BOX- and ERIC-PCR indicated that group III had the largest number of isolates, accounting for 56.72 and 61.19% of all 67 isolates, respectively, and the two characterization methods were similar and complementary. The results of this study revealed that the genomes of P. syringae pv. actinidiae isolates from Sichuan had rich genetic diversity but no obvious correlation was found between clustering and geographical region. This research provides novel methodologies for rapidly detecting kiwifruit bacterial canker pathogen and a molecular differentiation at genetic level of P. syringae pv. actinidiae biovar diversity in China.

Analysis of Human-Exoskeleton System Interaction for Ergonomic Design.

OBJECTIVE: Lower-limb exoskeleton systems are defined as gait training or walking-assisting devices for spinal cord injury or hemiplegic patients. Crutches, straps, and baffles are designed to protect subjects from falling. However, skin abrasions occur when the interaction forces are too large. In this study, the interaction forces between the human body and an exoskeleton system named the AIDER were measured to confirm whether the design was ergonomic. BACKGROUND: The AIDER system is a wearable lower-limb exoskeleton. It secures a subject by binding on the waist, thighs, shanks, and feet. METHOD: Eight healthy subjects participated in the study. The interaction forces of the waist strap, thigh baffles, shank baffles, and crutch handles were measured by pressure sensors. Ten repetitions were completed in this study. After one repetition, custom comfort questionnaires were completed by the subjects. RESULTS: Although a few of the peak values of the maximum intensities of pressure between the hands and crutch handles reached the minimum value of the pain-pressure threshold (PPT), the average pressure intensities were much smaller than the PPT value. CONCLUSIONS: The results indicated that the mechanical structure and control strategy of the AIDER must be improved to be more ergonomic in the future.

Roles and potential clinical implications of tissue transglutaminase in cardiovascular diseases.

Cardiovascular disease (CVD)-related mortality and morbidity are among the most critical disease burdens worldwide. CVDs encompass many diseases and involve complex pathogenesis and pathological changes. While research on these diseases has advanced significantly, treatments and their efficacy remain rather limited. New therapeutic strategies and targets must, therefore, be explored. Tissue transglutaminase (TG2) is pivotal to the pathological development of CVDs, including participating in the cross-linking of extracellular proteins, activation of fibroblasts, hypertrophy and apoptosis of cardiomyocytes, proliferation and migration of smooth muscle cells (SMCs), and inflammatory reactions. Regulating TG2 activity and expression could ensure remarkable improvements in disorders like heart failure (HF), pulmonary hypertension (PH), hypertension, and coronary atherosclerosis. In this review, we summarize recent advances in TG2: we discuss its role and mechanisms in the progression of various CVDs and its potential as a diagnostic and therapeutic target.

First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 µm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Identification of Colletotrichum Species Associated with Anthracnose Disease of Strawberry in Sichuan Province, China.

Strawberry anthracnose, caused by Colletotrichum species, is a major fungal disease threatening the strawberry industry in Sichuan Province of southwestern China. However, research on identification of Colletotrichum species associated with strawberry anthracnose in Sichuan remains scarce. In this study, 73 representative Colletotrichum strains were isolated from diseased leaves, stolons, petioles, and crowns of 11 major strawberry-planting localities in Sichuan Province. Based on morphological characteristics and multiloci phylogenetic analysis, the Colletotrichum strains were identified as three distinct species: Colletotrichum fructicola (53 strains, 72.60%), Colletotrichum siamense (17 strains, 23.29%), and Colletotrichum gloeosporioides sensu stricto (3 strains, 4.11%). Among them, C. fructicola was the most ubiquitous and dominant species, whereas C. gloeosporioides sensu stricto was restricted to Chongzhou. Importantly, our pathogenicity tests showed that C. fructicola and C. siamense can infect both leaves and stolons, whereas C. gloeosporioides sensu stricto was only pathogenic to leaves. Interestingly, although the sexual stage of C. siamense was not observed in this study, it still exhibited the strongest virulence to strawberry compared with C. gloeosporioides sensu stricto and C. fructicola. This is the first study to characterize Colletotrichum species causing strawberry anthracnose and evaluate their pathogenicity in Sichuan Province of southwestern China, which will provide a better strategy for accurate diagnosis and management of anthracnose disease in strawberry.

SUMO1 Modification Facilitates Avibirnavirus Replication by Stabilizing Polymerase VP1.

SUMOylation is a posttranslational modification that has crucial roles in diverse cellular biological pathways and in various viral life cycles. In this study, we found that the VP1 protein, the RNA-dependent RNA polymerase of avibirnavirus infectious bursal disease virus (IBDV), regulates virus replication by SUMOylation during infection. Our data demonstrated that the polymerase VP1 is efficiently modified by small ubiquitin-like modifier 1 (SUMO1) in avibirnavirus-infected cell lines. Mutation analysis showed that residues 404I and 406I within SUMO interaction motif 3 of VP1 constitute the critical site for SUMO1 modification. Protein stability assays showed that SUMO1 modification enhanced significantly the stability of polymerase VP1 by inhibiting K48-linked ubiquitination. A reverse genetic approach showed that only IBDV with I404C/T and I406C/F mutations of VP1 could be rescued successfully with decreased replication ability. Our data demonstrated that SUMO1 modification is essential to sustain the stability of polymerase VP1 during IBDV replication and provides a potential target for designing antiviral drugs targeting IBDV.IMPORTANCE SUMOylation is an extensively discussed posttranslational modification in diverse cellular biological pathways. However, there is limited understanding about SUMOylation of viral proteins of IBDV during infection. In the present study, we revealed a SUMO1 modification of VP1 protein, the RNA-dependent RNA polymerase of avibirnavirus infectious bursal disease virus (IBDV). The required site of VP1 SUMOylation comprised residues 404I and 406I of SUMO interaction motif 3, which was essential for maintaining its stability by inhibiting K48-linked ubiquitination. We also showed that IBDV with SUMOylation-deficient VP1 had decreased replication ability. These data demonstrated that the SUMOylation of IBDV VP1 played an important role in maintaining IBDV replication.

Ubiquitination Is Essential for Avibirnavirus Replication by Supporting VP1 Polymerase Activity.

Ubiquitination is critical for several cellular physical processes. However, ubiquitin modification in virus replication is poorly understood. Therefore, the present study aimed to determine the presence and effect of ubiquitination on polymerase activity of viral protein 1 (VP1) of avibirnavirus. We report that the replication of avibirnavirus is regulated by ubiquitination of its VP1 protein, the RNA-dependent RNA polymerase of infectious bursal disease virus (IBDV). In vivo detection revealed the ubiquitination of VP1 protein in IBDV-infected target organs and different cells but not in purified IBDV particles. Further analysis of ubiquitination confirms that VP1 is modified by K63-linked ubiquitin chain. Point mutation screening showed that the ubiquitination site of VP1 was at the K751 residue in the C terminus. The K751 ubiquitination is independent of VP1's interaction with VP3 and eukaryotic initiation factor 4A II. Polymerase activity assays indicated that the K751 ubiquitination at the C terminus of VP1 enhanced its polymerase activity. The K751-to-R mutation of VP1 protein did not block the rescue of IBDV but decreased the replication ability of IBDV. Our data demonstrate that the ubiquitination of VP1 is crucial to regulate its polymerase activity and IBDV replication.IMPORTANCE Avibirnavirus protein VP1, the RNA-dependent RNA polymerase, is responsible for IBDV genome replication, gene expression, and assembly. However, little is known about its chemical modification relating to its polymerase activity. In this study, we revealed the molecular mechanism of ubiquitin modification of VP1 via a K63-linked ubiquitin chain during infection. Lysine (K) residue 751 at the C terminus of VP1 is the target site for ubiquitin, and its ubiquitination is independent of VP1's interaction with VP3 and eukaryotic initiation factor 4A II. The K751 ubiquitination promotes the polymerase activity of VP1 and unubiquitinated VP1 mutant IBDV significantly impairs virus replication. We conclude that VP1 is the ubiquitin-modified protein and reveal the mechanism by which VP1 promotes avibirnavirus replication.

Generation of mWasabi fluorescent protein-binding nanobodies.

mWasabi is a bright monomeric green fluorescent protein. It can be used as a fusion tag to monitor various biological events, e.g. protein localization. Here we report the selection of camelid-derived single-domain antibody fragments (nanobodies) against mWasabi. In this work, phage-display approach was employed to select the high affinity mWasabi-specific Nb (nanobodies). These nanobodies were able to recognize mWasabi or in a fused fashion with PD1. The interesting binding characteristics of these two mWasabi-specific nanobodies could be valuable for design new tools for cellular tracing or targeting based on the mWasabi-fusing protein in many different biological research fields.

Phenotypic and Genetic Characterization of Botrytis cinerea Population from Kiwifruit in Sichuan Province, China.

Botrytis cinerea (anamorph of Botryotinia fuckeliana) causes gray mold on numerous plants, including kiwifruit. The primary aim of this study was to investigate the phenotypic and genetic characteristics of the Botrytis cinerea population from kiwifruit in Sichuan Province, China. In all, 176 isolates were collected from kiwifruit orchards from eight geographic regions in Sichuan. All isolates were identified as B. cinerea sensu stricto based on the combined datasets, including morphological criteria, determination of the Bc-hch allele, and phylogenetic analysis of the genes RPB2, G3PDH, and HSP60. Three colony types (i.e., sclerotial, mycelial, and conidial) were observed on potato dextrose agar after 2 weeks, with sclerotial isolates, the predominant category, accounting for 40.91%. No obvious differences in microscopic characteristics were observed among the three types. Three genotypes of transposable elements were identified in the B. cinerea population: boty, flipper, and transposa types. The most prevalent genotype from different geographic populations of B. cinerea was transposa; in contrast, the flipper genotype accounted for only 3.98% of the total population, whereas the vacuma genotype was absent. According to MAT locus amplification, 87 and 89 isolates are MAT1-1 and MAT1-2 type, respectively, and the two mating types were found to be balanced overall in the population. Forty-eight representative isolates were all able to cause gray mold to some extent, and disease severities were significantly different between the cultivars Hongyang and Hort16A (P < 0.01). Disease severity was significantly greater on young leaves than on mature leaves (P < 0.01). No significant relationship was found between pathogenicity and geographical region, colony type, or transposon distribution. The results obtained in the present study suggest a relatively uniform species diversity of Botrytis but rich phenotypic and genetic differentiation within the B. cinerea population on kiwifruit in China. Utilizing resistant cultivars and rain-shelter cultivation instead of fungicides may be an effective approach to delaying pathogen variability.

Cellular proteomic analysis of porcine circovirus type 2 and classical swine fever virus coinfection in porcine kidney-15 cells using isobaric tags for relative and absolute quantitation-coupled LC-MS/MS.

Viral coinfection or superinfection in host has caused public health concern and huge economic losses of farming industry. The influence of viral coinfection on cellular protein abundance is essential for viral pathogenesis. Based on a coinfection model for porcine circovirus type 2 (PCV2) and classical swine fever virus (CSFV) developed previously by our laboratory, isobaric tags for relative and absolute quantitation (iTRAQ)-coupled LC-MS/MS proteomic profiling was performed to explore the host cell responses to PCV2-CSFV coinfection. Totally, 3932 proteins were identified in three independent mass spectrometry analyses. Compared with uninfected cells, 304 proteins increased (fold change >1.2) and 198 decreased (fold change <0.833) their abundance in PCV2-infected cells (p < 0.05), 60 and 61 were more and less abundant in CSFV-infected cells, and 196 and 158 were more and less abundant, respectively in cells coinfected with PCV2 and CSFV. Representative differentially abundant proteins were validated by quantitative real-time PCR, Western blotting and confocal laser scanning microscopy. Bioinformatic analyses confirmed the dominant role of PCV2, and indicated that mitochondrial dysfunction, nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated oxidative stress response and apoptosis signaling pathways might be the specifical targets during PCV2-CSFV coinfection.

iTRAQ-based quantitative subcellular proteomic analysis of Avibirnavirus-infected cells.

Infectious bursal disease virus (IBDV) enters the host cells via endocytic pathway to achieve viral replication in the cytoplasm. Here, we performed LC-MS/MS coupled with isobaric tags for relative and absolute quantification labeling of differentially abundant proteins of IBDV-infected cells using a subcellular fractionation strategy. We show that the viral infection regulates the abundance and/or subcellular localization of 3211 proteins during early infection. In total, 23 cellular proteins in the cytoplasmic proteome and 34 in the nuclear proteome were significantly altered after virus infection. These differentially abundant proteins are involved in such biological processes as immune response, signal transduction, RNA processing, macromolecular biosynthesis, energy metabolism, virus binding, and cellular apoptosis. Moreover, transcriptional profiles of the 25 genes corresponding to the identified proteins were analyzed by quantitative real-time RT-PCR. Ingenuity Pathway Analysis clustered the differentially abundant proteins primarily into the mTOR pathway, PI3K/Akt pathway, and interferon-ß signaling cascades. Confocal microscopy showed colocalization of the viral protein VP3 with host proteins heterogeneous nuclear ribonucleoprotein H1, nuclear factor 45, apoptosis inhibitor 5, nuclear protein localization protein 4 and DEAD-box RNA helicase 42 during the virus infection. Together, these identified subcellular constituents provide important information for understanding host-IBDV interactions and underlying mechanisms of IBDV infection and pathogenesis.

[Study on the hemodynamic changes in solid thyroid nodules by ultrasound contrast quantitative analysis].

OBJECTIVE: To compare the difference between the different perfusional regions in solid thyroid nodules. METHODS: From October 2013 to May 2015, CEUS was performed in 59 patients who hospitalizated in Zhoushan Hospital with solid thyroid nodules before operation. The time-intensity curve (TIC) of normal thyroid tissue, tumor edge and tumor center was drawn to collect perfusion index like the peak intensity (PI), time to peak (TP), area under the curve (AUC), mean transit time (MTT). After surgery, immunohistochemical staining was performed to evaluate the MVD in surgical specimens.Quantitative parameters and MVD were assessed by the Spearman correlation analysis. RESULTS: There were 31 thyroid papillary carcinomas and 28 nodular goiters. In malignant tumor group, the PI of normal thyroid tissue, tumor edge and tumor center were 28% ± 6%, 21% ± 7% and 14% ± 5%, respectively, while the AUC and MVD of the same regions were (1 865 ± 1 079)%S, (1 376 ± 595)%S, (805 ± 412)%S and(33 ± 6), (27 ± 6)/HP, (17 ± 6)/HP, respectively. The differences were statistically significant. However, in benign tumor group, there was no obvious statistic difference in the quantitative parameters and MVD between the three regions. The PI values of thyroid carcinomas and nodular goiters all were positively correlated with MVD (r=0.819, r=0.838, P<0.05). CONCLUSIONS: The variance of perfusion parameters were valuable diagnostic basis in differential diagnosis between benign and malignant thyroid nodules. They were associated with MVD, which might reflect the microvessel distributional characteristics of neoplasm and might be one of bases used to evaluate neoplasm angiogenesis.

High-throughput profiling of point mutations across the HIV-1 genome.

BACKGROUND: The HIV-1 pandemic is not the result of a static pathogen but a large genetically diverse and dynamic viral population. The virus is characterized by a highly mutable genome rendering efforts to design a universal vaccine a significant challenge and drives the emergence of drug resistant variants upon antiviral pressure. Gaining a comprehensive understanding of the mutational tolerance of each HIV-1 genomic position is therefore of critical importance. RESULTS: Here we combine high-density mutagenesis with the power of next-generation sequencing to gauge the replication capacity and therefore mutational tolerability of single point mutations across the entire HIV-1 genome. We were able to achieve the evaluation of point mutational effects on viral replicative capacity for 5,553 individual HIV-1 nucleotide positions - representing 57% of the viral genome. Replicative capacity was assessed at 3,943 nucleotide positions for a single alternate base change, 1,459 nucleotide positions for two alternate base changes, and 151 nucleotide positions for all three possible alternate base changes. This resulted in the study of how a total of 7,314 individual point mutations impact HIV-1 replication on a single experimental platform. We further utilize the dataset for a focused structural analysis on a capsid inhibitor binding pocket. CONCLUSION: The approach presented here can be applied to any pathogen that can be genetically manipulated in a laboratory setting. Furthermore, the methodology can be utilized under externally applied selection conditions, such as drug or immune pressure, to identify genetic elements that contribute to drug or host interactions, and therefore mutational routes of pathogen resistance and escape.

[Pregnancy outcome in 54 patients with antiphospholipid syndrome: a retrospective clinical study].

OBJECTIVE: To summarize the maternal/fetal outcome of pregnancy in antiphospholipid syndrome (APS) patients to evaluate the influence of treatment on the outcomes of pregnancy, and to investigate the possible clinical predictors of unsuccessful pregnancy. METHODS: The clinical characteristics, laboratory profiles and the outcomes of delivery of 54 APS patients from January 2000 to March 2013 were investigated retrospectively. RESULTS: (1) Maternal/fetal outcome: 17 pregnancies (31.4%) resulted in full term delivery, 7 (12.9%) in stillbirth, 16 (29.6%) in spontaneous abortion,10 (18.5%) in premature birth due to eclampsia or severe preeclampsia or signs of placental insufficiency, 4 (7.4%)received therapeutic termination of pregnancy due to eclampsia or severe preeclampsia. In 27 live birth cases, 8 (29.6%) were fetal growth restriction, 4 (14.8%) were low birth weight infants, and 3 (11.1%) were very low birth weight infants. (2) Influence of treatment on the pregnancy outcomes and complications: 24 APS patients were given the treatment of aspirin or aspirin combined with low molecular weight heparin, and 30 patients received no treatment. Compared with the untreated group, the treated group had lower rate of fetal loss, higher rate of full-term delivery, increased gestational age and birth weight, decreased incidence of preeclampsia / eclampsia and thrombocytopenia. There was a significant difference between the two groups (P<0.05). (3)Possible risk factors of unsuccessful pregnancy: there were 17 successful pregnancies and 37 unsuccessful pregnancy. The rate of double APL positive and antibody titers ≥ three times the upper limit of normal were higher in the unsuccessful pregnancy group than the successful pregnancy group. Antibody negative rate before pregnancy proportion of patients received treatment and the level of complement 4 were lower in the unsuccessful pregnancy group. CONCLUSION: Pregnant women with APS are an extremely high risk group for adverse maternal /fetal outcome. Treatments can improve the pregnancy outcome of the APS patients. APL not turning negative before pregnancy double APL positive, antibody titers ≥ three times the upper limit of normal and complement 4 decrease may be the risk factors for pregnancy failure and treatment may be a protective factor for successful pregnancy.