The Sw-5b NLR Immune Receptor Induces Early Transcriptional Changes in Response to Thrips and Mechanical Modes of Inoculation of Tomato spotted wilt orthotospovirus.

The NLR (nucleotide-binding leucine-rich repeat) class immune receptor Sw-5b confers resistance to Tomato spotted wilt orthotospovirus (TSWV). Although Sw-5b is known to activate immunity upon recognition of the TSWV movement protein NSm, we know very little about the downstream events that lead to resistance. Here, we investigated the Sw-5b-mediated early transcriptomic changes that occur in response to mechanical and thrips-mediated inoculation of TSWV, using near-isogenic tomato lines CNPH-LAM 147 (Sw5b+/+) and Santa Clara (Sw-5b-/-). We observed earlier Sw-5b-mediated transcriptional changes in response to thrips-mediated inoculation compared with that in response to mechanical inoculation of TSWV. With thrips-mediated inoculation, differentially expressed genes (DEGs) were observed at 12, 24, and 72 h postinoculation (hpi). Whereas with mechanical inoculation, DEGs were observed only at 72 hpi. Although some DEGs were shared between the two methods of inoculation, many DEGs were specific to either thrips-mediated or mechanical inoculation of TSWV. In response to thrips-mediated inoculation, an NLR immune receptor, cysteine-rich receptor-like kinase, G-type lectin S-receptor-like kinases, the ethylene response factor 1, and the calmodulin-binding protein 60 were induced. Fatty acid desaturase 2-9, cell death genes, DCL2b, RIPK/PBL14-like, ERF017, and WRKY75 were differentially expressed in response to mechanical inoculation. Our findings reveal Sw-5b responses specific to the method of TSWV inoculation. Although TSWV is transmitted in nature primarily by the thrips, Sw-5b responses to thrips inoculation have not been previously studied. Therefore, the DEGs we have identified in response to thrips-mediated inoculation provide a new foundation for understanding the mechanistic roles of these genes in the Sw-5b-mediated resistance. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Structure-function analyses of coiled-coil immune receptors define a hydrophobic module for improving plant virus resistance.

Plant immunity relies on nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) that detect microbial patterns released by pathogens, and activate localized cell death to prevent the spread of pathogens. Tsw is the only identified resistance (R) gene encoding an NLR, conferring resistance to tomato spotted wilt orthotospovirus (TSWV) in pepper species (Capsicum, Solanaceae). However, molecular and cellular mechanisms of Tsw-mediated resistance are still elusive. Here, we analysed the structural and cellular functional features of Tsw protein, and defined a hydrophobic module to improve NLR-mediated virus resistance. The plasma membrane associated N-terminal 137 amino acid in the coiled-coil (CC) domain of Tsw is the minimum fragment sufficient to trigger cell death in Nicotiana benthamiana plants. Transient and transgenic expression assays in plants indicated that the amino acids of the hydrophobic groove (134th-137th amino acid) in the CC domain is critical for its full function and can be modified for enhanced disease resistance. Based on the structural features of Tsw, a super-hydrophobic funnel-like mutant, TswY137W, was identified to confer higher resistance to TSWV in a SGT1 (Suppressor of G-two allele of Skp1)-dependent manner. The same point mutation in a tomato Tsw-like NLR protein also improved resistance to pathogens, suggesting a feasible way of structure-assisted improvement of NLRs.

In vivo transient expression of a viral silencing suppressor, NSs, derived from tomato spotted wilt virus decreases insect RNAi efficiencies.

Tomato spotted wilt virus is a single-stranded RNA virus and causes a serious plant disease. Its horizontal transmission depends on some thrips species including Frankliniella occidentalis. Its genome encodes a nonstructural protein, nonstructural (NSs), which acts as a silencing suppressor and plays a crucial role in the pathogenicity by defending antiviral immunity using RNA interference (RNAi) in plant hosts. However, its physiological function as a silencing suppressor was not well clarified in insect vectors. This study assessed any change of RNAi efficiencies in two other insect systems by NSs expression. To this end, the gene was cloned into a eukaryotic expression vector and transiently expressed in two different insect species via in vivo transient expression (IVTE). After feeding the recombinant construct to non-viruliferous F. occidentalis, NSs expression was observed for over 2 days in the thrips. Under this expression of NSs, thrips were rescued from a treatment of a toxic double stranded RNA specific to v-ATPase. Interestingly, the thrips treated with IVTE significantly suppressed the expression of RNAi machinery genes such as SID and Dicer-2. The recombinant vector expressing NSs was injected to a non-vector insect, Spodoptera exigua, larvae. The larvae expressing NSs by the IVTE were highly susceptible to an infection of a RNA virus called iflavirus. These suggest that NSs acts as a silencing suppressor in insects and would be used for a synergist for RNA pathogens to control insect pests.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa.

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Genome-Wide Identification and Functions against Tomato Spotted Wilt Tospovirus of PR-10 in Solanum lycopersicum.

Tomato spotted wilt virus impacts negatively on a wide range of economically important plants, especially tomatoes. When plants facing any pathogen attack or infection, increase the transcription level of plant genes that are produced pathogenesis-related (PR) proteins. The aim of this study is a genome-wide identification of PR-10 superfamily and comparative analysis of PR-10 and Sw-5b gene functions against tomato responses to biotic stress (TSWV) to systemic resistance in tomato. Forty-five candidate genes were identified, with a length of 64-210 amino acid residues and a molecular weight of 7.6-24.4 kDa. The PR-10 gene was found on ten of the twelve chromosomes, and it was determined through a genetic ontology that they were involved in six biological processes and molecular activities, and nine cellular components. Analysis of the transcription level of PR-10 family members showed that the PR-10 gene (Solyc09g090980) has high expression levels in some parts of the tomato plant. PR-10 and Sw-5b gene transcription and activity in tomato leaves were strongly induced by TSWV infection, whereas H8 plants having the highest significantly upregulated expression of PR-10 and Sw-5b gene after the inoculation of TSWV, and TSWV inoculated in M82 plants showed significantly upregulated expression of PR-10 gene comparatively lower than H8 plants. There was no significant expression of Sw-5b gene of TSWV inoculated in M82 plants and then showed highly significant correlations between PR-10 and Sw-5b genes at different time points in H8 plants showed significant correlations compared to M82 plants after the inoculation of TSWV; a heat map showed that these two genes may also participate in regulating the defense response after the inoculation of TSWV in tomato.

Molecular Characteristics of Subgenomic RNAs and the Cap-Dependent Translational Advantage Relative to Corresponding Genomic RNAs of Tomato spotted wilt virus.

Tomato spotted wilt virus (TSWV) causes severe viral diseases on many economically important plants of Solanaceae. During the infection process of TSWV, a series of 3'-truncated subgenomic RNAs (sgRNAs) relative to corresponding genomic RNAs were synthesized, which were responsible for the expression of some viral proteins. However, corresponding genomic RNAs (gRNAs) seem to possess the basic elements for expression of these viral proteins. In this study, molecular characteristics of sgRNAs superior to genomic RNAs in viral protein expression were identified. The 3' ends of sgRNAs do not cover the entire intergenic region (IGR) of TSWV genomic RNAs and contain the remarkable A-rich characteristics. In addition, the 3' terminal nucleotides of sgRNAs are conserved among different TSWV isolates. Based on the eIF4E recruitment assay and subsequent northern blot, it is suggested that the TSWV sgRNA, but not gRNA, is capped in vivo; this is why sgRNA is competent for protein expression relative to gRNA. In addition, the 5' and 3' untranslated region (UTR) of sgRNA-Ns can synergistically enhance cap-dependent translation. This study further enriched the understanding of sgRNAs of ambisense RNA viruses.

Discovery of novel chromone derivatives containing a sulfonamide moiety as potential anti-TSWV agents.

A number of chromone derivatives containing sulfonamide structure were designed and synthesized. Firstly, the target compounds were evaluated for anti-TSWV activities in vivo by the half-leaf method. We found that most of the compounds had good anti-TSWV activities. Among them, compound 12B had excellent anti-TSWV inactivating activity with an EC50 of 80.5 µg/mL, which was significantly better than xiangcaoliusuobingmi (765.7 µg/mL). Secondly, TSWV nucleocapsid protein (N) was expressed and purified, and the affinity between the compounds and TSWV N was tested by microscale thermophoresis (MST). Compound 12B had a good affinity for TSWV N with a Kd value of 5.02 µM, which was superior to xiangcaoliusuobingmi (29.83 µM). Finally, in order to study the mode of interaction between the compound 12B and TSWV N, we carried out molecular docking. The results indicated that compound 12B might inactivate the virus by destroying the TSWV N oligomer structure. These results lay a solid foundation for the further discovery of chromone derivatives containing sulfonamide structure with high anti-TSWV activities.

Changes in the GN/GCof the M segment show positive selection and recombination of one aggressive isolate and two mild isolates of tomato spotted wilt virus.

We isolated and compared three tomato spotted wilt virus (TSWV) isolates from lettuce (TSWV-Let), pepper (TSWV-Pep), and tomato (TSWV-Tom) from central Mexico to determine their ability to infect a set of eighteen differential plant species from seven families. TWSV-Let was an aggressive isolate with the ability to infect up to 52% of the differential plants, including maize, under greenhouse conditions. The nucleotide (nt) sequences of the three isolates are more than 90% similar in the M and S RNA segments. In the M segment of the TSWV-Let isolate, we detected nt changes in their intergenic region (IGR) and, in the Gc gene, a region containing a recombination site, as well as a synapomorphy associated with one of three sites under positive selection with a change in one aa residue (a cysteine-to-valine mutation). We speculate on the association of these features in the Gc gene with host selection, adaptation, aggressiveness, and ability to infect maize plants.

Dynamic Transcriptional Profiles of Arabidopsis thaliana Infected by Tomato spotted wilt virus.

Tomato spotted wilt virus (TSWV) is a negative-stranded RNA virus that infects hundreds of plant species, causing great economic loss. Infected Arabidopsis thaliana plants develop symptoms including chlorosis and wilt, which can lead to cell death. From 9 to 15 days after TSWV infection, symptoms progress through a three-stage process of appearance, severity, and death. In this study, deep sequencing technology was first used to explore gene expression in response to TSWV infection in model plant A. thaliana at different symptom development stages. We found that plant immune defense and protein degradation are induced by TSWV infection and that both inductions became stronger over time. The photosynthesis pathway was attenuated with TSWV infection. Cell wall metabolism had a large extent of downregulation while some genes were upregulated. These results illustrate the dynamic nature of TSWV infection in A. thaliana at the whole-transcriptome level. The link between biological processes and subpathway metabolism was further analyzed. Our study provides new insight into host regulatory networks and dynamic processes in response to TSWV infection.

Tagitinin A from Tithonia diversifolia provides resistance to tomato spotted wilt orthotospovirus by inducing systemic resistance.

Tomato spotted wilt orthotospovirus (TSWV) causes devastating losses to agronomic and ornamental crops worldwide. Currently, there is no effective strategy to control this disease. Use of biotic inducers to enhance plant resistance to viruses maybe an effective approach. Our previous study indicated that Tagitinin A (Tag A) has a high curative and protective effect against TSWV. However, the underlying molecular mechanism of Tag A-mediated antiviral activity remains unknown. In this study, Tag A reduced the expression of the NSs, NSm genes was very low in untreated leaves following TSWV infection. In addition, the expression of all TSWV genes in the inoculated and systemic leaves was inhibited in the protective assay, and with an inhibition rate of more than 85% in systemic leaves. Tag A increased phenylalanine ammonia-lyase (PAL) activity in the curative and protective assays. The concentrations of jasmonic acid (JA) and jasmonic acid -isoleucine (JA-Ile) and the expression of its key gene NtCOI1 in Tag A-treated and systemic leaves of treated plants were significantly higher than those of the control plant. Furthermore, Tag A-induced resistance to TSWV could be eliminated by VIGS-mediated silencing of the NtCOI1 gene. These indicated that Tag A acts against TSWV by activating the JA defense signaling pathway.

Alterations in cellular RNA decapping dynamics affect tomato spotted wilt virus cap snatching and infection in Arabidopsis.

RNA processing and decay pathways have important impacts on RNA viruses, particularly animal-infecting bunyaviruses, which utilize a cap-snatching mechanism to translate their mRNAs. However, their effects on plant-infecting bunyaviruses have not been investigated. The roles of mRNA degradation and non-sense-mediated decay components, including DECAPPING 2 (DCP2), EXORIBONUCLEASE 4 (XRN4), ASYMMETRIC LEAVES2 (AS2) and UP-FRAMESHIFT 1 (UPF1) were investigated in infection of Arabidopsis thaliana by several RNA viruses, including the bunyavirus, tomato spotted wilt virus (TSWV). TSWV infection on mutants with decreased or increased RNA decapping ability resulted in increased and decreased susceptibility, respectively. By contrast, these mutations had the opposite, or no, effect on RNA viruses that use different mRNA capping strategies. Consistent with this, the RNA capping efficiency of TSWV mRNA was higher in a dcp2 mutant. Furthermore, the TSWV N protein partially colocalized with RNA processing body (PB) components and altering decapping activity by heat shock or coinfection with another virus resulted in corresponding changes in TSWV accumulation. The present results indicate that TSWV infection in plants depends on its ability to snatch caps from mRNAs destined for decapping in PBs and that genetic or environmental alteration of RNA processing dynamics can affect infection outcomes.

Refining a major QTL controlling spotted wilt disease resistance in cultivated peanut (Arachis hypogaea L.) and evaluating its contribution to the resistance variations in peanut germplasm.

BACKGROUND: Spotted wilt, caused by tomato spotted wilt virus (TSWV), has been one of major diseases in cultivated peanut grown in the southeastern United States (US) since 1990. Previously a major quantitative trait locus (QTL) controlling spotted wilt disease resistance was mapped to an interval of 2.55 cM genetic distance corresponding to a physical distance of 14.4 Mb on chromosome A01 of peanut by using a segregating F2 population. The current study focuses on refining this major QTL region and evaluating its contributions in the US peanut mini-core germplasm. RESULTS: Two simple sequence repeat (SSR) markers associated with the major QTL were used to genotype F5 individuals, and 25 heterozygous individuals were selected and developed into an F6 segregating population. Based on visual evaluation in the field, a total of 194 susceptible F6 individuals were selected and planted into F7 generation for phenotyping. Nine SSR markers were used to genotype the 194 F6 individuals, and QTL analysis revealed that a confidence interval of 15.2 Mb region had the QTL with 22.8% phenotypic variation explained (PVE). This QTL interval was further genotyped using the Amplicon-seq method. A total of 81 non-redundant single nucleotide polymorphism (SNP) and eight InDel markers were detected. No recombinant was detected among the F6 individuals. Two InDel markers were integrated into the linkage group and helped to refine the confidence interval of this QTL into a 0.8 Mb region. To test the QTL contributes to the resistance variance in US peanut mini-core germplasm, two flanking SSR markers were used to genotype 107 mini-core germplasm accessions. No statistically significant association was observed between the genotype at the QTL region and spotted wilt resistance in the mini-core germplasm, which indicated that the resistance allelic region at this QTL didn't contribute to the resistance variance in the US peanut mini-core germplasm, thus was a unique resistance source. CONCLUSION: A major QTL related to spotted wilt disease resistance in peanut was refined to a 0.8 Mb region on A01 chromosome, which didn't relate to spotted wilt disease resistance in the US peanut mini-core germplasm and might be a unique genetic source.

Comprehensive phytohormone metabolomic and transcriptomic analysis of tobacco (Nicotiana tabacum) infected by tomato spotted wilt virus (TSWV).

Tomato spotted wilt virus (TSWV) is ranked among the top 10 most destructive viruses globally. It results in abnormal leaf growth, stunting, and even death, significantly affecting crop yield and quality. Phytohormones play a crucial role in regulating plant-virus interactions. However, there is still limited research on the effect of TSWV on phytohormone levels, particularly growth hormones and genes involved in the phytohormone pathway. In our study, we combined phytohormone metabolomics and transcriptomics to examine the impact of TSWV infection on phytohormone content and gene expression profile. Metabolomic results showed that 41 metabolites, including major phytohormones and their precursors and derivatives were significantly altered after 14 days of TSWV inoculation tobacco plants cvK326, with 31 being significantly increased and 10 significantly reduced. Specifically, the levels of abscisic acid (ABA) and jasmonoyl-isoleucine (JA-Ile) were significantly reduced. The levels of indole-3-acetic acid (IAA) have remained unchanged. However, the levels of cytokinin isopentenyladenine (iP) and salicylic acid (SA) significantly increased. The transcriptome analysis revealed 2,746 genes with significant changes in expression. Out of these, 1,072 genes were significantly downregulated, while 1,674 genes were significantly upregulated. Among them, genes involved in ABA synthesis and signaling pathways, such as 9-cis-epoxycarotenoid dioxygenase (NCED), protein phosphatase 2C (PP2C), serine/threonine-protein kinase (SnRK2), and abscisic acid responsive element binding factor (ABF), exhibited significant downregulation. Additionally, expression of the lipoxygenase gene LOX, Jasmonate ZIM domain-containing protein gene JAZ, and transcription factor gene MYC were significantly down-regulated. In the cytokinin pathway, while there were no significant changes in the expression of the cytokinin synthesis genes, a significant downregulation of transcriptionally active factor type-B response regulators (type-B RRs) was observed. In terms of SA synthesis and signaling pathways, the isochorismate synthase gene ICS1 and the pathogenesis-related gene PR1 were significantly upregulated. These results can strengthen the theoretical foundation for understanding the interaction between TSWV and tobacco and provide new insights for the future prevention and control of TSWV.

Effective plant virus enrichment using carbon nanotubes and microfluidics.

Plant virus detection and identification in crops is a pillar for disease management, import of crop material, production of clean stock plants and basic plant virology studies. In this report, we present a platform for the enrichment and isolation of known or unknown viruses. This platform is based on carbon nanotube arrays inside a microfluidic device that can be a solution for the identification of low titer viruses from plants. Using our microfluidic devices, we achieved enrichment of two economically important viruses, the orthotospovirus, tomato spotted wilt orthotospovirus (TSWV) and the potyvirus, zucchini yellow mosaic virus (ZYMV). The carbon nanotube arrays integrated in these microfluidic devices are capable of trapping viruses discriminated by their size; the virus rich arrays can be then analyzed by common downstream techniques including immunoassays, PCR, HTS and electron microscopy. This procedure offers a simple to operate and portable sample preparation device capable of trapping viruses from raw plant extracts while reducing the host contamination.

Quinolizidine Alkaloids and Isoflavones from the Herb of Thermopsis lupinoides and Their Antiviral, Antifungal, and Insecticidal Activities.

As part of our ongoing investigation of natural bioactive substances from the genus Thermopsis of the tribe Fabaceae for agricultural protection, the chemical constituents of the herb Thermopsis lupinoides were systematically investigated, which led to the isolation of 39 quinolizidine alkaloids (QAs) (1-39), including 14 new QAs (1-14) and 14 isoflavones (40-53). Their structures were elucidated through comprehensive spectroscopic data analysis (IR, UV, NMR, HRESIMS), ECD calculations, and X-ray crystallography. The antitomato spotted wilt virus (TSWV) and antifungal (against Botrytis cinerea, Gibberella zeae, Phytophythora capsica, and Alternaria alternata) and insecticidal (against Aphis fabae and Tetranychus urticae) activities of the isolated compounds were screened using the lesion counting method, mycelial inhibition assay, and spray method, respectively. The bioassay results showed that 34 exhibited excellent protective activity against TSWV, with an EC50 value of 36.04 µg/mL, which was better than that of the positive control, ningnanmycin (86.03 µg/mL). The preliminary mechanistic exploration illustrated that 34 induced systemic acquired resistance in the host plant by acting on the salicylic acid signaling pathway. Moreover, 1 showed significant antifungal activity against B. cinerea (EC50 value of 20.83 µg/mL), while 2 exhibited good insecticidal activity against A. fabae (LC50 value of 24.97 µg/mL). This research is promising for the invention of novel pesticides from QAs with high efficiency and satisfactory ecological compatibility.

Detection of viruses directly from the fresh leaves of a Phalaenopsis orchid using a microfluidic system.

Early detection of pathogens is crucial for the effective surveillance of diseases. Many efforts have been made to explore methods which can detect these pathogens within a short period of time without requiring a tedious protocol. However, these developed methods have disadvantages such as they are relatively time-consuming or require specialized laboratory facilities. In this work, we have developed an integrated microfluidic system for rapid and automatic detection of viruses by direct analysis from fresh Phalaenopsis orchid leaves. The entire protocol, including ribonucleic acid (RNA) purification, reverse transcription loop-mediated-isothermal-amplification (RT-LAMP) and optical detection by measuring changes in turbidity was performed on a single chip. This is the first time that an integrated microfluidic system for the detection of viruses infecting the Phalaenopsis orchid has been demonstrated. The sensitivity of the developed system was also explored in this study to validate its performance. FROM THE CLINICAL EDITOR: In this study, the authors report the development of an integrated microfluidic system for rapid and automatic detection of viruses by direct analysis of fresh Phalaenopsis orchid leaves, performing the 3-step protocol using a single chip. Similar methods may find clinical application for fast and accurate detection of viral infections.

Two Alimentary Canal Proteins, Fo-GN and Fo-Cyp1, Act in Western Flower Thrips, Frankliniella occidentalis TSWV Infection.

Tomato spotted wilt virus (TSWV) is a plant virus that causes massive economic damage to high-valued crops. This virus is transmitted by specific thrips, including the western flower thrips, Frankliniella occidentalis. TSWV is acquired by the young larvae during feeding on infected host plants. TSWV infects the gut epithelium through hypothetical receptor(s) and multiplies within the cells for subsequent horizontal transmission to other plant hosts via the salivary glands during feeding. Two alimentary canal proteins, glycoprotein (Fo-GN) and cyclophilin (Fo-Cyp1), are thought to be associated with the TSWV entry into the gut epithelium of F. occidentalis. Fo-GN possesses a chitin-binding domain, and its transcript was localized on the larval gut epithelium by fluorescence in situ hybridization (FISH) analysis. Phylogenetic analysis indicated that F. occidentalis encodes six cyclophilins, in which Fo-Cyp1 is closely related to a human cyclophilin A, an immune modulator. The Fo-Cyp1 transcript was also detected in the larval gut epithelium. Expression of these two genes was suppressed by feeding their cognate RNA interference (RNAi) to young larvae. The RNAi efficiencies were confirmed by the disappearance of the target gene transcripts from the gut epithelium by FISH analyses. The RNAi treatments directed to Fo-GN or Fo-Cyp1 prevented the typical TSWV titer increase after the virus feeding, compared to control RNAi treatment. Our immunofluorescence assay using a specific antibody to TSWV documented the reduction of TSWV in the larval gut and adult salivary gland after the RNAi treatments. These results support our hypothesis that the candidate proteins Fo-GN and Fo-Cyp1 act in TSWV entry and multiplication in F. occidentalis.

Matrine-Type Alkaloids with Anti-Tomato Spotted Wilt Virus Activity from the Root of Sophora tonkinensis Gagnep.

As a continuation of our research on the development of pesticide active quinolizidine alkaloids (QAs) from the family Fabaceae, the chemical constituents of the root of Sophora tonkinensis Gagnep. were systematically investigated. Seventeen new matrine-type alkaloids (1-17), including one new naturally occurring compound (17), along with 20 known ones were isolated from the EtOH extract of S. tonkinensis. Notably, compound 5 possessed an unprecedented 6/6/5/4/6/6 hexacyclic system. Their structures were confirmed via comprehensive spectroscopic data analysis (IR, UV, NMR, HRESIMS), ECD calculation, and X-ray crystallography. Biological tests indicated that compounds 1, 4, 10, 12, 13, and 30 displayed significant anti-tomato spotted wilt virus (TSWV) activities compared with the positive control ningnanmycin. Moreover, compound 12 strongly inhibited the expression of the TSWV N, NSs, and NSm genes and TSWV NSs protein in plant host. Furthermore, compounds 4, 10, 12, 20, and 22 exhibited moderate insecticidal activities against TSWV thrip vector (Frankliniella occidentalis).