Recessive resistance against beet chlorosis virus is conferred by the eukaryotic translation initiation factor (iso)4E in Beta vulgaris.

Eukaryotic translation initiation factors (eIFs) are important for mRNA translation but also pivotal for plant-virus interaction. Most of these plant-virus interactions were found between plant eIFs and the viral protein genome-linked (VPg) of potyviruses. In case of lost interaction due to mutation or deletion of eIFs, the viral translation and subsequent replication within its host is negatively affected, resulting in a recessive resistance. Here we report the identification of the Beta vulgaris Bv-eIF(iso)4E as a susceptibility factor towards the VPg-carrying beet chlorosis virus (genus Polerovirus). Using yeast two-hybrid and bimolecular fluorescence complementation assays, the physical interaction between Bv-eIF(iso)4E and the putative BChV-VPg was detected, while the VPg of the closely related beet mild yellowing virus (BMYV) was found to interact with the two isoforms Bv-eIF4E and Bv-eIF(iso)4E. These VPg-eIF interactions within the polerovirus-beet pathosystem were demonstrated to be highly specific, as single mutations within the predicted cap-binding pocket of Bv-eIF(iso)4E resulted in a loss of interaction. To investigate the suitability of eIFs as a resistance resource against beet infecting poleroviruses, B. vulgaris plants were genome edited by CRISPR/Cas9 resulting in knockouts of different eIFs. A simultaneous knockout of the identified BMYV-interaction partners Bv-eIF4E and Bv-eIF(iso)4E was not achieved, but Bv-eIF(iso)4EKO plants showed a significantly lowered BChV accumulation and decrease in infection rate from 100% to 28.86%, while no influence on BMYV accumulation was observed. Still, these observations support that eIFs are promising candidate genes for polerovirus resistance breeding in sugar beet.

Virome Characterization of Native Wild-Rice Plants Discovers a Novel Pathogenic Rice Polerovirus With World-Wide Circulation.

Pandemics originating from zoonotic viruses have posed significant threats to human health and agriculture. Recent discoveries have revealed that wild-rice plants also harbour viral pathogens capable of severely impacting rice production, a cornerstone food crop. In this study, we conducted virome analysis on ~1000 wild-rice individual colonies and discovered a novel single-strand positive-sense RNA virus prevalent in these plants. Through comprehensive genomic characterization and comparative sequence analysis, this virus was classified as a new species in the genus Polerovirus, designated Rice less tiller virus (RLTV). Our investigations elucidated that RLTV could be transmitted from wild rice to cultivated rice via a specific insect vector, the aphid Rhopalosiphum padi, causing less tiller disease symptoms in rice plants. We generated an infectious cDNA clone for RLTV and demonstrated systemic infection of rice cultivars and induction of severe disease symptoms following mechanical inoculation or stable genetic transformation. We further illustrated transmission of RLTV from stable transgenic lines to healthy rice plants by the aphid vector, leading to the development of disease symptoms. Notably, our database searches showed that RLTV and another polerovirus isolated from a wild plant species are widely circulating not only in wild rice but also cultivated rice around the world. Our findings provide strong evidence for a wild plant origin for rice viruses and underscore the imminent threat posed by aphid-transmitted rice Polerovirus to rice cultivar.

Characterization of the proteins encoded by a recently emerged cotton-infecting Polerovirus.

The cotton leafroll dwarf virus (CLDV), an important viral pathogen responsible for substantial losses in cotton crops, has recently emerged in the United States (US). Although CLDV shares similarities with other members of the genus Polerovirus in terms of encoded proteins, their functional characteristics remain largely unexplored. In this study, we expressed and analyzed each protein encoded by CLDV to determine its intracellular localization using fluorescence protein fusion. We also evaluated their potential to induce plant responses, such as the induction of hypersensitive response-like necrosis and the generation of reactive oxygen species. Our findings show that the proteins encoded by CLDV exhibit comparable localization patterns and elicit similar robust plant responses as observed with cognate proteins from other viruses within the genus Polerovirus. This study contributes to our understanding of the functional repertoire of genes carried by Polerovirus members, particularly to CLDV that has recently emerged as a widespread viral pathogen infecting cotton in the US.

Genetic Variability Among U.S.-Sentinel Cotton Plot Cotton Leafroll Dwarf Virus and Globally Available Reference Isolates Based on ORF0 Diversity.

The aphid-transmitted polerovirus, cotton leafroll dwarf virus (CLRDV), first characterized from symptomatic cotton plants in South America, has been identified in commercial cotton plantings in the United States. Here, the CLRDV intraspecific diversity was investigated by comparative sequence analysis of the most divergent CLRDV coding region, ORF0/P0. Bayesian analysis of ORF0 sequences for U.S. and reference populations resolved three well-supported sister clades comprising one U.S. and two South American lineages. Principal component analysis (PCA) identified seven statistically supported intraspecific populations. The Bayesian phylogeny and PCA dendrogram-inferred relationships were congruent. Population analysis of ORF0 sequences indicated most lineages have evolved under negative selection, albeit certain sites/isolates evolved under positive selection. Both U.S. and South American isolates exhibited extensive ORF0 diversity. At least two U.S. invasion foci were associated with their founder populations in Alabama-Georgia and eastern Texas. The Alabama-Georgia founder is implicated as the source of recent widespread expansion and establishment of secondary disease foci throughout the southeastern-central United States. Based on the geographically restricted distribution, spread of another extant Texas population appeared impeded by a population bottleneck. Extant CLRDV isolates represent several putative introductions potentially associated with catastrophic weather events dispersing viruliferous cotton aphids of unknown origin(s).

Genetic Variation of Turnip Yellows Virus in Arable and Vegetable Brassica Crops, Perennial Wild Brassicas, and Aphid Vectors Collected from the Plants.

Turnip yellows virus (TuYV; Polerovirus, Solemoviridae) infects and causes yield losses in a range of economically important crop species, particularly the Brassicaceae. It is persistently transmitted by several aphid species and is difficult to control. Although the incidence and genetic diversity of TuYV has been extensively investigated in recent years, little is known about how the diversity within host plants relates to that in its vectors. Arable oilseed rape (Brassica napus) and vegetable brassica plants (Brassica oleracea), wild cabbage (B. oleracea), and aphids present on these plants were sampled in the field in three regions of the United Kingdom. High levels of TuYV (82 to 97%) were detected in plants in all three regions following enzyme-linked immunosorbent assays. TuYV was detected by reverse transcription polymerase chain reaction in Brevicoryne brassicae aphids collected from plants, and TuYV sequences were obtained. Two TuYV open reading frames, ORF0 and ORF3, were partially sequenced from 15 plants, and from one aphid collected from each plant. Comparative analyses between TuYV sequences from host plants and B. brassicae collected from respective plants revealed differences between some ORF0 sequences, which possibly indicated that at least two of the aphids might not have been carrying the same TuYV isolates as those present in their host plants. Maximum likelihood phylogenetic analyses including published, the new TuYV sequences described above, 101 previously unpublished sequences of TuYV from oilseed rape in the United Kingdom, and 13 also previously unpublished sequences of TuYV from oilseed rape in Europe and China revealed three distinct major clades for ORF0 and one for ORF3, with some distinct subclades. Some clustering was related to geographic origin. Explanations for TuYV sequence differences between plants and the aphids present on respective plants and implications for the epidemiology and control of TuYV are discussed.

The first report of cotton leafroll dwarf virus infecting upland cotton plants in Arizona.

Cotton leafroll dwarf virus (CLRDV) represents a persistent threat to cotton production in the United States (U.S.) (Edula et al. 2023). Initially detected in Alabama (Avelar et al. 2019), CLRDV occurs in almost all the states in the U.S. cotton belt, extending from Virginia through Texas. The symptoms associated with CLRDV includes interveinal chlorosis, leaf rolling, stunting, and reduced boll sets. However, asymptomatic CLRDV-infected plants have also been reported (Edula et al. 2023). In the 2023 growing season, upland cotton plants (Gossypium hirsutum) presenting terminal splitting symptoms in the blooming stage were observed in a commercial field in Pinal County, Arizona, at 60% incidence. To evaluate if CLRDV may be associated with these symptoms, young fully expanded terminal leaves were collected from 20 symptomatic and ten asymptomatic plants. Moreover, ten samples were collected from a second asymptomatic block in the same field. Samples were shipped on dry ice to Cornell University in hermetic bags under APHIS PPQ permit 526-23-256-14384. Midribs and petioles were used to extract total nucleic acids from each sample using OPS Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics) per the manufacturer's instructions. Complementary DNA (cDNA) was synthesized using an iScript Reverse transcriptase kit (BioRad) and used for the detection of a partial sequence of the coat protein (CP) of CLRDV using PCR assays as described previously (Mahas et al. 2022). The expected 309-bp product was obtained from only one symptomatic sample. CLRDV presence in the samples was further evaluated using CLRDV-specific primers targeting the RNA-dependent RNA polymerase (RdRp) gene. Primers CLRDV-Pol_innerF1 (5'- ACCCTCCAAGGAACAGAG -3') / R1 (5'- CGAATAATCTGATYGGGTCAC -3') and CLRDV-Pol_outerF1 (5'- AACGCGCCCAGTCCGCACAAATACC-3') / R1 (5'-ACCGGGTTTACTGGGGATTGCACGC-3'), designed based on virus isolates available in GenBank as of September 2022, were used to implement a single-tube nested RT-PCR as detailed by Dey et al. (2012) and to index the presence of CLRDV in all the samples. Two additional symptomatic samples and three asymptomatic samples (two from field one and one from field two) were positive for the virus. Direct Sanger sequencing of the one CP and two RdRp amplicons from symptomatic and asymptomatic samples (PP482918-20) demonstrated they shared >99% nucleotide identity to an isolate from South Carolina (OQ300129). To further evaluate the presence of CLRDV in Arizona, we performed double antibody sandwich (DAS)-ELISA on midrib and petiole samples using camelid single-chain antibodies against the CP as the capture antibody (Filed Patent 18/436,287) and the commercially available Anti-PLRV conjugate (Agdia, Elkhart, IN) as the secondary antibody. DAS-ELISA detected CLRDV in eight symptomatic and three asymptomatic samples, with the positive and negative controls testing positive and negative, respectively. Considering all the diagnostic approaches, ten symptomatic and five asymptomatic samples were positive for CLRDV (Table S1). To the best of our knowledge, this is the first report of CLRDV in Arizona. Future studies are required to evaluate the possible incidence and impact on the crop yield in the state and develop a reliable diagnostic assay to detect the virus in all infected samples. Since our study did not associate CLRDV with the terminal abortion or splitting symptoms, ongoing efforts are underway to elucidate if other viruses may be associated with the symptoms.

An Aphid-Transmitted Virus Reduces the Host Plant Response to Its Vector to Promote Its Transmission.

The success of virus transmission by vectors relies on intricate trophic interactions between three partners, the host plant, the virus, and the vector. Despite numerous studies that showed the capacity of plant viruses to manipulate their host plant to their benefit, and potentially of their transmission, the molecular mechanisms sustaining this phenomenon has not yet been extensively analyzed at the molecular level. In this study, we focused on the deregulations induced in Arabidopsis thaliana by an aphid vector that were alleviated when the plants were infected with turnip yellows virus (TuYV), a polerovirus strictly transmitted by aphids in a circulative and nonpropagative mode. By setting up an experimental design mimicking the natural conditions of virus transmission, we analyzed the deregulations in plants infected with TuYV and infested with aphids by a dual transcriptomic and metabolomic approach. We observed that the virus infection alleviated most of the gene deregulations induced by the aphids in a noninfected plant at both time points analyzed (6 and 72 h) with a more pronounced effect at the later time point of infestation. The metabolic composition of the infected and infested plants was altered in a way that could be beneficial for the vector and the virus transmission. Importantly, these substantial modifications observed in infected and infested plants correlated with a higher TuYV transmission efficiency. This study revealed the capacity of TuYV to alter the plant nutritive content and the defense reaction against the aphid vector to promote the viral transmission.

First Report of Cucurbit aphid-borne yellows virus infecting five cucurbits in India.

Cucurbits are among the most popular vegetables cultivated globally. They have high economic importance, especially in India, where they are cooked and eaten as vegetables (Dhillon et al. 2016). In February 2023, yellowing symptoms were observed on cucurbitaceous species, viz. Trichosanthes cucumerina (Snake gourd - SG), Luffa acutangula (Ridge gourd - RG), Lagenaria siceraria (Bottle gourd - BG), Luffa aegyptiaca (Sponge gourd - SPG) and yellow chlorotic spots were recorded on Benincasa hispida (Ash gourd - AG) growing in the experimental farm at the Indian Agricultural Research Institute, Regional Station, Pune (Supplementary Figure 1). The average disease incidence ranged from 5% to 30%. A total of 175 leaf samples, including thirty symptomatic and five asymptomatic plants of each cucurbit, were collected and tested by DAS-ELISA using antisera against cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), and papaya ringspot virus (PRSV) (Agdia, USA). All 150 symptomatic cucurbit samples tested positive for CABYV, while five samples from SG, 14 from RG, two from AG, and 11 from SPG hosts were also positive for PRSV. Asymptomatic samples were negative for all viruses tested. In order to further confirm the presence of the virus, total RNA was extracted from ten samples of each cucurbit host that were positive only for CABYV and the asymptomatic samples using the RNeasy Plant Mini Kit (Qiagen, Germany) as per the manufacturer's protocol. Two-step RT-PCR was carried out using the extracted RNA and CABYV-specific primers, amplifying c. 484 bp of the coat protein gene region (Boubourakas et al. 2006). Amplicons of expected size were obtained in all symptomatic samples, whereas the asymptomatic samples tested negative. Three amplicons obtained from positive samples from each of the cucurbit species were directly sequenced and found to be identical to each other. A representative virus sequence obtained from each cucurbit was deposited in GenBank (Snake gourd - OQ921128, Ridge gourd - OQ921127, Bottle gourd - OQ921126, Ash gourd - OQ921125, Sponge gourd - OQ921129). In BLASTn analysis, the isolates shared from 94.23 to 100% nucleotide identities with the Indian CABYV isolates of various cucurbits and clustered closely with other Pune isolates in the phylogenetic analysis (Supplementary Figure 2). CABYV (genus Polerovirus) is a single-stranded positive-sense RNA virus, and is known to infect and cause severe economic losses in cucurbits worldwide. Previously, occurrences of CABYV have been reported in cucurbits such as watermelon, bitter gourd, cucumber, squash, teasel gourd, and muskmelon in India (Nagendran et al. 2022; Tripathi et al. 2023). It has also been reported to infect a weed species - Abelmoschus moschatus from the same geographical region (Verma et al. 2023). To our knowledge, this is the first report of the natural occurrence of CABYV in snake gourd and ridge gourd worldwide and bottle gourd, ash gourd and sponge gourd in India. The present findings have significant epidemiological importance, as they demonstrate that CABYV is spreading to other cucurbits and occurring widely in India.

Analysis of Cotton Leafroll Dwarf Virus P0 Gene Sequences from South Carolina Reveals Low Variability Among Isolates.

Cotton leafroll dwarf virus (CLRDV) is emerging across the major cotton-producing states of the southern United States. Because it was detected in nearly all cotton-producing states within a few years of its initial detection in the United States, the spread of the virus has apparently occurred rapidly. In this study spanning three growing seasons in South Carolina, we collected CLRDV isolates from symptomatic and asymptomatic cotton plants in 10 counties. The genomic region encoding P0, the viral suppressor of RNA silencing, was sequenced and compared among CLRDV isolates. Low variability among CLRDV P0 sequences from South Carolina isolates with similarities to other United States isolates was revealed by amino acid sequence alignment and phylogenetic analysis. Low variability among South Carolina isolates was also confirmed by sequencing a subset of eight near-complete genomes of CLRDV isolates. Although sequence variability was low among South Carolina isolates, this data should be taken in the context of all United States isolates, for which diversity may be higher than initially expected. Sequences gathered in this study add to the body of knowledge on CLRDV diversity in the United States.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

First report of beet western yellows virus in radish in Korea.

Radish (Raphanus sativus L.) is an important root vegetable widely consumed in kimchi in Korea. In October 2021, radish leaves with virus-like symptoms of mosaic and yellowing were collected in three fields around Naju, Korea (Fig. S1). A pooled sample (n = 24) was screened for causal viruses by high-throughput sequencing (HTS), with detection confirmed by reverse transcription (RT) PCR. Total RNA was extracted from symptomatic leaves using the Plant RNA Prep kit (Biocube System, Korea), and a cDNA library was constructed and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo transcriptome assembly yielded 63,708 contigs, which were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches. Two large contigs were clearly of viral origin. BLASTn analysis showed that a 9,842-bp contig (4,481,600 mapped reads, mean read coverage 68,758.6×) had 99% identity (99% coverage) with isolate CCLB of turnip mosaic virus (TuMV) from radish in China (KR153038). A second contig of 5,711 bp (7,185 mapped reads, mean read coverage 189.9×) had 97% identity (99% coverage) with isolate SDJN16 of beet western yellows virus (BWYV) from Capsicum annuum in China (MK307779). To confirm the presence of these viruses, total RNA extracted from 24 leaf samples was subjected to RT-PCR using primers specific for TuMV (N60_5'-ACATTGAAAAGCGTAACCA-3' and C30_5'-TCCCATAAGCGAGAATACTAACGA-3', amplicon 356 bp) and BWYV (95F_5'-CGAATCTTGAACACAGCAGAG-3' and 784R_5'-TGTGGG ATCTTGAAGGATAGG-3', amplicon 690 bp) for virus detection. Of the 24 samples, 22 were positive for TuMV and 7 were co-infected with BWYV. Single infection of BWYV was not detected. Infection with TuMV, the predominant virus in radish in Korea, was previously reported (Choi and Choi, 1992; Chung et al., 2015). To determine the complete genomic sequence of the BWYV isolate (BWYV-NJ22) from radish, RT-PCR was conducted using eight overlapping primer pairs designed according to the alignment of previously reported BWYV sequences (Table S2). Terminal sequences of the viral genome were analyzed by 5' and 3' rapid amplification of cDNA ends (RACE; Thermo Fisher Scientific Corp.). The assembled complete genome sequence of BWYV-NJ22 was 5,694 nt long and was deposited in GenBank (accession no. OQ625515). The Sanger sequences shared 96% nt identity with the HTS-derived sequence. BLASTn analysis showed that BWYV-NJ22 had high nucleotide identity (98%) at the complete genome level with a BWYV isolate (OL449448) from C. annuum in Korea. BWYV (genus Polerovirus, family Solemoviridae), is an aphid-borne virus with a host range that includes > 150 plant species and is one of the most important viruses causing yellowing and stunting of vegetable crops (Brunt et al., 1996; Duffus 1973). In Korea, BWYV was first reported to infect paprika, followed by pepper, motherwort, and figwort (Jeon et al., 2021; Kwon et al., 2016; 2018; Park et al., 2018). During fall and winter 2021, 675 radish plants with virus-like symptoms of mosaic, yellowing, and chlorosis were collected from 129 farms in major cultivation areas in Korea and analyzed by RT-PCR using the BWYV detection primers. The incidence of BWYV in radish plants was 4.7%, and all infections were mixed infections with TuMV. To our knowledge, this is the first report of BWYV infecting radish in Korea. The symptoms of single BWYV infection are unclear, as radish is a new host plant of BWYV in Korea. Further research on the pathogenicity and impact of this virus in radish is therefore needed.

Advances in Understanding the Mechanism of Cap-Independent Cucurbit Aphid-Borne Yellows Virus Protein Synthesis.

Non-canonical translation mechanisms have been described for many viral RNAs. In the case of several plant viruses, their protein synthesis is controlled by RNA elements in their genomic 3'-ends that are able to enhance cap-independent translation (3'-CITE). The proposed general mechanism of 3'-CITEs includes their binding to eukaryotic translation initiation factors (eIFs) that reach the 5'-end and AUG start codon through 5'-3'-UTR-interactions. It was previously shown that cucurbit aphid-borne yellows virus (CABYV) has a 3'-CITE, which varies in sequence and structure depending on the phylogenetic group to which the isolate belongs, possibly as a result of adaptation to the different geographical regions. In this work, the cap-independent translation mechanisms of two CABYV 3'-CITEs belonging to the Mediterranean (CMTE) and Asian (CXTE) groups, respectively, were studied. In vivo cap-independent translation assays show that these 3'-CITEs require the presence of the CABYV short genomic 5'-UTR with at least 40% adenines in cis and an accessible 5'-end for its activity. Additionally, they suggest that the eIF4E-independent CABYV 3'-CITE activities may not require either eIF4A or the eIF4F complex, but may depend on eIF4G and PABP. By pulling down host proteins using RNA baits containing both 5'- and 3'-CABYV-UTRs, 80 RNA binding proteins were identified. These interacted preferentially with either CMTE, CXTE, or both. One of these proteins, specifically interacting with the RNA containing CMTE, was HSP70.2. Preliminary results suggested that HSP70.2 may be involved in CMTE- but not CXTE-mediated cap-independent translation activity.

Crystal structure of the potato leafroll virus coat protein and implications for viral assembly.

Luteoviruses, poleroviruses, and enamoviruses are insect-transmitted, agricultural pathogens that infect a wide array of plants, including staple food crops. Previous cryo-electron microscopy studies of virus-like particles show that luteovirid viral capsids are built from a structural coat protein that organizes with T = 3 icosahedral symmetry. Here, we present the crystal structure of a truncated version of the coat protein monomer from potato leafroll virus at 1.80-Å resolution. In the crystal lattice, monomers pack into flat sheets that preserve the two-fold and three-fold axes of icosahedral symmetry and show minimal structural deviations when compared to the full-length subunits of the assembled virus-like particle. These observations have important implications in viral assembly and maturation and suggest that the CP N-terminus and its interactions with RNA play an important role in generating capsid curvature.

Differential gene expression in aphids following virus acquisition from plants or from an artificial medium.

BACKGROUND: Poleroviruses, such as turnip yellows virus (TuYV), are plant viruses strictly transmitted by aphids in a persistent and circulative manner. Acquisition of either virus particles or plant material altered by virus infection is expected to induce gene expression deregulation in aphids which may ultimately alter their behavior. RESULTS: By conducting an RNA-Seq analysis on viruliferous aphids fed either on TuYV-infected plants or on an artificial medium containing purified virus particles, we identified several hundreds of genes deregulated in Myzus persicae, despite non-replication of the virus in the vector. Only a few genes linked to receptor activities and/or vesicular transport were common between the two modes of acquisition with, however, a low level of deregulation. Behavioral studies on aphids after virus acquisition showed that M. persicae locomotion behavior was affected by feeding on TuYV-infected plants, but not by feeding on the artificial medium containing the purified virus particles. Consistent with this, genes potentially involved in aphid behavior were deregulated in aphids fed on infected plants, but not on the artificial medium. CONCLUSIONS: These data show that TuYV particles acquisition alone is associated with a moderate deregulation of a few genes, while higher gene deregulation is associated with aphid ingestion of phloem from TuYV-infected plants. Our data are also in favor of a major role of infected plant components on aphid behavior.

Exploration of plant transcriptomes reveals five putative novel poleroviruses and an enamovirus.

Transcriptome datasets available in public domain serve as valuable resource for identification and characterization of novel viral genomes. Poleroviruses are economically important plant-infecting RNA viruses belonging to the family Solemoviridae. In the present study, we explored the plant transcriptomes available in public domain and identified five putative novel poleroviruses tentatively named as Foeniculum vulgare polerovirus (FvPV), Kalanchoe marnieriana polerovirus (KmPV), Paspalum notatum polerovirus (PnPV), Piper methysticum polerovirus (PmPV), Trachyspermum ammi polerovirus (TaPV) and a novel enamovirus named as Celmisia lyallii enamovirus (ClEV) in Foeniculum vulgare, Kalanchoe marnieriana, Paspalum notatum, Piper methysticum, Trachyspermum ammi and Celmisia lyallii, respectively. Coding-complete genomes (5.56-5.74 kb) of CIEV, KmPV, PnPV, PmPV and TaPV were recovered while only the partial genome of FvPV could be recovered. The genome organization of identified viruses except ClEV is 5'-ORF0-ORF1-ORF2-ORF3a-ORF3-ORF4-ORF5-3' while that of ClEV is 5'-ORF0-ORF1-ORF2-ORF3-ORF5-3'. Phylogenetic analysis revealed that poleroviruses of apiaceous plants formed a monophyletic clade within the genus Polerovirus.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milosevic et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

A Previously Undescribed Polerovirus (Solemoviridae) Infecting Theobroma cacao Germplasm.

Cacao Theobroma cacao L. (Malvaceae) is an economically important crop cultivated in tropical climates for the bean from which chocolate and other products are made (Zarrillo et al., 2018). Virus-like symptoms consisting of discoloration, leaf distortion with downward rolling of leaves, and yellow speckling or mottling (Fig. S1), were observed in imported cacao germplasm at the USDA-ARS-SHRS cacao quarantine facilities in the fall of 2020. Total RNA was isolated from leaves collected from four symptomatic plants using silica RNA extraction method (Rott and Jelkmann, 2001). Ribosomal RNA (rRNA)-depleted RNA samples were used for cDNA library construction, followed by high throughput sequencing on Illumina® NovaSeq 6000 platform (Novogene Corp., Sacramento, CA). Quality-filtered, 150-bp paired-ended reads (2,601,293-3,104,474) were assembled de novo using SPAdes v.3.14.1 (Nurk et al., 2013). The contigs (200,799 to 276,851) were queried against the NCBI virus reference sequence (RefSeq) database using the discontiguous megablast algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi?). The resultant contigs (n=1,344) were 150-nt to 1463-nt in length (k-mer coverage from 6.3x to 26,721.7x) and shared their highest nucleotide (nt) identity with potato leafroll virus (PLRV; NC_001747; genus Polerovirus; family Solemoviridae), at 69.1%-72.8%. The contigs pooled from the four samples were assembled into 15 scaffolds. BLASTn analyses of the 15 scaffolds against the RefSeq database indicated the best matches were to thirteen other polerovirus species, with top hits to cereal yellow dwarf virus-RPV (D10206) and pepper vein yellows virus (LC528383), having similarity scores of 66.2% and 100% respectively. The 15 scaffolds matched to the 5' terminal end, ORF1-2, ORF3, ORF4 and ORF3-5 of the different polerovirus genomes. For confirmatory sequencing, total RNA was subjected to reverse transcription using SuperScript IV (Invitrogen, Carlsbad, CA), followed by RT-PCR amplification with general polerovirus primers PoconF/PoconcpR (Xiang et al., 2008) expected to yield an amplicon of ~1,400-bp located at the 3' end of the RNA-dependent, RNA polymerase (RdRp), including the complete coat protein (CP) and movement protein (MP) genes. Amplicons were ligated to pGEM-T Easy vector (Promega, Madison, WI) and sequenced bi-directionally by Sanger sequencing (Eton Bio, Research Triangle Park, NC). BLASTn analysis of the polerovirus-like nt sequences (GenBank accession nos. (ON745771-ON745774) indicated the closest relatives were potato leafroll virus (OK058524) and cucumber aphid-borne yellows virus (FJ460218), at 71% and 73%, respectively. The CP amino acid (aa) sequence shared the greatest similarity to cereal yellow dwarf virus RPV (NP_840023), at 53%, and the MP aa sequence shared the greatest aa similarity to wheat yellow leaf dwarf virus-GPV (YP_003029842), at 38%. These results provide robust support for the association of a previously undescribed polerovirus with symptomatic cacao trees, herein named, cacao leafroll virus (Solemoviridae; Polerovirus). Although Koch's postulates have not been completed to confirm causality, the presence of this virus in cacao germplasm undermine efforts to distribute pathogen-free germplasm and may pose a risk to cacao production in trees established from virus-infected plant material. To our knowledge, this is the first report of a polerovirus infecting cacao trees. All trees of these accessions at the quarantined facility in Miami, FL have been destroyed.

First Report of Cotton Leafroll Dwarf Virus Infecting Hibiscus syriacus in South Korea.

Three cotton leafroll dwarf virus (CLRDV; genus Polerovirus, family Solemoviridae) genotypes have recently been identified (Tabassum et al., 2021; Ramos-Sobrinho et al., 2021). This virus is widespread in the United States (Thiessen et al., 2020; Aboughanem-Sabanadzovic et al., 2019; Tabassum et al., 2020) and has also been reported to infect chickpea (Cicer arietinum) in Uzbekistan (Kumari et al., 2020). As well, CLRDV was detected from 23 weed species (16 families), including Hibiscus sabdariffa (Sedhain et al., 2021, Hagan et al., 2019). From June to September 2019, virus-like symptoms, including mild leaf stunting, crinkling, and deformation, were observed in multiple plants (n=14) in several provinces of South Korea (e-Xtra Table. 1). To characterize the associated viruses, pooled leaf tissues from all 14 samples were used for total RNA isolation, followed by paired-end high-throughput sequencing (HTS) on the Illumina NovaSeq 6000 platform (Macrogen, South Korea). A total of 614,424,952 trimmed and high-quality reads were assembled into 506,024 contigs using Trinity de novo transcriptome assembly. The resulting contigs were compared with viral sequences in the GenBank database using BLASTx analysis. Several viral contigs were identified, including cucumber mosaic virus, apple stem pitting virus, apple stem grooving virus, cherry virus A, and CLRDV. The CLRDV contig of 5,800 nucleotides (nt) with an average coverage of 307x shared 92.1% identity (query coverage: 99%) with the CLRDV isolate CN-S5 (KX588248). To confirm CLRDV infection and to obtain its complete genome sequence, total RNA was extracted from each of the 14 samples and used for reverse transcription (RT)-PCR with six overlapping sets of primers designed from the HTS contig (e-Xtra Table. 2). The expected product sizes were obtained only for the Hibiscus syriacus L. (family: Malvaceae) sample showing foliar mild vein clearing symptoms on the leaves (e-Xtra Fig.1). All RT-PCR products were cloned using the RBC TA Cloning vector (Taipei, Taiwan) and at least five positive clones per cloned DNA fragment were sequenced. The 5 and 3 termini sequences were determined as described previously (Zhao et al. 2016). The complete genome of CLRDV isolate SK (OK073299) was determined to be 5,862 nt and it shared 89-91% complete genome identity with 12 other CLRDV isolates based on pairwise comparisons (e-Xtra Table. 3). Maximum likelihood phylogenetic analysis based on the complete genome and P3-CP aa sequences showed that CLRDV-SK is more closely related CN-S5 (e-Xtra Fig. 2). In the fall of 2021, additional H. syriacus samples (n=18) with mild chlorosis, blistering and crinkling symptoms were collected from 2 provinces of South Korea and tested by RT-PCR using the primers: CLRDV-SK-101-120 For & CLRDV-SK-1021-1040 Rev targeting a region of the ORF0. Two of 18 samples (11.1%) tested positive for CLRDV. The 16 negative samples only showed symptoms of mild yellowing. The RT-PCR products were cloned and sequenced. In pairwise comparisons, the obtained sequences (OM339522-23) were 95.85% and 96.06% identical to the corresponding sequences of CLRDV isolate SK. This is the first report of CLRDV occurrence in H. syriacus in South Korea to the best of our knowledge. Our findings will assist further studies on the epidemiology and sustainable management of diseases caused by CLRDV. Acknowledgments This work was supported by IPET (Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries; Project No. AGC1762111), Ministry of Agriculture, Food and Rural Affairs, Republic of Korea. References Tabassum, A., et al., 2021. PloS One. 16: e0252523 Ramos-Sobrinho, R., et al., 2021. Viruses. 13:2230 Thiessen, L.D., et al. 2020. Plant Dis. 104:3275 Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis. 103:1798 Tabassum, A., et al. 2020. Microbiol. Res. Announce. 9:e00812-20 Kumari, S.G., et al. 2021. Plant Dis. 104:2532 Sedhain, N.P., et al. 2021. Crop protection 144:105604 Hagan, A., er al. 2019. Alabama Cooperative Extension System. ANR:2539 Zhao, F., et al. 2016. Arch. Virol. 161:2047 Conflict of interest The authors declare that they have no conflict of interest.

First report of maize yellow mosaic virus (MaYMV) naturally infecting wheat in China.

Maize yellow mosaic virus (MaYMV), a new species in the genus Polerovirus (family Solemoviridae), was reported in maize for the first time in China in 2016 (Chen et al., 2016). Later, MaYMV was found in other gramineous species including sugarcane (Saccharum spp.), itch grass (Rottboellia cochinchinensis), millet (Panicum miliaceum) and sorghum (Sorghum bicolor) in several countries in Asia, Africa, and South America (Yahaya et al. 2017; Lim et al. 2018; Sun et al. 2019; Nithya et al. 2021). Here, we report its presence in cultivated wheat (Triticum aestivum), detected using high-throughput sequencing (HTS). In 2021 in Henan Province, China, wheat plants with virus-like symptoms such as yellowing, stunting, and vein clearing were collected from fields in Luoyang (three plants, cv. Luohan 6), Nanyang (two plants, cv. Xinong 979), and Anyang (one plant, cv. Bainong 207). RNA was extracted from symptomatic leaves of each plant sample using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). From each sample, 1 µg of RNA was mixed into a single pool to construct an rRNA-depleted RNA-seq library using a TruSeq RNA Sample Prep Kit for sequencing on the HiSeq X-Ten platform as 150-bp paired-end reads. A total of 88,892,804 clean reads were obtained after removing adaptor sequences and low-quality reads. Reads were mapped against the wheat genome database (IWGSC RefSeq v2.1) using the hisat2 v2.0.5 program. Remaining sequences were de novo assembled into contigs with Trinity program. Contigs from barley yellow dwarf virus PAV (BYDV-PAV), and BYDV-GAV were identified using a Blast search of the NCBI nr/nt database, all previously reported in wheat in China. Interestingly, four contigs with high similarity (>95%, at the nucleotide level) to MaYMV were also identified. Using the sequence of MaYMV isolate Yunnan 9 (KU291105) as reference, a total of 1,260 reads from HTS mapped to the virus genome with a coverage of 75.5% (average coverage: 33.5×). For verifying the presence of MaYMV in the source samples, MaYMV-specific primers MV-fw/MV-rev were designed to amplify the 513-bp fragment of the RdRp gene by a reverse transcription-polymerase chain reaction (RT-PCR) using the original total RNA. RT-PCR assay revealed that only 1 of the 6 samples tested positive for MaYMV, while the remaining plants were positive for other viruses (BYDV-PAV and BYDV-GAV that produce similar symptoms; viral-specific primers as previously described [Liu et al., 2020]). A subsequent survey of 17 winter wheat fields in 2021 confirmed that 6 of 286 wheat samples with virus symptoms were infected with MaYMV; 4 positives were from Linfen, Shanxi Province and 1 each from Yuanyang and Anyang, Henan Province. The full genome of wheat-infecting MaYMV isolate Anyang1 was then sequenced using RT-PCR with Sanger sequencing technology; the genomic sequence (5,642 nt) was deposited in GenBank as accession OK331995. BLASTn search showed that the complete genome sequence of this virus is 99.0%, 98.9% and 98.7% identical to isolate SC1 (MK652148), Guizhou1 (KU291107) and Yunnan 11 (KU248489), respectively. Also, the MaYMV isolate Anyang1 obtained in this study clustered with other MaYMV isolates in a phylogenetic analysis based on MaYMV full genomes. To the best of our knowledge, this is the first report of MaYMV in wheat worldwide. The presence of MaYMV in wheat is important because winter wheat could serve as an overwintering reservoir of MaYMV and perpetuate the virus in wheat-maize rotation systems in northern China.