RESUMO
Whether in ant-aphid mutualism the ants exert evolutionary selection pressure on aphid morphology has not yet been fully tested. Here, we tested whether the long proboscises of Stomaphis yanonis (Aphididae Lachninae) aphids confer an advantage in preventing predation by the tending ants. Specifically, we tested the hypothesis that aphids with a shorter proboscis would excrete less honeydew, making them more likely to be preyed upon by ants. Our results showed that aphid individuals with a shorter proboscis took up less phloem sap and excreted less honeydew than individuals with a longer proboscis. In addition, among aphids with a similar body size, those with a shorter proboscis were more susceptible to predation by ants than those with a longer proboscis. These results suggest that predation by tending ants, by exerting selection pressure on aphid proboscis morphology, has caused the aphids to evolve longer proboscises.
Assuntos
Formigas , Afídeos , Comportamento Predatório , Animais , Afídeos/fisiologia , Formigas/fisiologia , Comportamento Predatório/fisiologia , Simbiose/fisiologiaRESUMO
We quantified the life table parameters and predation capacity of a generalist predatory mite, Typhlodromus bagdasarjani Wainstein and Arutunjan on five monotypic diets, including Tetranychus urticae Koch (TSSM) eggs in the presence (SW) and absence (SN) of webs, Trialeurodes vaporariorum Westwood (GHWF) eggs (G), honeydew (H), and maize pollen (M) as well as three mixed diets, including SN + M, SN + G, and G + M. Our results showed that the individuals fed on the mixed diets had a considerably shorter developmental time and pre-oviposition period (APOP), higher oviposition days, higher fecundity and population growth rate than those raised on the monotypic diets. Furthermore, we found that the mixed diet of TSSM and GHWF eggs was the most favorable diet, resulted in the highest fecundity and population growth rate, shortest developmental time and APOP. While TSSM eggs alone in the presence of webs and honeydew were the worst diets resulted in the longest developmental time, lower oviposition day, higher fecundity and population growth rate. Our data determined that TSSM has more nutritional benefits than GHWF for T. bagdasarjani. We observed the positive effects of pollen addition to prey on the predatory mite's immature and adult life-history characters; however, it reduced the predation rate. Overall, maize pollen could enhance ecosystem services provided against spider mites and whiteflies by positively impacting the increase of T. bagdasarjani population. This predator may be more effective when two prey species are available than when only one species is present.
Assuntos
Hemípteros , Tetranychidae , Feminino , Animais , Comportamento Predatório , Crescimento Demográfico , Ecossistema , Dieta , Controle Biológico de Vetores/métodosRESUMO
As an important biogenic amine in invertebrates and corresponding to the neurotransmitter norepinephrine in vertebrates, octopamine (OA) regulates diverse physiological and behavioral processes by binding to specific octopamine receptors (OARs) in invertebrates. At present, OARs have been identified and characterized in several insects. However, less is known about the OARs of Laodelphax striatellus, one of the most destructive pests in East Asian rice fields. In the present study, an α1-adrenergic-like OAR (LsOA1) from L. striatellus was cloned. LsOA1 has the typical characteristics of G-protein coupled receptors and is clustered with other insect homologs. The transcript level of LsOA1 varied in various stages and tissues, and was highly expressed at the egg stage and in the brain. Silencing of LsOA1 causes a reduction in vitellogenin (LsVg) and vitellogenin receptor (LsVgR) expression. Although LsOA1 interference did not affect the fecundity and survival of L. striatellus, the hatching rate of L. striatellus was significantly reduced, and the hatching period was prolonged. The decrease in the amount of honeydew excreted after silencing LsOA1 indicates that LsOA1 may be involved in regulating the feeding behavior of L. striatellus. In addition, the interference of LsOA1 significantly reduced the expression of capsid protein (CP) and viral RNA3 segment (RNA3) in rice stripe virus (RSV)-viruliferous L. striatellus, but did not affect the vertical transmission rate of RSV. The present study demonstrated that LsOA1 played a crucial role in the physiological and behavioral processes of L. striatellus, which will provide the basis for developing a new target gene for pest control.
Assuntos
Hemípteros , Oryza , Receptores de Amina Biogênica , Tenuivirus , Animais , Adrenérgicos/metabolismo , Hemípteros/fisiologia , Insetos , Receptores de Amina Biogênica/genética , Tenuivirus/metabolismoRESUMO
Aphid cornicles are abdominal appendages that secrete an array of volatile and nonvolatile compounds with diverse ecological functions. The emission of alarm pheromones yields altruistic benefits for clone-mates in the aphid colony, which is essentially a superorganism with a collective fate. Secreted droplets also contain unsaturated triglycerides, fast-drying adhesives that can be lethal when smeared on natural enemies but more often impede their foraging efficiency. The longest cornicles have evolved in aphids that feed in exposed locations and are likely used to scent-mark colony intruders. Reduced cornicles are associated with reliance on alternative defenses, such as the secretion of protective waxes or myrmecophily. Root-feeding and gall-forming lifestyles provide protected feeding sites and are associated with an absence of cornicles. In some eusocial gall-formers, soldier morphs become repositories of cornicle secretion used to defend the gall, either as menopausal apterae that defend dispersing alatae or as sterile first instars that dispatch predators with their stylets and use cornicle secretions as a construction material for gall repair. Collectively, the evidence is consistent with an adaptive radiation of derived cornicle functions molded by the ecological lifestyle of the aphid lineage.
Assuntos
Afídeos , Animais , FeromôniosRESUMO
AbstractInsect herbivores, such as aphids, are common on plants, yet how they interact with plant microbiomes remains largely unknown. For instance, for the widespread bacterial epiphyte and potential aphid pathogen Pseudomonas syringae, aphids could impact bacterial populations by serving as secondary hosts or by altering the epiphytic habitat through feeding and/or waste secretion. Here, we examined whether the pea aphid, Acyrthosiphon pisum, could influence epiphytic populations of P. syringae. First, we quantified epiphytic growth ability without aphids and virulence to aphids across 21 diverse P. syringae strains. For eight strains that varied in these traits we then assessed the influence of aphid presence on epiphytic bacterial growth. In some cases P. syringae benefited significantly from the presence of aphids, with up to 3.8 times more cell doublings. This benefit was not correlated with strain traits but rather with initial population densities; smaller bacterial populations received relatively more benefit from aphids, and larger populations received less benefit. Honeydew, the sugary waste product of aphids, in the absence of aphids was sufficient to increase P. syringae density on leaves. We conclude that aphid honeydew can sometimes increase P. syringae epiphytic growth but that the bacteria may not benefit from using aphids as hosts.
Assuntos
Afídeos , Animais , Afídeos/microbiologia , Bactérias , Herbivoria , Pseudomonas syringae , VirulênciaRESUMO
Honeydew is the keystone of many interactions between aphids and their predators, parasitoids, and mutualistic partners. Despite the crucial importance of honeydew in aphid-ant mutualism, very few studies have investigated the potential impacts of climate change on its production and composition. Here, we quantified changes in sugar compounds and the amount of honeydew droplets released by Aphis fabae reared on Vicia faba plants under elevated temperature and/or CO2 conditions. Following the combined elevation of these two abiotic factors, we found a significant increase in the fructose content of A. fabae honeydew, accompanied by nonsignificant trends of increase in total honeydew production and melezitose content. The environmental conditions tested in this study did not significantly impact the other honeydew sugar contents. The observed changes may be related to changes in phloem composition under elevated CO2 conditions as well as to increases in aphid metabolism and sap ingestion under elevated temperatures. Although limited, such changes in aphid honeydew may concurrently reinforce ant attendance and mutualism under elevated temperature and CO2 conditions. Finally, we discuss the enhancing and counteracting effects of climate change on other biological agents (gut microorganisms, predators, and parasitoids) that interact with aphids in a complex multitrophic system.
Assuntos
Afídeos , Animais , Açúcares , Temperatura , Dióxido de Carbono , Simbiose , CarboidratosRESUMO
Pest control in agriculture is mainly based on the application of insecticides, which may impact nontarget beneficial organisms leading to undesirable ecological effects. Neonicotinoids are among the most widely used insecticides. However, they have important negative side effects, especially for pollinators and other beneficial insects feeding on nectar. Here, we identify a more accessible exposure route: Neonicotinoids reach and kill beneficial insects that feed on the most abundant carbohydrate source for insects in agroecosystems, honeydew. Honeydew is the excretion product of phloem-feeding hemipteran insects such as aphids, mealybugs, whiteflies, and psyllids. We allowed parasitic wasps and pollinating hoverflies to feed on honeydew from hemipterans feeding on trees treated with thiamethoxam or imidacloprid, the most commonly used neonicotinoids. LC-MS/MS analyses demonstrated that both neonicotinoids were present in honeydew. Honeydew with thiamethoxam was highly toxic to both species of beneficial insects, and honeydew with imidacloprid was moderately toxic to hoverflies. Collectively, our data provide strong evidence for honeydew as a route of insecticide exposure that may cause acute or chronic deleterious effects on nontarget organisms. This route should be considered in future environmental risk assessments of neonicotinoid applications.
Assuntos
Comportamento Alimentar , Insetos/fisiologia , Neonicotinoides/toxicidade , Floema/parasitologia , Animais , Cucurbitaceae , Insetos/efeitos dos fármacos , Floema/efeitos dos fármacos , Análise de SobrevidaRESUMO
UV hyperspectral imaging (225 nm-410 nm) was used to identify and quantify the honeydew content of real cotton samples. Honeydew contamination causes losses of millions of dollars annually. This study presents the implementation and application of UV hyperspectral imaging as a non-destructive, high-resolution, and fast imaging modality. For this novel approach, a reference sample set, which consists of sugar and protein solutions that were adapted to honeydew, was set-up. In total, 21 samples with different amounts of added sugars/proteins were measured to calculate multivariate models at each pixel of a hyperspectral image to predict and classify the amount of sugar and honeydew. The principal component analysis models (PCA) enabled a general differentiation between different concentrations of sugar and honeydew. A partial least squares regression (PLS-R) model was built based on the cotton samples soaked in different sugar and protein concentrations. The result showed a reliable performance with R2cv = 0.80 and low RMSECV = 0.01 g for the validation. The PLS-R reference model was able to predict the honeydew content laterally resolved in grams on real cotton samples for each pixel with light, strong, and very strong honeydew contaminations. Therefore, inline UV hyperspectral imaging combined with chemometric models can be an effective tool in the future for the quality control of industrial processing of cotton fibers.
Assuntos
Imageamento Hiperespectral , Espectroscopia de Luz Próxima ao Infravermelho , Carboidratos , Análise dos Mínimos Quadrados , AçúcaresRESUMO
A non-targeted LC-HRMS fingerprinting methodology based on a C18 reversed-phase mode under universal gradient elution using an Orbitrap mass analyzer was developed to characterize and classify Spanish honey samples. A simple sample treatment consisting of honey dissolution with water and a 1:1 dilution with methanol was proposed. A total of 136 honey samples belonging to different blossom and honeydew honeys from different botanical varieties produced in different Spanish geographical regions were analyzed. The obtained LC-HRMS fingerprints were employed as sample chemical descriptors for honey pattern recognition by principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA). The results demonstrated a superior honey classification and discrimination capability with respect to previous non-targeted HPLC-UV fingerprinting approaches, with them being able to discriminate and authenticate the honey samples according to their botanical origins. Overall, noteworthy cross-validation multiclass predictions were accomplished with sensitivity and specificity values higher than 96.2%, except for orange/lemon blossom (BL) and rosemary (RO) blossom-honeys. The proposed methodology was also able to classify and authenticate the climatic geographical production region of the analyzed honey samples, with cross-validation sensitivity and specificity values higher than 87.1% and classification errors below 10.5%.
Assuntos
Mel , Mel/análise , Análise Discriminante , Cromatografia Líquida de Alta Pressão , Flores/química , Análise de Componente PrincipalRESUMO
The controversial question of whether optical rotation data can be used to distinguish floral from honeydew honey was investigated. Specific optical rotation angles were determined for 41 honey samples, including floral, honeydew, and adulterated honey, indicating that moderate to high positive optical rotation angles were found for all adulterated samples measured. A strong correlation between the sugar profile and the specific optical rotation angle of honey was confirmed, and a method based on 13C NMR metabolomics was proposed to calculate specific optical rotation angles with good correlation with the experimental values. The results indicate that optical rotation is not a reliable method for distinguishing the origin of honey but could indicate adulteration.
Assuntos
Mel , Mel/análise , Rotação Ocular , Espectroscopia de Ressonância MagnéticaRESUMO
Fir honeydew honey is a uniquely beneficial product which is often subjected to adulteration; however, pollen analysis is not useful to verify this honey type. Fourteen samples of EU protected designation of origin fir honeydew honey gathered directly from apiaries were studied. Standards of legal requirements and additional parameters, i.e., specific optical rotation, mineral content, and antioxidant activity, were tested. Five nectar honeys of different varieties were used as a comparative material. HPTLC and SDS-PAGE methods were used to fingerprint the honey types. All honeys tested fulfilled the quality requirements in terms of water content, pH, total acidity, conductivity, HMF, and diastase number. They were defined as dark amber on the Pfund scale and exhibited positive specific rotation (+2.5 to 25). Honeydew honey surpassed the tested nectar honeys in terms of mineral content and antioxidant activity as well as total polyphenolic content, except for buckwheat honey. The sugar and polyphenolic profile obtained by HPTLC allowed to distinguish honeydew from nectar honeys. The same was achieved by SDS-PAGE protein profiling. Both techniques seem to be cheap and quick tools for precisely distinguishing honeydew honey.
Assuntos
Antioxidantes/farmacologia , Mel/análise , Minerais/análise , Fenóis/análise , Quercus/química , Açúcares/análise , Antioxidantes/análiseRESUMO
The feasibility of non-targeted off-line SPE LC-LRMS polyphenolic fingerprints to address the classification and authentication of Spanish honey samples based on both botanical origin (blossom and honeydew honeys) and geographical production region was evaluated. With this aim, 136 honey samples belonging to different botanical varieties (multifloral and monofloral) obtained from different Spanish geographical regions with specific climatic conditions were analyzed. Polyphenolic compounds were extracted by off-line solid-phase extraction (SPE) using HLB (3 mL, 60 mg) cartridges. The obtained extracts were then analyzed by C18 reversed-phase LC coupled to low-resolution mass spectrometry in a hybrid quadrupole-linear ion trap mass analyzer and using electrospray in negative ionization mode. Principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) were employed to assess the pattern recognition capabilities of the obtained fingerprints to address honey classification and authentication. In general, a good sample discrimination was accomplished by PLS-DA, being able to differentiate both blossom-honey and honeydew-honey samples according to botanical varieties. Multiclass predictions by cross-validation for the set of blossom-honey samples showed sensitivity, specificity, and classification ratios higher than 60%, 85%, and 87%, respectively. Better results were obtained for the set of honeydew-honey samples, exhibiting 100% sensitivity, specificity, and classification ratio values. The proposed fingerprints also demonstrated that they were good honey chemical descriptors to deal with climatic and geographical issues. Characteristic polyphenols of each botanical variety were tentatively identified by LC-MS/MS in multiple-reaction monitoring mode to propose possible honey markers for future experiments (i.e., naringin for orange/lemon blossom honeys, syringic acid in thyme honeys, or galangin in rosemary honeys).
Assuntos
Mel , Mel/análise , Cromatografia Líquida , Quimiometria , Espectrometria de Massas em Tandem , Extração em Fase SólidaRESUMO
The "River Disease" (RD), a disorder impacting honeybee colonies located close to waterways with abundant riparian vegetation (including Sebastiania schottiana, Euphorbiaceae), kills newly hatched larvae. Forager bees from RD-affected colonies collect honeydew excretions from Epormenis cestri (Hemiptera: Flatidae), a planthopper feeding on trees of S. schottiana. First-instar honeybee larvae fed with this honeydew died. Thus, we postulated that the nectars of RD-affected colonies had a natural toxin coming from either E. cestri or S. schottiana. An untargeted metabolomics characterization of fresh nectars extracts from colonies with and without RD allowed to pinpoint xanthoxylin as one of the chemicals present in higher amounts in nectar from RD-affected colonies than in nectars from healthy colonies. Besides, xanthoxylin was also found in the aerial parts of S. schottiana and the honeydew excreted by E. cestri feeding on this tree. A larva feeding assay where xanthoxylin-enriched diets were offered to 1st instar larvae showed that larvae died in the same proportion as larvae did when offered enriched diets with nectars from RD-colonies. These findings demonstrate that a xenobiotic can mimic the RD syndrome in honeybee larvae and provide evidence of an interspecific flow of xanthoxylin among three trophic levels. Further, our results give information that can be considered when implementing measures to control this honeybee disease.
Assuntos
Acetofenonas/análise , Abelhas/fisiologia , Euphorbiaceae/química , Acetofenonas/farmacologia , Animais , Abelhas/crescimento & desenvolvimento , Dieta/veterinária , Análise Discriminante , Euphorbiaceae/metabolismo , Cromatografia Gasosa-Espectrometria de Massas , Larva/efeitos dos fármacos , Larva/fisiologia , Análise dos Mínimos Quadrados , Espectroscopia de Ressonância Magnética , Metabolômica/métodos , Componentes Aéreos da Planta/química , Componentes Aéreos da Planta/metabolismo , Néctar de Plantas/químicaRESUMO
In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.
RESUMO
Stingless bee honey, specifically honeydew honey, is generally valued for its better health benefits than those of most blossom types. However, scientific studies about the differentiation of stingless bee honey based on honeydew and blossom origins are very limited. In this study, 13C NMR spectroscopy was employed to quantify the seven major sugar tautomers in stingless bee honey samples, and the major sugar compositions of both honeydew and blossom types were found not significantly different. However, several physicochemical properties of honeydew honey including moisture content, free acidity, electrical conductivity, ash content, acetic acid, diastase, hydrogen peroxide, and mineral elements levels were significantly higher; while total soluble solid, proline, and hydroxymethylfurfural were significantly lower than blossom honey. Greater antioxidant capacity in honeydew honey was proven with higher total phenolic compounds, ABTS, DPPH, superoxide radical scavenging activities, peroxyl radical inhibition, iron chelation, and ferric reducing power. Using principal component analysis (PCA), two clusters of stingless bee honey from the honeydew and blossom origin were observed. PCA also revealed that the differentiation between honeydew and blossom origin of stingless bee honey is possible with certain physicochemical and antioxidant parameters. The combination of NMR spectroscopy and chemometrics are suggested to be useful to determine the authenticity and botanical origin of stingless bee honey.
Assuntos
Antioxidantes/química , Abelhas , Carboidratos/química , Quimiometria , Mel/análise , Ressonância Magnética Nuclear Biomolecular , Fenóis/química , Animais , MalásiaRESUMO
The objective of this study was to examine the effect of different treatments on the physicochemical, antioxidant, and antibacterial properties of honeydew honey. Honeydew honey was subjected to heat treatment and 9 different ultrasound treatments. Our results showed that the following parameters were significantly changed: water content, pH, electrical conductivity, diastase activity, HMF content and water activity. The ultrasound resulted in an increase in the total phenol content and the antioxidant capacity (DPPH, FRAP, and ABTS tests) in comparison with the conventional thermal technique. In most cases, the samples subjected to ultrasound improved the antibacterial activity; the heat treatment resulted in a significant reduction of the antibacterial activity, and sample 4 (ultrasound 30 °C, 5 min) showed the best antibacterial activity. The ultrasound treatment, especially at lower temperatures, represents a technique that enables the preservation and improvement of the biological properties of honeydew honey.
RESUMO
Plants link interactions between aboveground and belowground organisms. Herbivore-induced changes in plant chemistry are hypothesized to impact entire food webs by changing the strength of trophic cascades. Yet, few studies have explored how belowground herbivores affect the behaviors of generalist predators, nor how such changes may act through diverse changes to the plant metabolome. Using a factorial experiment, we tested whether herbivory by root-knot nematodes (Meloidogyne incognita) affected the aboveground interaction among milkweed plants (Asclepias fascicularis or Asclepias speciosa), oleander aphids (Aphis nerii), and aphid-tending ants (Linepithema humile). We quantified the behaviors of aphid-tending ants, and we measured the effects of herbivore treatments on aphid densities and on phytochemistry. Unexpectedly, ants tended aphids primarily on the leaves of uninfected plants, whereas ants tended aphids primarily at the base of the stem of nematode-infected plants. In nematode-infected plants, aphids excreted more sugar per capita in their ant-attracting honeydew. Additionally, although plant chemistry was species-specific, nematode infection generally decreased the richness of plant secondary metabolites while acting as a protein sink in the roots. Path analysis indicated that the ants' behavioral change was driven in part by indirect effects of nematodes acting through changes in plant chemistry. We conclude that belowground herbivores can affect the behaviors of aboveground generalist ant predators by multiple paths, including changes in phytochemistry, which may affect the attractiveness of aphid honeydew rewards.
Assuntos
Formigas , Afídeos , Nematoides , Animais , Herbivoria , PlantasRESUMO
Bulgaria and North Macedonia have a long history of the production and use of honey; however, there is an obvious lack of systematic and in-depth research on honey from both countries. The oak honeydew honey is of particular interest, as it is highly valued by consumers because of its health benefits. The aim of this study was to characterize honeydew and floral honeys from Bulgaria and North Macedonia based on their NMR profiles. The 1D and 2D 1H and 13C-NMR spectra were measured of 16 North Macedonian and 22 Bulgarian honey samples. A total of 25 individual substances were identified, including quinovose, which was found for the first time in honey. Chemometric methods (PCA-principal component analysis, PLS-DA-partial least squares discriminant analysis, ANOVA-analysis of variance) were used to detect similarities and differences between samples, as well as to determine their botanical and geographical origin. Semiquantitative data on individual sugars and some other constituents were obtained, which allowed for the reliable classification of honey samples by botanical and geographical origin, based on chemometric approaches. The results enabled us to distinguish oak honeydew honey from other honey types, and to determine the country of origin. NMR was a rapid and convenient method, avoiding the need for other more time-consuming analytical techniques.
Assuntos
Análise de Alimentos/métodos , Mel/análise , Espectroscopia de Ressonância Magnética/métodos , Bulgária , Quimioinformática/métodos , Flores , Análise de Alimentos/estatística & dados numéricos , Análise dos Mínimos Quadrados , Espectroscopia de Ressonância Magnética/estatística & dados numéricos , Análise de Componente Principal , República da Macedônia do Norte , Açúcares/análiseRESUMO
BACKGROUND: Aphids are common insect pests that feed on and excrete feces/honeydew on storage vegetables, especially in the temperate region of the northern hemisphere. The honeydew of aphids is an excellent growth medium for microorganisms. To explore the effects of aphid infestation on the risk of microbial contamination and food safety: (i) the bacterial diversity and community in aphid honeydew were investigated; (ii) the nutritional components of the cabbage were analyzed; and (iii) safety was evaluated. RESULTS: The results showed that the dominant bacteria in storage Chinese cabbage under different exposure times belonged to the phylum Proteobacteria, family Enterobacteriaceae. The richness of Enterobacteriaceae increased from 36.35% (1 day) to 39.70% (5 days) and to 50.74% (10 days) as the exposure time increased. Serratia was the genus with the highest abundance (23.38% for 1 day, 30.56% for 5 days and 37.85% for 10 days). The abundance of pathways associated with Staphylococcus aureus infection and Shigellosis increased significantly after prolonged storage. In addition, when the aphid density increased from 0 to 100 per 250 g of Chinese cabbage leaves, the protein content in Chinese cabbage decreased significantly, whereas the reducing sugar content increased significantly. CONCLUSION: These results demonstrate that the honeydew excreted by the green peach aphid Myzus persicae (Sulzer) on storage Chinese cabbage can serve as a medium for some foodborne disease pathogens. The present study may provide both a theoretical and practical basis for vegetable storage to reduce the risk of foodborne pathogen infection and to maintain the balance of nutrients. © 2020 Society of Chemical Industry.
Assuntos
Afídeos/fisiologia , Bactérias/crescimento & desenvolvimento , Brassica/microbiologia , Brassica/parasitologia , Animais , Bactérias/classificação , Bactérias/genética , Bactérias/metabolismo , Brassica/química , Valor Nutritivo , Doenças das Plantas/microbiologia , Doenças das Plantas/parasitologia , Folhas de Planta/química , Folhas de Planta/microbiologia , Folhas de Planta/parasitologiaRESUMO
(E)-ß-Farnesene (EßF) is the predominant constituent of the alarm pheromone of most aphid pest species. Moreover, natural enemies of aphids use EßF to locate their aphid prey. Some plant species emit EßF, potentially as a defense against aphids, but field demonstrations are lacking. Here, we present field and laboratory studies of flower defense showing that ladybird beetles are predominantly attracted to young stage-2 pyrethrum flowers that emitted the highest and purest levels of EßF. By contrast, aphids were repelled by EßF emitted by S2 pyrethrum flowers. Although peach aphids can adapt to pyrethrum plants in the laboratory, aphids were not recorded in the field. Pyrethrum's (E)-ß-farnesene synthase (EbFS) gene is strongly expressed in inner cortex tissue surrounding the vascular system of the aphid-preferred flower receptacle and peduncle, leading to elongated cells filled with EßF. Aphids that probe these tissues during settlement encounter and ingest plant EßF, as evidenced by the release in honeydew. These EßF concentrations in honeydew induce aphid alarm responses, suggesting an extra layer of this defense. Collectively, our data elucidate a defensive mimicry in pyrethrum flowers: the developmentally regulated and tissue-specific EßF accumulation and emission both prevents attack by aphids and recruits aphid predators as bodyguards.