Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.

ABSTRACT

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.