Activated T cells enhance interferon-α production by plasmacytoid dendritic cells stimulated with RNA-containing immune complexes.

OBJECTIVES: Patients with systemic lupus erythematosus (SLE) have an ongoing interferon-α (IFN-α) production by plasmacytoid dendritic cells (pDCs). We investigated whether T cells can promote IFN-α production by pDCs. METHODS: Human pDCs were stimulated with immune complexes (ICs) containing U1 small nuclear ribonucleic proteins particles and SLE-IgG (RNA-IC) in the presence of T cells or T cell supernatants. T cells were activated by anti-CD3/CD28 antibodies or in a mixed leucocyte reaction. IFN-α and other cytokines were determined in culture supernatants or patient sera with immunoassays. The effect of interleukin (IL) 3 and granulocyte-macrophage-colony-stimulating factor (GM-CSF) on pDCs was examined by the use of antibodies, and the expression of CD80/CD86 was determined using flow cytometry. RESULTS: Activated T cells and supernatants from activated T cells increased IFN-α production by >20-fold. The stimulatory effect of T cell supernatants was reduced after depletion of GM-CSF (81%) or by blocking the GM-CSF receptor (55%-81%). Supernatant from activated T cells, furthermore, increased the frequency of CD80 and CD86 expressing pDCs stimulated with RNA-IC from 6% to 35% (p<0.05) and from 10% to 26% (p<0.01), respectively. Activated SLE T cells enhanced IFN-α production to the same extent as T cells from healthy individuals and a subset of patients with SLE had increased serum levels of GM-CSF. CONCLUSIONS: Activated T cells enhance IFN-α production by RNA-IC stimulated pDCs via GM-CSF and induce pDC maturation. Given the increased serum levels of GM-CSF in a subset of patients with SLE, these findings suggest that activated T cells may upregulate type I IFN production in SLE.

The type I interferon system in the development of lupus.

The type I interferon (IFN) system induces inhibition of viral replication, but can also activate the innate and adaptive immune system. An important role of the type I IFN system in autoimmune diseases, including lupus, is suggested by the observation that these disorders display a prominent over-expression of type I IFN regulated genes. The development of autoimmune diseases in some individuals treated with IFN-α directly supports a pivotal role for this cytokine in breaking tolerance and inducing autoimmune reactions. A genetic setup that promotes type I IFN production and/or response and the presence of endogenous inducers of IFN-α production have been described in patients with lupus. Several known environmental risk factors for development of lupus or disease flares may contribute to the ongoing type I IFN production. In the present review we will describe the possible role of the type I IFN system in the lupus disease process. The possible connection between the type I IFN system and some environmental and genetic risk factors for lupus is also discussed.

B lymphocytes enhance interferon-α production by plasmacytoid dendritic cells.

OBJECTIVE: The type I interferon (IFN) system and B cells are activated in many autoimmune diseases, such as systemic lupus erythematosus (SLE). The IFNα produced by plasmacytoid dendritic cells (PDCs) stimulates several B cell functions, including autoantibody production. However, not much is known about how B cells influence PDC function. The aim of this study was to investigate the regulatory effect of B cells on IFNα production by PDCs. METHODS: PDCs and B cells isolated from peripheral blood mononuclear cells from healthy blood donors were stimulated with RNA-containing immune complexes (ICs) consisting of U1 small nuclear RNP and SLE IgG, herpes simplex virus, or oligonucleotide (ODN) 2216, alone or in cocultures. IFNα, several other cytokines, and PDC- or B cell-associated surface molecules were analyzed using immunoassays or flow cytometry. RESULTS: B cells enhanced IFNα production by PDCs up to 47-fold, and the effect was most pronounced for PDCs stimulated with RNA-containing ICs. Anti-CD31 antibody reduced RNA-containing IC-induced IFNα production by 80% but had no effect on IFNα production when ODN 2216 was used as an inducer. Supernatants from ODN 2216-stimulated B cells promoted IFNα production by PDCs, while supernatants from RNA-containing IC-stimulated B cells did not. CONCLUSION: Our results showed that a novel function of B cells is enhancement of type I IFN production by PDCs. Because B cells are activated by type I IFN, this PDC-B cell cross-talk might be of fundamental importance in the etiopathogenesis of SLE and contribute to long-term immune activation in SLE and other systemic rheumatic diseases.

IFN-α production by plasmacytoid dendritic cells stimulated with RNA-containing immune complexes is promoted by NK cells via MIP-1ß and LFA-1.

Several systemic autoimmune diseases display a prominent IFN signature. This is caused by a continuous IFN-α production by plasmacytoid dendritic cells (pDCs), which are activated by immune complexes (ICs) containing nucleic acid. The IFN-α production by pDCs stimulated with RNA-containing IC (RNA-IC) consisting of anti-RNP autoantibodies and U1 small nuclear ribonucleoprotein particles was recently shown to be inhibited by monocytes, but enhanced by NK cells. The inhibitory effect of monocytes was mediated by TNF-α, PGE(2), and reactive oxygen species, but the mechanisms for the NK cell-mediated increase in IFN-α production remained unclear. In this study, we investigated the mechanisms whereby NK cells increase the RNA-IC-induced IFN-α production by pDCs. Furthermore, NK cells from patients with systemic lupus erythematosus (SLE) were evaluated for their capacity to promote IFN-α production. We found that CD56(dim) NK cells could increase IFN-α production >1000-fold after RNA-IC activation, whereas CD56(bright) NK cells required costimulation by IL-12 and IL-18 to promote IFN-α production. NK cells produced MIP-1α, MIP-1ß, RANTES, IFN-γ, and TNF-α via RNA-IC-mediated FcγRIIIA activation. The IFN-α production in pDCs was promoted by NK cells via MIP-1ß secretion and LFA-mediated cell-cell contact. Moreover, NK cells from SLE patients displayed a reduced capacity to promote the RNA-IC-induced IFN-α production, which could be restored by exogenous IL-12 and IL-18. Thus, different molecular mechanisms can mediate the NK cell-dependent increase in IFN-α production by RNA-IC-stimulated pDCs, and our study suggests that the possibility to therapeutically target the NK-pDC axis in IFN-α-driven autoimmune diseases such as SLE should be investigated.

Comprehensive evaluation of the genetic variants of interferon regulatory factor 5 (IRF5) reveals a novel 5 bp length polymorphism as strong risk factor for systemic lupus erythematosus.

We analyzed a comprehensive set of single-nucleotide polymorphisms (SNPs) and length polymorphisms in the interferon regulatory factor 5 (IRF5) gene for their association with the autoimmune disease systemic lupus erythematosus (SLE) in 485 Swedish patients and 563 controls. We found 16 SNPs and two length polymorphisms that display association with SLE (P < 0.0005, OR > 1.4). Using a Bayesian model selection and averaging approach we identified parsimonious models with exactly two variants of IRF5 that are independently associated with SLE. The variants of IRF5 with the highest posterior probabilities (1.00 and 0.71, respectively) of being causal in SLE are a SNP (rs10488631) located 3' of IRF5, and a novel CGGGG insertion-deletion (indel) polymorphism located 64 bp upstream of the first untranslated exon (exon 1A) of IRF5. The CGGGG indel explains the association signal from multiple SNPs in the IRF5 gene, including rs2004640, rs10954213 and rs729302 previously considered to be causal variants in SLE. The CGGGG indel contains three or four repeats of the sequence CGGGG with the longer allele containing an additional SP1 binding site as the risk allele for SLE. Using electrophoretic mobility shift assays we show increased binding of protein to the risk allele of the CGGGG indel and using a minigene reporter assay we show increased expression of IRF5 mRNA from a promoter containing this allele. Increased expression of IRF5 protein was observed in peripheral blood mononuclear cells from SLE patients carrying the risk allele of the CGGGG indel. We have found that the same IRF5 allele also confers risk for inflammatory bowel diseases and multiple sclerosis, suggesting a general role for IRF5 in autoimmune diseases.

A risk haplotype of STAT4 for systemic lupus erythematosus is over-expressed, correlates with anti-dsDNA and shows additive effects with two risk alleles of IRF5.

Systemic lupus erythematosus (SLE) is the prototype autoimmune disease where genes regulated by type I interferon (IFN) are over-expressed and contribute to the disease pathogenesis. Because signal transducer and activator of transcription 4 (STAT4) plays a key role in the type I IFN receptor signaling, we performed a candidate gene study of a comprehensive set of single nucleotide polymorphism (SNPs) in STAT4 in Swedish patients with SLE. We found that 10 out of 53 analyzed SNPs in STAT4 were associated with SLE, with the strongest signal of association (P = 7.1 x 10(-8)) for two perfectly linked SNPs rs10181656 and rs7582694. The risk alleles of these 10 SNPs form a common risk haplotype for SLE (P = 1.7 x 10(-5)). According to conditional logistic regression analysis the SNP rs10181656 or rs7582694 accounts for all of the observed association signal. By quantitative analysis of the allelic expression of STAT4 we found that the risk allele of STAT4 was over-expressed in primary human cells of mesenchymal origin, but not in B-cells, and that the risk allele of STAT4 was over-expressed (P = 8.4 x 10(-5)) in cells carrying the risk haplotype for SLE compared with cells with a non-risk haplotype. The risk allele of the SNP rs7582694 in STAT4 correlated to production of anti-dsDNA (double-stranded DNA) antibodies and displayed a multiplicatively increased, 1.82-fold risk of SLE with two independent risk alleles of the IRF5 (interferon regulatory factor 5) gene.

Type I interferon system activation and association with disease manifestations in systemic sclerosis.

OBJECTIVES: To study the presence of interferogenic autoantibodies in systemic sclerosis (SSc) and their correlation with clinical manifestations, serum levels of interferon alpha (IFNalpha) and chemokines of importance in the disease process. METHODS: Peripheral blood mononuclear cells (PBMCs) or purified plasmacytoid dendritic cells (pDCs) from healthy donors were stimulated with sera from patients with SSc (n=70) or healthy individuals (n=30), together with necrotic or apoptotic cell material. The IFNalpha produced and serum levels of IFNalpha, IFN-inducible protein-10 (IP-10)/chemokine (C-X-C motif) ligand 10, monocyte chemoattractant protein-1 (MCP-1)/(C-C motif) ligand-2 (CCL-2), macrophage inflammatory protein-1alpha (MIP-1alpha)/CCL-3 and RANTES/CCL-5 were measured and correlated with the presence of autoantibodies and clinical manifestations in the patients with SSc. RESULTS: Sera from both diffuse SSc and limited SSc contained interferogenic antibodies, which correlated with the presence of anti-ribonucleoprotein and anti-Sjögren syndrome antigen autoantibodies. The pDCs were responsible for the IFNalpha production which required interaction with FcgammaRII and endocytosis. Increased serum levels of IP-10 were associated with vascular manifestations such as cardiac involvement (p=0.027) and pulmonary arterial hypertension (p=0.036). Increased MCP-1 or IFNalpha serum levels were associated with lung fibrosis (p=0.019 and 0.048, respectively). Digital ulcers including digital loss were associated with increased serum levels of IFNalpha (p=0.029). CONCLUSION: An activated type I IFN system previously seen in several other systemic autoimmune diseases is also present in SSc and may contribute to the vascular pathology and affect the profibrotic process.

Type I interferon and lupus.

PURPOSE OF REVIEW: Patients with lupus have signs of an ongoing production of type I interferons (IFNs) that are of importance both for the etiopathogenesis and the clinical manifestations. In this review, we summarize the latest information concerning the type I IFN system in lupus. RECENT FINDINGS: Activated plasmacytoid dendritic cells are responsible for the IFNalpha production in lupus and can be found in target organs such as glomeruli. The plasmacytoid dendritic cells are triggered by interferogenic immune complexes, and produced IFNalpha activates the immune system and impairs T-regulatory cell function. Autoantibodies, which can form interferogenic immune complexes, are not only present in serum of lupus patients but also in the cerebrospinal fluid of patients with neuropsychiatric manifestations. There is a strong association between risk to develop lupus and gene variants connected to the production and effects of type I IFN. Risk variants can not only cause either increased serum IFNalpha activity or sensitivity but also a more severe disease phenotype. Administration of monoclonal anti-IFNalpha antibodies to lupus patients downregulates several proinflammatory pathways and reduces disease activity. SUMMARY: Increasing evidence indicates that the activated type I IFN system in lupus is critical in the etiopathogenesis of the disease and is an important therapeutic target.

The natural interferon-alpha producing cells in systemic lupus erythematosus.

Prolonged exposure of the immune system to type I interferons (IFN-alpha/beta/omega) in patients receiving IFN-alpha therapy frequently results in development of autoantibodies and autoimmune disease. This is attributed to the many immunostimulatory effects of these cytokines. Patients with the autoimmune disease systemic lupus erythematosus (SLE) have an ongoing IFN-alpha production. Recent studies of SLE demonstrated the presence of endogenous IFN-alpha inducers, acting specifically on natural IFN-alpha producing cells (NIPC), often termed plasmacytoid dendritic cells (PDC). These IFN-alpha inducers were potent, present at the blood level, and characterized as immune complexes that contained DNA and IgG as essential components. They were considered a likely reason for the activated IFN-alpha production in SLE, which, in turn, might be an important etiopathogenic factor. Here, we briefly review the biology of the type I IFN system, with emphasis on inducers, producing cells (especially NIPC/PDC), IFN-alpha actions, and target immune cells, which might be relevant in SLE. Based on such information and results from studies in SLE patients, we propose a hypothesis that explains how NIPC/PDC become activated and play a pivotal etiopathogenic role in SLE and perhaps also other autoimmune diseases. This hypothesis furthermore indicates new therapeutic targets.

Role of natural interferon-alpha producing cells (plasmacytoid dendritic cells) in autoimmunity.

The type I interferons (IFNs) have antiviral, cytostatic and prominent immunomodulatory effects, which all are of great importance during viral infections. However, prolonged exposure of the immune system to type I IFN can break tolerance and initiate an autoimmune reaction, eventually leading to autoimmune disease. Recent observations in patients with systemic lupus erythematosus (SLE) have revealed that such individuals have endogenous IFN-alpha inducers, causing an ongoing IFN-alpha production and consequently a continuous stimulation of the immune system. These IFN-alpha inducers consist of small immune complexes (IC) containing DNA or RNA and act on the principal IFN-alpha producing cell, the natural IFN-alpha producing cell (NIPC), also termed the plasmacytoid dendritic cell (PDC). The NIPC/PDC is a key cell in both the innate and adaptive immune response but can also, either directly or via produced IFN-alpha, have a pivotal role in autoimmunity. In this review we summarize recent data concerning NIPC/PDC, including their activation, regulation, function and possible role in autoimmune diseases, especially SLE.

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells.

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.

A candidate gene study of the type I interferon pathway implicates IKBKE and IL8 as risk loci for SLE.

Systemic Lupus Erythematosus (SLE) is a systemic autoimmune disease in which the type I interferon pathway has a crucial role. We have previously shown that three genes in this pathway, IRF5, TYK2 and STAT4, are strongly associated with risk for SLE. Here, we investigated 78 genes involved in the type I interferon pathway to identify additional SLE susceptibility loci. First, we genotyped 896 single-nucleotide polymorphisms in these 78 genes and 14 other candidate genes in 482 Swedish SLE patients and 536 controls. Genes with P<0.01 in the initial screen were then followed up in 344 additional Swedish patients and 1299 controls. SNPs in the IKBKE, TANK, STAT1, IL8 and TRAF6 genes gave nominal signals of association with SLE in this extended Swedish cohort. To replicate these findings we extracted data from a genomewide association study on SLE performed in a US cohort. Combined analysis of the Swedish and US data, comprising a total of 2136 cases and 9694 controls, implicates IKBKE and IL8 as SLE susceptibility loci (P(meta)=0.00010 and P(meta)=0.00040, respectively). STAT1 was also associated with SLE in this cohort (P(meta)=3.3 × 10⁻5), but this association signal appears to be dependent of that previously reported for the neighbouring STAT4 gene. Our study suggests additional genes from the type I interferon system in SLE, and highlights genes in this pathway for further functional analysis.

Genetic variants and disease-associated factors contribute to enhanced interferon regulatory factor 5 expression in blood cells of patients with systemic lupus erythematosus.

OBJECTIVE: Genetic variants of the interferon (IFN) regulatory factor 5 gene (IRF5) are associated with susceptibility to systemic lupus erythematosus (SLE). The contribution of these variants to IRF-5 expression in primary blood cells of SLE patients has not been addressed, nor has the role of type I IFNs. The aim of this study was to determine the association between increased IRF-5 expression and the IRF5 risk haplotype in SLE patients. METHODS: IRF-5 transcript and protein levels in 44 Swedish patients with SLE and 16 healthy controls were measured by quantitative real-time polymerase chain reaction, minigene assay, and flow cytometry. Single-nucleotide polymorphisms rs2004640, rs10954213, and rs10488631 and the CGGGG insertion/deletion were genotyped in these patients. Genotypes of these polymorphisms defined both a common risk haplotype and a common protective haplotype. RESULTS: IRF-5 expression and alternative splicing were significantly up-regulated in SLE patients compared with healthy donors. Enhanced transcript and protein levels were associated with the risk haplotype of IRF5; rs10488631 displayed the only significant independent association that correlated with increased transcription from the noncoding first exon 1C. Minigene experiments demonstrated an important role for rs2004640 and the CGGGG insertion/deletion, along with type I IFNs, in regulating IRF5 expression. CONCLUSION: This study provides the first formal proof that IRF-5 expression and alternative splicing are significantly up-regulated in primary blood cells of patients with SLE. Furthermore, the risk haplotype is associated with enhanced IRF-5 transcript and protein expression in patients with SLE.

Regulation of the interferon-alpha production induced by RNA-containing immune complexes in plasmacytoid dendritic cells.

OBJECTIVE: Interferon-alpha (IFNalpha) is produced in several autoimmune diseases, including systemic lupus erythematosus (SLE), and may be important in their pathogenesis. We undertook this study to investigate how IFNalpha production induced by RNA-containing immune complexes (ICs) in plasmacytoid dendritic cells (PDCs) is regulated. METHODS: Normal PDCs purified from peripheral blood mononuclear cells (PBMCs) were cocultivated with other cell populations isolated from healthy individuals or SLE patients. IFNalpha production was induced by RNA-containing ICs, which consisted of anti-RNP autoantibodies and U1 small nuclear RNP particles, and the effects of prostaglandin E2 (PGE2), reactive oxygen species (ROS), or the cytokines IFNalpha2b, granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-10 (IL-10), or tumor necrosis factor alpha (TNFalpha) were explored. RESULTS: Monocytes inhibited IFNalpha production by PDCs in PBMC cultures, while natural killer (NK) cells were stimulatory. The monocytes had little effect on IFNalpha production by pure PDCs but inhibited its stimulation by NK cells. Monocytes from SLE patients were less inhibitory. Exposure of PBMCs or PDCs to IFNalpha2b/GM-CSF increased their IFNalpha production. RNA-containing ICs caused production of ROS, PGE2, and TNFalpha, especially in monocytes. These mediators and IL-10 suppressed IFNalpha production in PBMC cultures, with ROS and PGE2 also inhibiting IFNalpha production by purified PDCs. Inhibition by all of these agents, except for ROS, was abolished by IFNalpha2b/GM-CSF. The inhibitory effect of monocytes was significantly counteracted by the ROS scavengers serotonin and catalase. CONCLUSION: IFNalpha production induced by RNA-containing ICs in PDCs is regulated by a network of interactions between monocytes, NK cells, and PDCs, involving several pro- and antiinflammatory molecules. This should be considered when designing and applying new therapies.

C1q inhibits immune complex-induced interferon-alpha production in plasmacytoid dendritic cells: a novel link between C1q deficiency and systemic lupus erythematosus pathogenesis.

OBJECTIVE: C1q deficiency is the strongest risk factor known for the development of systemic lupus erythematosus (SLE), since almost all humans with a genetic deficiency of C1q develop this disease. Low C1q serum concentration is also a typical finding in SLE during flares, emphasizing the involvement of C1q in SLE pathogenesis. Recent studies have revealed that C1q has a regulatory effect on Toll-like receptor-induced cytokine production. Therefore, we undertook this study to investigate whether C1q could regulate production of interferon-alpha (IFNalpha). METHODS: Peripheral blood mononuclear cells (PBMCs) and plasmacytoid dendritic cells (PDCs) were stimulated with 3 known interferogenic stimuli and cultured with physiologic concentrations of C1q. IFNalpha production was determined by an immunoassay. RESULTS: C1q significantly inhibited PBMC IFNalpha production induced by RNA-containing immune complexes (ICs), herpes simplex virus (HSV), and CpG DNA. C1q also inhibited PDC IFNalpha production induced by ICs and CpG DNA but increased PDC IFNalpha production induced by HSV. The regulatory role of C1q was not specific for IFNalpha but was also seen for interleukin-6 (IL-6), IL-8, and tumor necrosis factor alpha. We demonstrated binding of C1q to PDCs both by surface plasmon resonance interaction analysis and by flow cytometry, and we also demonstrated intracellular detection of 2 C1q binding proteins. CONCLUSION: Our findings contribute to the understanding of why C1q deficiency is such a strong risk factor for SLE and suggest an explanation for the up-regulation of the type I IFN system seen in SLE patients.

A part of the VP4 capsid protein exhibited by coxsackievirus B4 E2 is the target of antibodies contained in plasma from patients with type 1 diabetes.

The capsid protein VP4 was identified previously as the target of antibodies contained in plasma enhancing the coxscakievirus B4 (CV-B4) E2-induced production of IFN-alpha by peripheral blood mononuclear cells (PBMCs). The sequence of VP4 recognized by these antibodies was investigated. This sequence was identified as amino acids 11 to 30 by using synthetic overlapping peptides spanning VP4(CV-B4 E2) in competition experiments for antibodies enhancing the CV(B4 E2) induced production of IFN-alpha by PBMCs. This amino acid sequence was the major target of anti-VP4 antibodies according to enzyme-linked immunosorbent assays (ELISA). There was a positive correlation between the levels of anti-VP4 and anti-VP4(11-30) peptide antibodies detected by ELISA. The levels and the prevalences of these antibodies were significantly higher in patients with type 1 diabetes than in healthy controls. The proportions and the levels of those antibodies in patients were independent of HLA-DR alleles, age, or presence of ketosis in blood and were not associated with newly or previously diagnosed disease. The VP4(CV-B4 E2) amino acid sequence was submitted to the Swiss-model in project mode to visualize the possible shape of the sequence of VP4 corresponding to amino acids 11-30 which appeared to be constituted principally by an non-structured loop. In conclusion, the sequence of VP4 corresponding to amino acids 11-30, or a part of it plays a role in the plasma-dependent enhancement of CV-B4 E2-induced production of IFN-alpha by PBMCs, suggesting that at 37 degrees C the virus exhibits that region of VP4 to antibodies.

A possible mechanism for endogenous activation of the type I interferon system in myositis patients with anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies.

OBJECTIVE: To investigate type I interferon (IFN) system activation and its correlation with autoantibodies and organ manifestations in polymyositis (PM), dermatomyositis (DM), and inclusion body myositis. METHODS: Sera from 30 patients and 16 healthy controls, or purified IgG, were combined with material released from necrotized cells to stimulate IFNalpha production by peripheral blood mononuclear cells (PBMCs) from healthy blood donors. Muscle biopsy specimens from 25 patients and 7 healthy controls were investigated for blood dendritic cell antigen 2 (BDCA-2)-positive plasmacytoid dendritic cells (PDCs) and IFNalpha/beta-inducible myxovirus resistance 1 (MX-1) protein. RESULTS: Sera from 13 patients who were positive for anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies induced IFNalpha production in PBMCs when combined with necrotic cell material. In addition, IgG prepared from anti-Jo-1-positive PM sera induced IFNalpha with necrotic material, but not when the latter was treated with RNase. BDCA-2 expression in PDCs in muscle tissue was increased in PM patients with anti-Jo-1 autoantibodies, while MX-1 staining in capillaries was increased in DM patients, compared with healthy individuals. IFNalpha-inducing capacity correlated with interstitial lung disease, while MX-1 expression in the capillaries correlated with DM. CONCLUSION: Immune complexes containing anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies and RNA may act as endogenous IFNalpha inducers that activate IFNalpha production in PDCs. These PDCs could be of importance for inducing myositis, whereas in DM patients without autoantibodies the presence of MX-1 protein in capillaries suggests another cellular IFNalpha source and induction mechanism. Consequently, the type I IFN system may be of importance in both PM and DM, but via different pathways.

Association of a haplotype in the promoter region of the interferon regulatory factor 5 gene with rheumatoid arthritis.

OBJECTIVE: To determine whether genetic variants of the interferon regulatory factor 5 (IRF-5) and Tyk-2 genes are associated with rheumatoid arthritis (RA). METHODS: Five single-nucleotide polymorphisms (SNPs) in IRF5 and 3 SNPs in Tyk2 were analyzed in a Swedish cohort of 1,530 patients with RA and 881 controls. A replication study was performed in a Dutch cohort of 387 patients with RA and 181 controls. All patient sera were tested for the presence of autoantibodies against cyclic citrullinated peptides (anti-CCP). RESULTS: Four of the 5 SNPs located in the 5' region of IRF5 were associated with RA, while no association was observed with the Tyk2 SNPs. The minor alleles of 3 of the IRF5 SNPs, which were in linkage disequilibrium and formed a relatively common haplotype with a frequency of approximately 0.33, appeared to confer protection against RA. Although these disease associations were seen in the entire patient group, they were mainly found in RA patients who were negative for anti-CCP. A suggestive association of IRF5 SNPs with anti-CCP-negative RA was also observed in the Dutch cohort. CONCLUSION: Given the fact that anti-CCP-negative RA differs from anti-CCP-positive RA with respect to genetic and environmental risk factor profiles, our results indicate that genetic variants of IRF5 contribute to a unique disease etiology and pathogenesis in anti-CCP-negative RA.

Mechanisms of Disease: primary Sjögren's syndrome and the type I interferon system.

Sjögren's syndrome is a chronic autoimmune disease of largely unknown etiology and pathogenesis. The salivary and lacrimal glands are the main target organs, and key cells and molecules involved in the autoimmune process have been detected in these glands. Chemokines, expressed by epithelial cells, can attract T cells and dendritic cells that produce proinflammatory cytokines, which stimulate the immune response and induce apoptosis in the acinar and ductal epithelial cells. The autoantigens SSA and SSB are translocated to the apoptotic blebs and trigger infiltrating B cells to produce autoantibodies against SSA and SSB. Germinal-center-like structures can form within glandular lymphocyte foci, facilitating the antigen-driven B-cell activation. Many of the autoimmune mechanisms described above can be induced by type I interferon (IFN), and activation of this system in patients with Sjögren's syndrome has been described. A possible scenario is that an initial viral infection induces type I IFN production in salivary glands with a subsequent activation of the adaptive immune system. Resultant autoantibodies form nucleic-acid-containing immune complexes that can trigger prolonged type I IFN production, leading to a self-perpetuating autoimmune reaction. Several potential therapeutic targets for Sjögren's syndrome exist within the type I IFN system.