RESUMO
Viruses pose a great threat to animal and plant health worldwide, with many being dependent on insect vectors for transmission between hosts. While the virus-host arms race has been well established, how viruses and insect vectors adapt to each other remains poorly understood. Begomoviruses comprise the largest genus of plant-infecting DNA viruses and are exclusively transmitted by the whitefly Bemisia tabaci. Here, we show that the vector Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway plays an important role in mediating the adaptation between the begomovirus tomato yellow leaf curl virus (TYLCV) and whiteflies. We found that the JAK/STAT pathway in B. tabaci functions as an antiviral mechanism against TYLCV infection in whiteflies as evidenced by the increase in viral DNA and coat protein (CP) levels after inhibiting JAK/STAT signaling. Two STAT-activated effector genes, BtCD109-2 and BtCD109-3, mediate this anti-TYLCV activity. To counteract this vector immunity, TYLCV has evolved strategies that impair the whitefly JAK/STAT pathway. Infection of TYLCV is associated with a reduction of JAK/STAT pathway activity in whiteflies. Moreover, TYLCV CP binds to STAT and blocks its nuclear translocation, thus, abrogating the STAT-dependent transactivation of target genes. We further show that inhibition of the whitefly JAK/STAT pathway facilitates TYLCV transmission but reduces whitefly survival and fecundity, indicating that this JAK/STAT-dependent TYLCV-whitefly interaction plays an important role in keeping a balance between whitefly fitness and TYLCV transmission. This study reveals a mechanism of plant virus-insect vector coadaptation in relation to vector survival and virus transmission.
Assuntos
Begomovirus , Hemípteros , Vírus de Plantas , Solanum lycopersicum , Animais , Antivirais , Begomovirus/genética , DNA Viral , Hemípteros/fisiologia , Janus Quinases/genética , Solanum lycopersicum/genética , Doenças das Plantas , Vírus de Plantas/genética , Fatores de Transcrição STAT/genética , Transdução de SinaisRESUMO
Insect vector-virus-plant interactions have important ecological and evolutionary implications. The constant struggle of plants against viruses and insect vectors has driven the evolution of multiple defense strategies in the host as well as counter-defense strategies in the viruses and insect vectors. Cotton leaf curl Multan virus (CLCuMuV) is a major causal agent of cotton leaf curl disease in Asia and is exclusively transmitted by the whitefly Bemisia tabaci. Here, we report that plants infected with CLCuMuV and its betasatellite CLCuMuB enhance the performance of the B. tabaci vector, and ßC1 encoded by CLCuMuB plays an important role in begomovirus-whitefly-tobacco tripartite interactions. We showed that CLCuMuB ßC1 suppresses the jasmonic acid signaling pathway by interacting with the subtilisin-like protease 1.7 (NtSBT1.7) protein, thereby enhancing whitefly performance on tobacco plants. Further studies revealed that in wild-type plants, NtSBT1.7 could process tobacco preprohydroxyproline-rich systemin B (NtpreproHypSysB). After CLCuMuB infection, CLCuMuB ßC1 could interfere with the processing of NtpreproHypSysB by NtSBT1.7, thereby impairing plant defenses against whitefly. These results contribute to our understanding of tripartite interactions among virus, plant, and whitefly, thus offering ecological insights into the spread of vector insect populations and the prevalence of viral diseases.
Assuntos
Begomovirus , Hemípteros , Insetos Vetores , Nicotiana , Doenças das Plantas , Animais , Hemípteros/virologia , Hemípteros/fisiologia , Nicotiana/virologia , Begomovirus/fisiologia , Insetos Vetores/virologia , Insetos Vetores/fisiologia , Doenças das Plantas/virologia , Proteínas de Plantas/metabolismo , Proteínas de Plantas/genéticaRESUMO
Terpenes play a vital role in plant defense; tomato plants produce a diverse range of terpenes within specialized glandular trichomes, influencing interactions with herbivores, predators, and pollinators. This study employed two distinct methods, namely leaf dip and maceration, to extract trichomes from tomato leaves. Terpene quantification was carried out using Gas Chromatography-Mass Spectrometry (GC-MS). The leaf dip method proved effective in selectively targeting trichome content, revealing unique extraction patterns compared to maceration. The GC-MS method demonstrated high linearity, accuracy, sensitivity, and low limits of detection and quantification. Application of the method to different tomato species (Solanum pennellii, Solanum pimpinellifolium, Solanum galapagense, Solanum habrochaites, and Solanum lycopersicum) identified significant variation in terpene content among these species, highlighting the potential of specific accessions for breeding programs. Notably, the terpene α-zingiberene, known for its repellency against whiteflies, was found in high quantities (211.90-9155.13 µg g-1) in Solanum habrochaites accession PI209978. These findings provide valuable insights into terpenoid diversity for plant defense mechanisms, guiding future research on developing pest-resistant tomato cultivars. Additionally, the study underscores the broader applications of terpenes in agriculture.
Assuntos
Solanum lycopersicum , Solanum , Terpenos/análise , Cromatografia Gasosa-Espectrometria de Massas , Extratos VegetaisRESUMO
Multiple species within the order Hemiptera cause severe agricultural losses on a global scale. Aphids and whiteflies are of particular importance due to their role as vectors for hundreds of plant viruses, many of which enter the insect via the gut. To facilitate the identification of novel targets for disruption of plant virus transmission, we compared the relative abundance and composition of the gut plasma membrane proteomes of adult Bemisia tabaci (Hemiptera: Aleyrodidae) and Myzus persicae (Hemiptera: Aphididae), representing the first study comparing the gut plasma membrane proteomes of two different insect species. Brush border membrane vesicles were prepared from dissected guts, and proteins extracted, identified and quantified from triplicate samples via timsTOF mass spectrometry. A total of 1699 B. tabaci and 1175 M. persicae proteins were identified. Following bioinformatics analysis and manual curation, 151 B. tabaci and 115 M. persicae proteins were predicted to localize to the plasma membrane of the gut microvilli. These proteins were further categorized based on molecular function and biological process according to Gene Ontology terms. The most abundant gut plasma membrane proteins were identified. The ten plasma membrane proteins that differed in abundance between the two insect species were associated with the terms "protein binding" and "viral processes." In addition to providing insight into the gut physiology of hemipteran insects, these gut plasma membrane proteomes provide context for appropriate identification of plant virus receptors based on a combination of bioinformatic prediction and protein localization on the surface of the insect gut.
Assuntos
Afídeos , Trato Gastrointestinal , Proteínas de Insetos , Insetos Vetores , Vírus de Plantas , Animais , Proteínas de Insetos/metabolismo , Insetos Vetores/virologia , Insetos Vetores/metabolismo , Afídeos/virologia , Afídeos/metabolismo , Trato Gastrointestinal/virologia , Trato Gastrointestinal/metabolismo , Proteínas de Membrana/metabolismo , Hemípteros/virologia , Hemípteros/metabolismo , Proteoma , Membrana Celular/metabolismoRESUMO
DNA methylation is an epigenetic process that involves the chemical modification of DNA, leading to the regulation of its transcriptional activity. It is primarily known for the addition of methyl groups to cytosine in DNA. The whitefly Bemisia tabaci is a polyphagous pest insect and a vector that is responsible for transmitting numerous plant viruses, resulting in significant economic losses in agricultural crops globally. In our study, we characterized the expression of two key DNA methylation genes, the DNA methyltransferases Dnmt1 and Dnmt3, in B. tabaci. Additionally, we explored the impact of inhibiting DNMTs on the miRNA pathway and fitness of whitefly. To investigate the role of the DNA methylation pathway in B. tabaci, we found that the expression of Dnmt1 and Dnmt3 varied across different tissues and developmental stages of B. tabaci. We employed azacytidine (5-AZA) treatment of adults to inhibit DNMTs (DNMT1 and DNMT3). Administration of 5-AZA affected the survival and reproduction of this pest. Moreover, inhibition of DNMTs led to a decrease in the expression of the miRNA pathway core genes Dicer1 and Argonaute1, which subsequently resulted in reduced expression of Let-7 and miR-184 which are essential microRNAs in the physiology and biology of insects. The study suggests that DNA methyltransferases could be targeted for developing an inhibition strategy to control this pest and vector insect.
Assuntos
Metilação de DNA , Hemípteros , MicroRNAs , Animais , Hemípteros/genética , MicroRNAs/genética , MicroRNAs/metabolismo , Azacitidina/farmacologia , DNA (Citosina-5-)-Metiltransferases/metabolismo , DNA (Citosina-5-)-Metiltransferases/genética , Proteínas de Insetos/metabolismo , Proteínas de Insetos/genética , FemininoRESUMO
Chemical signals play a central role in mediating insect feeding and reproductive behavior, and serve as the primary drivers of the insect-plant interactions. The detection of chemical signals, particularly host plant volatiles, relies heavily on the insect's complex olfactory system. The Bemisia tabaci cryptic species complex is a group of globally important whitefly pests of agricultural and ornamental crops that have a wide range of host plants, but the molecular mechanism of their host plant recognition is not yet clear. In this study, the odorant coreceptor gene of the Whitefly MEAM1 cryptic species (BtOrco) was cloned. The coding sequence of BtOrco was 1413 bp in length, with seven transmembrane structural domains, and it was expressed primarily in the heads of both male and female adult whiteflies, rather than in other tissues. Knockdown of BtOrco using transgenic plant-mediated RNAi technology significantly inhibited the foraging behavior of whiteflies. This inhibition was manifested as a reduced percentage of whiteflies responding to the host plant and a prolonged foraging period. Moreover, there was a substantial suppression of egg-laying activity among adult female whiteflies. These results indicate that BtOrco has the potential to be used as a target for the design of novel active compounds for the development of environmentally friendly whitefly control strategies.
Assuntos
Hemípteros , Animais , Feminino , Hemípteros/genética , Oviposição , Plantas Geneticamente Modificadas , Interferência de RNARESUMO
Sida golden mosaic virus (SiGMV), an obligate pathogen that infects snap beans (Phaseolus vulgaris), is known to infect prickly sida (Sida spinosa L.), which is a common weed in agricultural farms in Georgia. Prickly sida has also been reported as a suitable host of sweetpotato whitefly (Bemisia tabaci), the vector of SiGMV. Despite being a host for both SiGMV and its vector, the role of prickly sida as a reservoir and inoculum source for SiGMV in snap bean farms has not been evaluated. This study was conducted to document the occurrence of SiGMV-infected prickly sida plants and to assess its potential role as a source of SiGMV inoculum in snap bean farms. A survey of 17 commercial snap bean farms conducted in spring 2021 confirmed the presence of SiGMV-infected prickly sida in southern Georgia. In fall 2021 and 2022, on-farm field trials were conducted in four commercial farms where SiGMV-infected prickly sida plants were documented earlier as a part of survey in spring 2021. The spatial distribution and temporal patterns of adult whiteflies and SiGMV on snap bean were compared between macroplots (13.7 × 30.5 m) "with prickly sida" or "without prickly sida" that were at least 232 m apart from each other. We did not observe any consistent differences in counts of adult whiteflies between macroplots with or without prickly sida in the four commercial farms. SiGMV infection was detected earlier and with higher incidences in snap bean macroplots "with prickly sida" compared with macroplots "without prickly sida." An apparent disease gradient was observed in two of the four farms assessed. Higher SiGMV incidences were observed on the edges of macroplots "with prickly sida." These findings indicate prickly sida as a potential natural reservoir and a source for SiGMV spread in snap bean farms in southern Georgia.
Assuntos
Hemípteros , Phaseolus , Doenças das Plantas , Georgia , Doenças das Plantas/virologia , Animais , Phaseolus/virologia , Hemípteros/virologia , Fazendas , Insetos Vetores/virologiaRESUMO
Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.
RESUMO
Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.
RESUMO
The traditional understanding of begomovirus transmission exclusively through the whitefly Bemisia tabaci (Gennadius) has shifted with findings of seed transmission in some begomoviruses over the last decade. We investigated the seed transmissibility of cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus that has recently emerged as a severe constraint for yellow squash (Cucurbita pepo L.) production in the southeastern United States. We found high concentration of CuLCrV in male and female flower tissues of infected squash, including pollen and ovules. The virus infiltrated the fruit tissues including the endocarp and funiculus, which are anatomically positioned adjacent to the seeds. In seeds, CuLCrV was detected in the endosperm and embryo where there are no vascular connections, in addition to the seed coat. The virus was detected in the radicle, plumule, cotyledonary leaves, and true leaves of seedlings grown from seeds collected from infected fruits. In the grow-out test conducted, CuLCrV infections ranged from 17-56% of the progeny plants. To ensure that partial viral genome fragments were not being mistaken for replicative forms of the virus, we performed RCA ̶ PCR and amplified complete DNA-A and DNA-B of CuLCrV from seed tissues, seedlings, progeny plants of CuLCrV infected squash. Near complete DNA-A and DNA-B sequences of CuLCrV were recovered from a progeny plant, further validating our findings. Our results demonstrate that CuLCrV can translocate from vegetative to reproductive tissues of yellow squash, persist within the seeds, and subsequently induce infection in progeny plants, confirming its capacity for seed transmission.
RESUMO
Tomato yellow leaf curl virus (TYLCV) is a begomovirus (genus Begomovirus, family Geminiviridae) transmitted persistently by the whitefly Bemisia tabaci. It causes tomato yellow leaf curl disease (TYLCD), resulting in significant yield losses worldwide. TYLCD is controlled mainly by using F1 hybrid tomato cultivars harboring the TYLCV resistance gene Ty-1. However, infected Ty-1-bearing tomato plants accumulate viral DNA, which may eventually lead to the emergence of a resistance-breaking TYLCV variant. Recently, a B. tabaci-resistant tomato line derived from the introgression of type IV leaf glandular trichomes and acylsucrose secretion from wild tomato (Solanum pimpinellifolium) was shown to effectively control the spread of TYLCV. In this study, we combined B. tabaci resistance and Ty-1-based TYLCV resistance to increase the robustness and durability of the TYLCD resistance mediated by Ty-1 in tomato plants. Specifically, we characterized and used a Group 2-like isolate of the Israel strain of TYLCV (TYLCV-IL-G2) that contributes to TYLCD epidemics in southeastern Spain. A comparison with isolates of the previously identified TYLCV variant revealed TYLCV-IL-G2 has a similar host range, but it induces a slightly more severe TYLCD in Ty-1-bearing tomato plants. Moreover, we demonstrated that acylsucrose-producing B. tabaci-resistant tomato plants can limit the spread of TYLCV-IL-G2 better than a near-isogenic line lacking type IV trichomes and unable to secrete acylsucrose. Pyramiding Ty-1-based TYLCV resistance and B. tabaci resistance provided by type IV glandular trichomes helped to decrease the effects of TYLCV on Ty-1-bearing tomato plants as well as the likelihood of TYLCV evolution in infected plants.
RESUMO
A mandatory tomato-free period (TFP) was implemented in the state of Goiás, Brazil, in 2007 to help manage diseases caused by whitefly-transmitted begomoviruses. The impact of the TFP was examined in five locations across three states in Central Brazil from 2013 to 2016. Surveys revealed significant differences in begomovirus disease incidence among locations, i.e., low in Guaíra-TFP and Patos de Minas-TFP; moderate-high in Itaberaí-TFP and Morrinhos-TFP; and high in the non-TFP (NTFP) control, Cristalina-NTFP. PCR tests and DNA sequencing were used to validate the symptoms and showed that all collected symptomatic plant samples were infected with tomato severe rugose virus (ToSRV), a common indigenous bipartite begomovirus. Early season surveys (20 to 40 days after transplants [DAT]) in Itaberaí-TFP and Morrinhos-TFP revealed significantly less begomovirus disease in fields established sooner after the TFP (0 to 2 months) compared with incidences in (i) equivalent early planted fields in the Cristalina-NTFP control and (ii) fields established longer after the end of the TFP (>2 to 5 months). Whitefly infestation of crops was detected year-round in all locations and years, and all tested adults were classified in the Bemisia tabaci MEAM1 cryptic species. Infestation levels were significantly higher during the summer but did not vary significantly among locations. Results of monthly monitoring of adult whiteflies for general begomovirus and ToSRV were positively correlated and were indicators of disease incidence in the field. Notably, ToSRV was not detected in whiteflies collected from nontomato plants during the TFP, and there was a longer lag period before detection in whiteflies collected from processing tomatoes for Itaberaí-TFP and Morrinhos-TFP compared with Cristalina-NTFP. Taken together with the low levels of ToSRV infection detected in potential nontomato reservoir hosts at all locations, our results revealed low levels of primary inoculum during the TFP. Thus, even in a complex agroecosystem with year-round whitefly infestation of crops, the TFP was beneficial due to delayed and reduced begomovirus disease pressure during a critical stage of plant development (first month) and for favoring low levels of primary inoculum. Thus, we concluded that the TFP should be part of a regional integrated pest management (IPM) program targeting ToSRV in Brazil.
RESUMO
The Middle East Asia Minor 1 biotype of Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) is a greenhouse and field crop pest of global significance. The objective of this study was to assess the potential of the generalist predatory thrips, Franklinothrips vespiformis Crawford (Thysanoptera: Aeolothripidae), as a biological control agent for B. tabaci. This was achieved by determining the functional responses of F. vespiformis larvae and adults to the egg and nymphal stages of B. tabaci under laboratory conditions. Analyses consisted of 10 replicates of each predator and prey stage combination on bean leaf discs for a 24-h period. Following logistic regression analyses to determine the functional response type exhibited, response parameters were estimated with nonlinear least squares regression using Roger's equation. Results showed that F. vespiformis larvae and adults exhibited a Type II functional response when feeding on immature B. tabaci. The handling times (Th) of F. vespiformis larvae and adults were magnitudes higher for B. tabaci nymphs than they were for eggs, which were in part driven by the higher attack rates (a) observed on eggs. The maximum attack rate (T/Th) for B. tabaci eggs and nymphs exhibited by first-stage larvae, second-stage larvae, and adult F. vespiformis increased with increasing predator age. Results from this study suggest that F. vespiformis larvae and particularly adults are promising biological control agents for B. tabaci and are efficient predators at both low and high prey densities.
Assuntos
Hemípteros , Tisanópteros , Animais , Óvulo , Ásia Oriental , Agentes de Controle Biológico , Larva , NinfaRESUMO
BACKGROUND: Whiteflies are a global threat to crop yields, including the African subsistence crop cassava (Manihot esculenta). Outbreaks of superabundant whitefly populations throughout Eastern and Central Africa in recent years have dramatically increased the pressures of whitefly feeding and virus transmission on cassava. Whitefly-transmitted viral diseases threaten the food security of hundreds of millions of African farmers, highlighting the need for developing and deploying whitefly-resistant cassava. However, plant resistance to whiteflies remains largely poorly characterized at the genetic and molecular levels. Knowledge of cassava-defense programs also remains incomplete, limiting characterization of whitefly-resistance mechanisms. To better understand the genetic basis of whitefly resistance in cassava, we define the defense hormone- and Aleurotrachelus socialis (whitefly)-responsive transcriptome of whitefly-susceptible (COL2246) and whitefly-resistant (ECU72) cassava using RNA-seq. For broader comparison, hormone-responsive transcriptomes of Arabidopsis thaliana were also generated. RESULTS: Whitefly infestation, salicylic acid (SA), jasmonic acid (JA), ethylene (ET), and abscisic acid (ABA) transcriptome responses of ECU72 and COL2246 were defined and analyzed. Strikingly, SA responses were largely reciprocal between the two cassava genotypes and we suggest candidate regulators. While susceptibility was associated with SA in COL2246, resistance to whitefly in ECU72 was associated with ABA, with SA-ABA antagonism observed. This was evidenced by expression of genes within the SA and ABA pathways and hormone levels during A. socialis infestation. Gene-enrichment analyses of whitefly- and hormone-responsive genes suggest the importance of fast-acting cell wall defenses (e.g., elicitor recognition, lignin biosynthesis) during early infestation stages in whitefly-resistant ECU72. A surge of ineffective immune and SA responses characterized the whitefly-susceptible COL2246's response to late-stage nymphs. Lastly, in comparison with the model plant Arabidopsis, cassava's hormone-responsive genes showed striking divergence in expression. CONCLUSIONS: This study provides the first characterization of cassava's global transcriptome responses to whitefly infestation and defense hormone treatment. Our analyses of ECU72 and COL2246 uncovered possible whitefly resistance/susceptibility mechanisms in cassava. Comparative analysis of cassava and Arabidopsis demonstrated that defense programs in Arabidopsis may not always mirror those in crop species. More broadly, our hormone-responsive transcriptomes will also provide a baseline for the cassava community to better understand global responses to other yield-limiting pests/pathogens.
Assuntos
Arabidopsis , Hemípteros , Manihot , Animais , Ácido Abscísico , Manihot/genética , Manihot/metabolismo , Lignina , Arabidopsis/genética , Hemípteros/fisiologia , Perfilação da Expressão Gênica , Verduras/genética , Verduras/metabolismo , Hormônios , Ácido Salicílico/metabolismo , Doenças das Plantas/genéticaRESUMO
RNA interference (RNAi)-based technologies are starting to be commercialized as a new approach for agricultural pest control. Horizontally transferred genes (HTGs), which have been transferred into insect genomes from viruses, bacteria, fungi or plants, are attractive targets for RNAi-mediated pest control. HTGs are often unique to a specific insect family or even genus, making it unlikely that RNAi constructs targeting such genes will have negative effects on ladybugs, lacewings and other beneficial predatory insect species. In this study, we sequenced the genome of a red, tobacco-adapted isolate of Myzus persicae (green peach aphid) and bioinformatically identified 30 HTGs. We then used plant-mediated virus-induced gene silencing (VIGS) to show that several HTGs of bacterial and plant origin are important for aphid growth and/or survival. Silencing the expression of fungal-origin HTGs did not affect aphid survivorship but decreased aphid reproduction. Importantly, although there was uptake of plant-expressed RNA by Coccinella septempunctata (seven-spotted ladybugs) via the aphids that they consumed, we did not observe negative effects on ladybugs from aphid-targeted VIGS constructs. To demonstrate that this approach is more broadly applicable, we also targeted five Bemisia tabaci (whitefly) HTGs using VIGS and demonstrated that knockdown of some of these genes affected whitefly survival. As functional HTGs have been identified in the genomes of numerous pest species, we propose that these HTGs should be explored further as efficient and safe targets for control of insect pests using plant-mediated RNA interference.
Assuntos
Afídeos , Animais , Afídeos/genética , Interferência de RNA , Plantas Geneticamente Modificadas/genética , Sequência de Bases , Nicotiana/genéticaRESUMO
Begomoviruses are a group of ssDNA viruses exclusively transmitted by the whitefly Bemisia tabaci and constrain vegetable production in the old and new worlds. Although multiple molecular determinants governing the transmission of begomoviruses by whiteflies have been unravelled, factors critical for transmission majorly remain unknown. In this study, a whitefly C2H2 zinc finger (ZF) protein, 100% identical to the vascular endothelial ZF-like gene (vezf) protein was confirmed to interact with the CP of both old- and new-world begomoviruses. This was achieved by a yeast two-hybrid (Y2H) system screening of a whitefly cDNA library using capsid protein (CP) of TYLCV as a bait. In silico annotation of vezf protein revealed that it contains a N-terminal ZF-associated domain (ZAD) alongside multiple C2H2 ZF domains on the C-terminal end. ZAD-ZF proteins form the most abundant class of transcription factors within insects. Herein, we validated the interaction of vezf with four diverse begomoviruses and its functional role in begomovirus transmission. Silencing of the vezf gene of B. tabaci led to increased retention of three diverse begomoviruses tested. Vezf is the first insect transcription factor identified to interact with plant viruses and can be crucial to understand the possible mechanisms by which plant viruses modulate transcription of their insect vectors during transmission.
Assuntos
Begomovirus , Dedos de Zinco CYS2-HIS2 , Hemípteros , Animais , Begomovirus/genética , Begomovirus/metabolismo , Proteínas do Capsídeo/genética , Proteínas do Capsídeo/metabolismo , Hemípteros/genética , Hemípteros/metabolismo , Fatores de Transcrição/genética , Fatores de Transcrição/metabolismo , Doenças das PlantasRESUMO
In Brazil, the main viral disease of melon plant is severe yellowing disease called "Amarelão do Meloeiro," and a polerovirus, cucurbit aphid-borne yellows virus (CABYV) was considered one of the etiological agents. This virus is a recombinant strain originated from CABYV and unknown polerovirus. Due to unsuccessful mechanical inoculations of CABYV to host plants, the study of its biological characterization is hampered. Therefore, an infectious clone of the recombinant strain of CABYV was constructed using the Gibson Assembly technology. The full-length cDNA clones produced in this study showed to be infectious in three cucurbit species; melon (Cucumis melo), squash (a hybrid of Cucurbita maxima × C. moschata), and West Indian gherkin (Cucumis anguria) plants, but not in watermelon, cucumber, and zucchini plants. This insusceptibility of watermelon plants to the infectious clone corroborates the observation that this virus was never found in watermelon plants often located next to the infected melon plants. This infectious clone provides important tools for future study in developing resistant melon variety to CABYV infection.
Assuntos
Cucurbita , Cucurbitaceae , Luteoviridae , DNA Complementar/genética , Brasil , Luteoviridae/genética , Cucurbitaceae/genética , Cucurbita/genética , PlantasRESUMO
Plant-herbivore interactions have been extensively studied in tomato plants and their most common pests. Tomato plant chemical defenses, both constitutive and inducible, play a role in mediating these interactions. Damaged tomato plants alter their volatile profiles, affecting herbivore preferences between undamaged and damaged plants. However, previous studies on tomato volatiles and herbivore preferences have yielded conflicting results, both in the volatile chemistry itself as well as in the attraction/repellent herbivore response. This study revisits the volatile-mediated interactions between tomato plants and two of their main herbivores: the leafminer Tuta absoluta and the whitefly Trialeurodes vaporariorum. Tomato plant volatiles were analyzed before and after damage by each of these herbivores, and the preference for oviposition (T. absoluta) and settling (T. vaporariorum) on undamaged and damaged plants was assessed both after conspecific and heterospecific damage. We found that both insects consistently preferred damaged plants over undamaged plants. The emission of herbivore-induced plant volatiles (HIPVs) increased after T. absoluta damage but decreased after T. vaporariorum damage. While some of our findings are in line with previous reports, T. absoluta preferred to oviposit on plants damaged by conspecifics, which differs from earlier studies. A comparison of HIPVs emitted after damage by T. absoluta and T. vaporariorum revealed differences in up- or down-regulation, as well as significant variations in specific compounds (12 for T. absoluta and 26 for T. vaporariorum damaged-plants). Only two compounds, ß-caryophyllene and tetradecane, significantly varied because of damage by either herbivore, in line with the overall variation of the HIPV blend. Differences in HIPVs and herbivore preferences may be attributed to the distinct feeding habits of both herbivores, which activate different defensive pathways in plants. The plant's challenge in simultaneously activating both defensive pathways may explain the preference for heterospecific damaged plants found in this study, which are also in line with our own observations in greenhouses.
Assuntos
Hemípteros , Lepidópteros , Solanum lycopersicum , Compostos Orgânicos Voláteis , Animais , Feminino , Compostos Orgânicos Voláteis/química , Lepidópteros/fisiologia , Hemípteros/fisiologia , Insetos/fisiologia , Plantas/metabolismo , HerbivoriaRESUMO
Begomoviruses are economically important plant viruses and are transmitted by Bemisia tabaci which is a complex of various cryptic species. However, it is uncertain whether most begomoviruses that infect host plants are transmitted by B. tabaci at a similar rate. We compared the begomovirus profiles that were detected in a total of 37 whitefly populations and 52 host plants on Java Island, Indonesia. Seven begomovirus species were detected in B. tabaci at different rates: pepper yellow leaf curl Indonesia virus (PepYLCIV, 56.8%), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV, 46.0%), tomato leaf curl New Delhi virus (ToLCNDV, 21.6%), squash leaf curl China virus (SLCCNV, 21.6%), ageratum yellow vein China virus (AYVCNV, 2.7%), mungbean yellow mosaic India virus (MYMIV, 2.7%), and okra enation leaf curl virus (OELCuV, 2.7%). The begomoviruses were detected at different rates in three cryptic species of B. tabaci. In addition, six begomovirus species were detected in the various host plants at different rates: PepYLCIV (67.3%), TYLCKaV (53.9%), ToLCNDV (13.5%), MYMIV (11.5%), AYVCNV (3.9%), and Tomato yellow leaf curl Thailand virus (TYLCTHV) (1.9%). By comparing the virus presence between whiteflies and plants, five begomoviruses (AYVCNV, MYMIV, PepYLCIV, ToLCNDV, and TYLCKaV) were detected in both samples, but their sequence similarity was highly variable depending on the begomovirus themselves; TYLCKaV was highest (99.4%-100%) than any other viruses. Our study suggests B. tabaci acquire begomoviruses at different rates from plants. This study provides important information on the potential variation in the begomovirus transmission mechanism.
Assuntos
Begomovirus , Hemípteros , Animais , Indonésia , Doenças das Plantas , Tailândia , Insetos VetoresRESUMO
Bemisia tabaci is a species complex consisting of various genetically different cryptic species worldwide. To understand the genetic characteristics and geographic distribution of cryptic species of B. tabaci in Asia, we conducted an extensive collection of B. tabaci samples in ten Asian countries (Bangladesh, Indonesia, Japan, Korea, Myanmar, Nepal, Philippines, Singapore, Taiwan, and Vietnam) from 2013 to 2020 and determined 56 different partial sequences of mitochondrial cytochrome oxidase subunit I (COI) DNA. In addition, information on 129 COI sequences of B. tabaci identified from 16 Asian countries was downloaded from the GenBank database. Among the total 185 COI sequences of B. tabaci, the sequence variation reached to 19.68%. In addition, there were 31 cryptic species updated from 16 countries in Asia, that is, Asia I, Asia I India, Asia II (1-13), Asia III, Asia IV, Asia V, China 1-6, MEAM (1, 2, K), MED, Australia/Indonesia, Japan (1 and 2). Further, MED cryptic species consisted of 2 clades, Q1 and Q2. This study provides updated information to understand the genetic variation and geographic diversity of B. tabaci in Asia.