Structural and functional characterization of genes PYL-PP2C-SnRK2s in the ABA signalling pathway of Cucurbita pepo.

BACKGROUND: The core regulation of the abscisic acid (ABA) signalling pathway comprises the multigenic families PYL, PP2C, and SnRK2. In this work, we conducted a genome-wide study of the components of these families in Cucurbita pepo. RESULTS: The bioinformatic analysis of the C. pepo genome resulted in the identification of 19 CpPYL, 102 CpPP2C and 10 CpSnRK2 genes. The investigation of gene structure and protein motifs allowed to define 4 PYL, 13 PP2C and 3 SnRK2 subfamilies. RNA-seq analysis was used to determine the expression of these gene families in different plant organs, as well as to detect their differential gene expression during germination, and in response to ABA and cold stress in leaves. The specific tissue expression of some gene members indicated the relevant role of some ABA signalling genes in plant development. Moreover, their differential expression under ABA treatment or cold stress revealed those ABA signalling genes that responded to ABA, and those that were up- or down-regulated in response to cold stress. A reduced number of genes responded to both treatments. Specific PYL-PP2C-SnRK2 genes that had potential roles in germination were also detected, including those regulated early during the imbibition phase, those regulated later during the embryo extension and radicle emergence phase, and those induced or repressed during the whole germination process. CONCLUSIONS: The outcomes of this research open new research lines for agriculture and for assessing gene function in future studies.

Single and combined exposure to 'bee safe' pesticides alter behaviour and offspring production in a ground-nesting solitary bee (Xenoglossa pruinosa).

Mounting evidence supporting the negative impacts of exposure to neonicotinoids on bees has prompted the registration of novel 'bee-friendly' insecticides for agricultural use. Flupyradifurone (FPF) is a butenolide insecticide that shares the same mode of action as neonicotinoids and has been assessed to be 'practically non-toxic to adult honeybees' using current risk assessment procedures. However, these assessments overlook some routes of exposure specific to wild bees, such as contact with residues in soil for ground-nesters. Co-exposure with other pesticides may also lead to detrimental synergistic effects. In a fully crossed experiment, we assessed the possible lethal and sublethal effects of chronic exposure to two pesticides used on Cucurbita crops, the insecticide Sivanto Prime (FPF) and the fungicide Quadris Top (azoxystrobin and difenoconazole), alone or combined, on solitary ground-nesting squash bees (Xenoglossa pruinosa). Squash bees exposed to Quadris Top collected less pollen per flower visit, while Sivanto-exposed bees produced larger offspring. Pesticide co-exposure induced hyperactivity in female squash bees relative to both the control and single pesticide exposure, and reduced the number of emerging offspring per nest compared to individual pesticide treatments. This study demonstrates that 'low-toxicity' pesticides can adversely affect squash bees under field-realistic exposure, alone or in combination.

Optic nerve pilomyxoid astrocytoma: Intraoperative squash smear cytology of a rare entity.

Pilomyxoid astrocytoma [PMA] is a rare, recently described variant of pilocytic astrocytoma with unique clinical and histopathological characteristics. It typically affects the optico-chiasmatic and hypothalamic region in infants and young children. Though the pilocytic astrocytoma is the commonest tumor of the optic nerve, pilomyxoid astrocytoma arising from the intraorbital part of the optic nerve is extremely rare. To the best of our knowledge, only one case of introrbital optic nerve pilomyxoid astrocytoma has been described in the English literature. We report two cases of pilomyxoid astrocytoma arising from the intraorbital optic nerve, diagnosed on intraoperative squash smear cytology and later confirmed on histopathology. Like in other locations, optic nerve pilomyxoid astrocytoma behaves in an aggressive manner.

Cytological features of ependymal and choroid plexus tumours.

Ependymal and choroid plexus tumours arise in anatomically related regions. Their intraoperative differential diagnosis is large and depends on factors such as age, tumour site and clinical presentation. Squash cytology can provide valuable information in this context. Cytological features of conventional ependymomas, subependymomas and myxopapillary ependymomas as well as choroid plexus tumours are reviewed and illustrated. Differential diagnostic considerations integrating morphological and clinical information are discussed.

First report of cucurbit yellow vine disease caused by Serratia marcescens on cucurbit crops in Iowa.

Cucurbit yellow vine disease (CYVD) is caused by Serratia marcescens, vectored by squash bugs (Anasa tristis), and is an emerging disease in many parts of the U.S. CYVD can cause 100% yield losses in cucurbits (Bruton et al., 2003). In the summer of 2021, at the Iowa State University Horticultural Research Station (HRS) in Gilbert, Iowa, we observed leaf yellowing, vine decline, and honey-brown discoloration of the phloem of acorn squash (Cucurbita pepo cv. Table Ace) plants in research fields that were infested with squash bugs. In 2022, we observed similar symptoms on pumpkin (Cucurbita maxima cv. Howden) and muskmelon (Cucumis melo cv. Athena) in different fields at the HRS and on giant pumpkins (Cucurbita maxima cv. Prizewinner) in Jones and Ringgold counties. For up to 3 symptomatic plants of each cucurbit species per location, a 20-cm-long stem section immediately above the soil line was excised, surface sterilized by immersion in 10% sodium hypochlorite and 70% ethanol for 2 min each, then triple rinsed in sterile water. The interior of the cross-section tissue was blotted on Luria agar amended with cycloheximide (100 µg/ml) and tetracycline (20 µg/ml) (Stock et al. 2003). Whitish translucent colonies developed after incubation at 28°C for 48 h. The genomic DNA of three isolates from symptomatic plants of muskmelon (MK01), pumpkin (HFP01), and giant pumpkin (AP01), was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). S. marcescens species-specific primers YV1 (5'-GGGACTTGCTCCCCGG-3') and YV4 (5'-AACGTCAATTGATGAACGTATTAAGT-3') (Bruton et al. 2003) were used to amplify part of the 16S rDNA gene, and the primers specific to S. marcescens CYVD strains A79F/A79R (Zhang et al., 2005) were used to amplify part of a major facilitatory superfamily (MFS) transporter gene strain. The sequences of the 16S rRNA PCR product for the three isolates were identical and were deposited in NCBI under Accession OR963533. They shared 100% (395/395 nt) identity with other CYVD strains (Rascoe et al. 2003) and those of other S. marcescens strains in NCBI. The sequences of the amplified region of the MFS transporter gene of the three isolates (NCBI Accession OR962261) were identical and showed a 98.8% (319/323 nt) identity to that of non-CYVD-causing S. marcescens strains, such as N10A28 (Accession CP033623.1). Koch's postulates were fulfilled by inoculating C. pepo cv. Zephyr plants with either strain HFP01 or phosphate buffer saline (PBS) (10 plants per treatment) 1 wk after seeding by injecting 300 µl of bacteria (~108 CFU/ml) or PBS using a syringe needle. Plants were incubated at 28°C in a growth room for 4 wks. CYVD symptoms similar to those observed in the field developed on 7 out of 10 plants inoculated with strain HFP01 in one study, and 9 out 10 plants in a replicate study, with none of the PBS-inoculated plants showing CYVD symptoms. Bacteria were isolated from the symptomatic plants with selection on tetracycline. The PCR fragments amplified with YV1/YV4 and A79F/A79R were the same size as those of the pre-inoculation strain HFP01. To our knowledge this is the first report of CYVD in Iowa and in the Upper Midwest of the U.S. CYVD is a devastating disease that poses a significant threat to cucurbit production. This report can serve as an alert for the region's growers and for the development of effective management practices.

A multiplex RT-qPCR assay for simultaneous detection of cucurbit viruses from individual whitefly and plant samples.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

Exogenous Melatonin Application Accelerated the Healing Process of Oriental Melon Grafted onto Squash by Promoting Lignin Accumulation.

Melatonin (MT) is a vital hormone factor in plant growth and development, yet its potential to influence the graft union healing process has not been reported. In this study, we examined the effects of MT on the healing of oriental melon scion grafted onto squash rootstock. The studies indicate that the exogenous MT treatment promotes the lignin content of oriental melon and squash stems by increasing the enzyme activities of hydroxycinnamoyl CoA ligase (HCT), hydroxy cinnamaldehyde dehydrogenase (HCALDH), caffeic acid/5-hydroxy-conifer aldehyde O-methyltransferase (COMT), caffeoyl-CoA O-methyltransferase (CCoAOMT), phenylalanine ammonia-lyase (PAL), 4-hydroxycinnamate CoA ligase (4CL), and cinnamyl alcohol dehydrogenase (CAD). Using the oriental melon and squash treated with the exogenous MT to graft, the connection of oriental melon scion and squash rootstock was more efficient and faster due to higher expression of wound-induced dedifferentiation 1 (WIND1), cyclin-dependent kinase (CDKB1;2), target of monopteros 6 (TMO6), and vascular-related NAC-domain 7 (VND7). Further research found that the exogenous MT increased the lignin content of the oriental melon scion stem by regulating CmCAD1 expression, and then accelerated the graft healing process. In addition, the root growth of grafted seedlings treated with the exogenous MT was more vigorous.

Constant ratio between the genomic components of bipartite begomoviruses during infection and transmission.

The genomic components of multipartite viruses are encapsidated in separate virus particles, and the frequencies of genomic components represent one of the key genetic features. Many begomoviruses of economic significance are bipartite, and the details of the association between their genomic components remain largely unexplored. We first analyzed the temporal dynamics of the quantities of DNA-A and DNA-B and the B/A ratio of the squash leaf curl China virus (SLCCNV) in plants and found that while the quantities of DNA-A and DNA-B varied significantly during infection, the B/A ratio remained constant. We then found that changes in the B/A ratio in agrobacteria inoculum may significantly alter the B/A ratio in plants at 6 days post inoculation, but the differences disappeared shortly thereafter. We next showed that while the quantities of DNA-A and DNA-B among plants infected by agrobacteria, sap transmission and whitefly-mediated transmission differed significantly, the B/A ratios were similar. Further analysis of gene expression revealed that the ratio of the expression of genes encoded by DNA-A and DNA-B varied significantly during infection. Finally, we monitored the temporal dynamics of the quantities of DNA-A and DNA-B and the B/A ratio of another bipartite begomovirus, and a constant B/A ratio was similarly observed. Our findings highlight the maintenance of a constant ratio between the two genomic components of bipartite begomoviruses during infection and transmission, and provide new insights into the biology of begomoviruses.

Herbarium specimens reveal herbivory patterns across the genus Cucurbita.

PREMISE: Quantifying how closely related plant species differ in susceptibility to insect herbivory is important for understanding the variation in evolutionary pressures on plant functional traits. However, empirically measuring in situ variation in herbivory spanning the geographic range of a plant-insect complex is logistically difficult. Recently, new methods have been developed using herbarium specimens to investigate patterns in plant-insect symbioses across large geographic scales. Such investigations provide insights into how accelerated anthropogenic changes may impact plant-insect interactions that are of ecological or agricultural importance. METHODS: Here, we analyze 274 pressed herbarium samples to investigate variation in herbivory damage in 13 different species of the economically important plant genus Cucurbita (Cucurbitaceae). This collection is composed of specimens of wild, undomesticated Cucurbita that were collected from across their native range, and Cucurbita cultivars collected from both within their native range and from locations where they have been introduced for agriculture in temperate North America. RESULTS: Herbivory is common on individuals of all Cucurbita species collected throughout their geographic ranges. However, estimates of herbivory varied considerably among individuals, with mesophytic species accruing more insect damage than xerophytic species, and wild specimens having more herbivory than specimens collected from human-managed habitats. CONCLUSIONS: Our study suggests that long-term evolutionary changes in habitat from xeric to mesic climates and wild to human-managed habitats may mediate the levels of herbivory pressure from coevolved herbivores. Future investigations into the potential factors that contribute to herbivory may inform the management of domesticated crop plants and their insect herbivores.

Squash smear and fine needle aspiration features of conventional chordoma.

Chordoma is a rare primary central nervous system tumour of notochordal origin. Proper intraoperative or preoperative diagnosis of this entity is crucial for appropriate surgical management. The most common histopathological subtype is conventional chordoma. Cytological characteristics of this subtype are quite distinctive and the diagnosis can be easily made by cytology. There are two particularly important features that are observed in both squash smear and fine needle aspiration specimens: an abundant myxochondroid stroma and cells with large vacuoles, including physaliferous cells. The main differential diagnosis is conventional chondrosarcoma, but in problematic cases immunohistochemical studies are useful to establish the correct diagnosis.

Cytopathology of glioneuronal and neuronal tumours with histological correlations.

Glioneuronal and neuronal tumours constitute a diverse group of tumours that feature neuronal differentiation. In mixed glioneuronal tumours, a glial component is present in addition to the neuronal component. With a few exceptions (eg diffuse leptomeningeal glioneuronal tumour) they are well-circumscribed and slow-growing tumours, which is why their prognosis is intrinsically favourable after gross total resection. Rendering an intraoperative diagnosis of glioneuronal/neuronal tumour is therefore important-neurosurgeons should remove them to prevent the persistence of clinical symptoms and/or recurrence. In this context, cytopathological examination can be especially useful for assessing cellular details when frozen section artefacts render poor-quality preparations, as is the case for this group of tumours, which are frequently mistaken for infiltrating gliomas (eg diffuse astrocytoma infiltrating grey matter, oligodendroglioma) on frozen section slides. The aim of this article is to review the cytomorphological features of glioneuronal and neuronal tumours according to the 2021 World Health Organization classification of central nervous system tumours, 5th edition. Additionally, since interpretation in intraoperative cytology relies on intuiting tissue patterns from cytology preparations, representative histological figures of all discussed entities have been included. Clues for specific diagnoses and the primary diagnostic problems encountered during intraoperative procedures are also discussed.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Role of intra-operative squash cytology in rosette-forming glioneuronal tumor of the fourth ventricle: a case report.

Rosette-forming glioneuronal tumor (RGNT) of the 4th ventricle is a newly described WHO grade I brain tumor included in recent WHO classification of CNS tumors. It is a biphasic tumor thought to originate from pluripotent progenitor cells of subependymal plate. Intra-operative diagnosis plays an important role, as complete surgical excision is the treatment of choice. We are reporting a case of RGNT in a 19 years-old young male emphasizing the intra-operative pathological pointers and their role in accurate diagnosis for the suitable surgical intervention.

Expression and Functional Analysis of the Type III Secretion System Effector Repertoire of the Xylem Pathogen Erwinia tracheiphila on Cucurbits.

The predicted repertoire of type III secretion system effectors (T3SEs) in Erwinia tracheiphila, causal agent of cucurbit bacterial wilt, is much larger than in xylem pathogens in the closely related genera Erwinia and Pantoea. The genomes of strains BHKY and SCR3, which represent distinct E. tracheiphila clades, encode at least 6 clade-specific and 12 shared T3SEs. The strains expressed the majority of the T3SE genes examined in planta. Among the shared T3SE genes, eop1 was expressed most highly in both strains in squash (Cucurbita pepo) and muskmelon (Cucumis melo) but the clade-specific gene avrRpm2 was expressed 40- to 900-fold more than eop1 in BHKY. The T3SEs AvrRpm2, Eop1, SrfC, and DspE contributed to BHKY virulence on squash and muskmelon, as shown using combinatorial mutants involving six T3SEs, whereas OspG and AvrB4 contributed to BHKY virulence only on muskmelon, demonstrating host-specific virulence functions. Moreover, Eop1 was functionally redundant with AvrRpm2, SrfC, OspG, and AvrB4 in BHKY, and BHKY mutants lacking up to five effector genes showed similar virulence to mutants lacking only two genes. The T3SEs OspG, AvrB4, and DspE contributed additively to SCR3 virulence on muskmelon and were not functionally redundant with Eop1. Rather, loss of eop1 and avrB4 restored wild-type virulence to the avrB4 mutant, suggesting that Eop1 suppresses a functionally redundant effector in SCR3. These results highlight functional differences in effector inventories between two E. tracheiphila clades, provide the first evidence of OspG as a phytopathogen effector, and suggest that Eop1 may be a metaeffector influencing virulence. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Cytological features in pilomyxoid astrocytoma: A case report with summary of prior published cases.

Pilomyxoid astrocytoma is a subtype of pilocytic astrocytoma that is described as a grade 1 tumour in the 2022 WHO classification of central nervous system tumours. It occurs predominantly in the hypothalamic region in infants. Although the histological features of pilomyxoid astrocytomas are well documented, few reports are available in the literature regarding cytological findings. Here we describe the squash cytological features of a case of pilomyxoid astrocytoma along with a summary of prior published cases. Smears for this type of tumour tend to be more cellular, with piloid cells arranged in an angiocentric pattern without Rosenthal fibres or eosinophilic granular bodies. A blue myxoid substance may be present in the background.

Squash cytology of clear cell meningioma: Report of a case.

Clear cell meningioma (CCM) is a rare histological variant of meningioma. It is commonly located at the cerebellopontine angle and the spine particularly around the cauda equina. Squash cytology finding of meningioma is well-established, however there is sparse literature available on squash cytology of CCM. Here we describe a case of CCM occurring in the lumbar spine in a young woman. Initially, on squash cytology a diagnosis of a low grade glioma favouring an ependymoma was considered. Eventually histopathological examination along with immunohistochemistry helped us reach the diagnosis of a CCM. In this article we discuss the cytomorphology of CCM along with its cytological differentials and the hurdles to an accurate diagnosis.

Comparative evaluation of squash smear and frozen section in the intraoperative diagnosis of central nervous system tumours.

BACKGROUND: The squash smear technique was introduced into intra-operative neurosurgical diagnosis as early as 1930. It is becoming increasingly popular in the diagnosis of central nervous system (CNS) lesions, and is fairly accurate even with a small sample. The current study assesses the accuracy and utility of the squash smear and frozen section (FS) techniques in intraoperative consultations. Correlations with histopathological diagnoses are presented. AIMS: To compare two intra-operative diagnostic techniques-squash smear cytology and FS examination-in the context of central nervous system tumours. MATERIALS AND METHODS: A total of 53 cases of CNS tumours were included in the study, and all were subjected to squash smear examination. FS examinations were conducted for 39 of these samples. The results of the two techniques were compared and correlated with histopathological diagnoses. The observed results were then analysed using SPSS software. RESULTS: The most common primary CNS tumours were gliomas and meningiomas (28.3% each). The sensitivity, specificity, positive predictive value and negative predictive value for squash cytology were 86.67%, 87.5%, 81.25% and 91.3%, and for FS were 91.67%, 93.10%, 91.67%, 93.10%, respectively, with a corresponding comparative P-value of 0.56 (insignificant). Cytological diagnosis showed complete correlation with histopathological diagnosis in 39 cases (73.58%), partial correlation in eight cases (15.1%) and no correlation in six cases (11.32%). FS diagnosis showed complete correlation in 29 cases (74.35%), partial correlation in eight cases (20.5%) and no correlation in two cases (5.1%). CONCLUSION: Squash smear is a rapid, self-sufficient and cost-effective method for the intraoperative diagnosis of CNS tumours. The squash smear and FS techniques are complementary procedures that assist the pathologist in reaching a diagnosis.

Scoring system for intraoperative diagnosis of intracranial schwannoma by squash cytology.

OBJECTIVE: To assess the utility of a newly developed squash cytology (SC)-based scoring system for accurate intraoperative diagnosis of schwannoma. METHODS: We first compared SC-based and frozen section (FS) diagnoses with final pathological diagnoses of schwannoma (16 cases), meningioma (39 cases) and low-grade astrocytoma (16 cases). Then, by logistic regression modeling, we identified features of SC preparations that were independently predictive of schwannoma. To develop a diagnostic scoring system, we assigned one point to each feature, and performed receiver operating characteristic analysis to determine the score cut-off value that was most discriminatory for differentiating schwannoma from the other tumour types. We then compared accuracy, sensitivity, and specificity of diagnosis before and after the application of the scoring system. RESULTS: Overall diagnostic concordance rates for SC and FS were almost the same, at 73.2% (52/71) and 77.5% (55/71 cases), respectively. Of the 16 SC features entered into the analysis, the following nine were found to independently predict schwannoma, and were thus incorporated into the scoring system: smooth cluster margins, few or no isolated tumour cells, fibrillary stroma, spindle-shaped nuclei, parallel arrangement of stroma, parallel arrangement of nuclei, presence of anisonucleosis, absence of nucleoli, and hemosiderin deposition. A cut-off score of four items yielded the best sensitivity, specificity and predictive values for prediction of schwannoma. Use of the scoring system improved accuracy of intraoperative diagnosis from 80.3% to 94.4%, sensitivity from 56.2% to 93.8%, and specificity from 87.3% to 94.5%. CONCLUSION: Our proposed SC-based scoring system will increase accuracy of intraoperative diagnosis of schwannoma vs non-schwannoma tumours.

Temporal Dynamics and Severity of Cucurbit Downy Mildew Epidemics as Affected by Chemical Control and Cucurbit Host Type.

Cucurbit downy mildew caused by the oomycete Pseudoperonospora cubensis is an important disease that affects members of Cucurbitaceae family globally. However, temporal dynamics of the disease have not been characterized at the field scale to understand how control strategies influence disease epidemics. Disease severity was assessed visually on cucumber and summer squash treated with weekly alternation of chlorothalonil with cymoxanil, fluopicolide, or propamocarb during the 2018 spring season and 2019 and 2020 fall seasons in North Carolina and the 2018 and 2020 fall seasons in South Carolina. Disease onset was observed around mid-June during the spring season and early September during the fall season, followed by a rapid increase in severity until mid-July in the spring season and late September or mid-October in the fall season, typical of polycyclic epidemics. The Gompertz, logistic, and monomolecular growth models were fitted to disease severity using linear regression and parameter estimates to compare the effects of fungicide treatment and cucurbit host type on disease progress. The Gompertz and logistic models were more appropriate than the monomolecular model in describing temporal dynamics of cucurbit downy mildew, with the Gompertz model providing the best description for 34 of the 44 epidemics examined. Fungicide treatment and host type significantly (P < 0.0001) affected the standardized area under disease progress curve (sAUDPC), final disease severity (Final DS), and weighted mean absolute rates of disease progress (ρ), with these variables, in most cases, being significantly (P < 0.05) lower in fungicide-treated plots than in untreated control plots. Except in a few cases, sAUDPC, Final DS, and ρ were lower in cases where chlorothalonil was alternated with fluopicolide or propamocarb than in cases where chlorothalonil was alternated with cymoxanil or when chlorothalonil was applied alone. These results characterized the temporal progress of cucurbit downy mildew and provided an improved understanding of the dynamics of the disease at the field level. Parameters of disease progress obtained from this study could serve as inputs in simulation studies to assess the efficacy of fungicide alternation in managing fungicide resistance in this pathosystem.

First report of squash leaf curl China virus infecting tomato in China.

Squash leaf curl China virus (SLCCNV) is a species in the genus Begomovirus that possess a bipartite genome. It is transmitted by the whitefly species Bemisia tabaci and infects cucurbit crops in various parts of the Old World (Wu et al., 2020). In 2020, tomato plants with curled, distorted and yellow leaves were found in a greenhouse in Shouguang, Shandong Province, China (Fig. S1). Leaves with these symptoms were collected from 11 plants and the total RNA was extracted with TRIzol reagent (Invitrogen, USA). Five RNA extracts of the highest quality were combined and a small RNA library was generated by the company (BGI-Shenzhen, China). About 22,338,920 clean reads (18-28nt) were acquired and assembled into larger contigs with the software Velvet 1.0.5. These were further compared against nucleotide sequences in the National Center for Biotechnology Information (NCBI) databases with BLASTn searches. Not unexpectedly, there were many assembled contigs that had high identities (90%-100% identities) with known tomato-infecting viruses, including 241 contigs matching tomato chlorosis virus, 26 contigs matching southern tomato virus, and 4 contigs matching tomato yellow leaf curl virus. However, 12 contigs had high identities (90%-100%) with the genomic DNA-A of SLCCNV, while 9 other contigs had high identities (90%-100%) with the genomic DNA-B of SLCCNV. To verify the presence of SLCCNV in tomato plants, two sets of primer pairs were designed according to the specific contigs assembled from derived small interfering RNAs (vsiRNAs). The primer pairs A742-F/A742-R (5'-GTAATACGAGCATCCGCACGGTAG-3'/5'-CGTGGAGGGCGAC AAACAGCTAACG-3') and B539-F/B539-R (5'-GCTACTTTCAAGGACGAAGAAGAGG-3'/5'-CG ACATAGATTTCTGGTCGGTGGGC-3') directed the amplification of 742 bp and 539 bp for DNA-A and DNA-B fragments, respectively, from the total genomic DNA of the 11 tomato samples. The DNA-A and DNA-B of SLCCNV were both detected from all of the tomato samples. After sequencing, the 742 bp PCR products shared 100% nucleotide sequence identity with the DNA-A of SLCCNV isolate GDXW (MW389919), whereas the PCR-amplified 539 bp fragments shared 100% nucleotide sequence identity with the DNA-B of SLCCNV isolate GDXW (MW389920). The full-length of DNA-A and DNA-B components were amplified with back-to-back primers A-F/A-R (Wu et al., 2020) and B-F/B-R (5'-GATAAACACGTCTCATTGCACCGC-3'/5'-GAGACGTGTTTATCAATATGGA CG-3'), respectively. The amplified fragments were further cloned into the PCE2TA/Blunt-Zero vector (Vazyme Biotech Co., China). After sequencing, the complete sequence of DNA-A was 2736 nt in length (MZ682117), while the DNA-B was 2718 nt in length (OK236348). The phylogenetic relationships of the DNA-A and DNA-B components were determined using MEGA 7 based on the full-length sequences of DNA-A and DNA-B, respectively (Kumar et al., 2016). Results showed that the DNA-A formed an independent cluster and was mostly related to the GDHY (MW389917) in the phylogenetic tree constructed using the neighbor-joining (NJ) method, while the DNA-B formed an independent cluster and was mostly related to the SLCCNV isolate BLDG (MW389928) and isolate GDBL (MW389922) (Fig. S2). The nt identities of DNA-A were also calculated with SDT v1.2 by comparison with other begomovirus sequences from the initial BLASTn analysis (Muhire et al., 2014), showing that the virus shared 99.4% sequence identity with SLCCNV isolate GDHY (MW389917). According to the current demarcation threshold for begomoviruses, recommended by the International Committee on Taxonomy of Viruses (ICTV) (91% nt identity) (Brown et al., 2015), this virus identified from tomato is a distinct strain of SLCCNV, designated SLCCNV-SDSG. To the best of our knowledge, this is the first report of a natural infection of SLCCNV on tomato in China. SLCCNV has caused serious problems in cucurbit production in some areas, so it will be important to investigate if tomato plays a role in the disease biology by serving as a reservoir host. The author(s) declare no conflict of interest. Funding: The funding for this research was supported by the Beijing Academy of Agriculture and Forestry Foundation, China (QNJJ202131, QNJJ201915, KJCX20200113). References: Brown et al. 2015. Arch Virol 160: 1593-1619 Kumar et al. 2016. Mol Biol Evol, 33: 1870-1874 Muhire et al. 2014. Plos One, 9 Wu et al. 2020. J Integr Agr, 19: 570-577.