Your browser doesn't support javascript.
loading
Frequency of the cystic fibrosis delta F 508 mutation in a population from S ao Paulo State, Brazil
Braz. j. med. biol. res ; 26(10): 1037-40, Oct. 1993. ilus, tab
Article en En | LILACS | ID: lil-148779
Biblioteca responsable: BR1.1
ABSTRACT
Cystic fibrosis (CF) nonrelated patients (N = 24) from S ao Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33 per cent (15/48 chromosomes). The genotype distribution among the patients showed 12.5 per cent (N = 3) of delta F 508 homozygotes, 37.5 per cent (N = 9) of delta F heterozygotes and 50 per cent (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75 per cent to 80 per cent ) and is similar to that described in Southern Europe (25 per cent to 50 per cent ) which is consistent with the origins of this population
Asunto(s)
Buscar en Google
Colección: 01-internacional Banco de datos: LILACS Asunto principal: Fibrosis Quística / Frecuencia de los Genes / Mutación Límite: Humans País/Región como asunto: America do sul / Brasil Idioma: En Revista: Braz. j. med. biol. res Asunto de la revista: BIOLOGIA / MEDICINA Año: 1993 Tipo del documento: Article
Buscar en Google
Colección: 01-internacional Banco de datos: LILACS Asunto principal: Fibrosis Quística / Frecuencia de los Genes / Mutación Límite: Humans País/Región como asunto: America do sul / Brasil Idioma: En Revista: Braz. j. med. biol. res Asunto de la revista: BIOLOGIA / MEDICINA Año: 1993 Tipo del documento: Article