Protocol to cryopreserve and isolate nuclei from adipose tissue without dimethyl sulfoxide.

Cryopreservation injuries involve nuclear DNA damage. A protocol for cryopreserving and isolating adipocyte nuclei is proposed. Adipose tissue samples were directly analyzed (NoCRYO-0h), or stored at -196°C for 7 days without 10% dimethyl sulfoxide (DMSO) (CRYO-WO-DMSO) or with DMSO (CRYO-W-DMSO). To determine the effect of DMSO on cryopreservation treatment, adipose tissue samples were stored at 4°C for 24 h with 10% DMSO (NoCRYO-W-DMSO-24h) and without (NoCRYO-WO-DMSO-24h). Samples were processed in isolation buffer, and nuclear integrity was measured by flow cytometry. The coefficient of variation, forward scatter, side scatter, and number of nuclei analyzed were evaluated. Pea (Pisum sativum) was used to measure the amount of DNA. All groups contained similar amounts of DNA to previously reported values and a satisfactory number of nuclei were analyzed. CRYO-W-DMSO presented a higher coefficient of variation (3.19 ± 0.09) compared to NoCRYO-0h (1.85 ± 0.09) and CRYO-WO-DMSO (2.02 ± 0.02). The coefficient of variation was increased in NoCRYO-W-DMSO-24h (3.80 ± 0.01) compared to NoCRYO-WO-DMSO-24h (2.46 ± 0.03). These results relate DMSO presence to DNA damage independently of the cryopreservation process. CRYO-W-DMSO showed increased side scatter (93.46 ± 5.03) compared to NoCRYO-0h (41.13 ± 3.19) and CRYO-WO-DMSO (48.01 ± 2.28), indicating that cryopreservation with DMSO caused chromatin condensation and/or nuclear fragmentation. CRYO-W-DMSO and CRYO-WO-DMSO presented lower forward scatter (186.33 ± 9.33 and 196.89 ± 26.86, respectively) compared to NoCRYO-0h (322.80 ± 3.36), indicating that cryopreservation reduced nuclei size. Thus, a simple method for cryopreservation and isolation of adipocyte nuclei causing less damage to DNA integrity was proposed.

The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

Determination of tocopheryl acetate and ascorbyl tetraisopalmitate in cosmetic formulations by HPLC.

A rapid HPLC method was developed for the assay of tocopheryl acetate and ascorbyl tetraisopalmitate in cosmetic formulations. The validated method was applied for quantitative determination of these vitamins in simulated emulsion formulation. Samples were analysed directly on a RP-18 reverse phase column with UV detection at 222 nm. A mixture of methanol and isopropanol (25 : 75 v/v) was used as mobile phase. The retention time of tocopheryl acetate and ascorbyl tetraisopalmitate were 3.0 min and 5.9 min, respectively. Recovery was between 95% and 104%. In addition, the excipients did not interfere in the analysis. The method is simple, reproducible, selective and is suitable for routine analyses of commercial products.

In vitro 3D assay to test angiogenic effects of human CD14+ monocytes seeded on macroporous PLGA/CaP polymers with a CaP nanostructured surface.

In this study we present a three-dimensional angiogenesis assay in vitro that allows the evaluation of the influence of Poly(lactic-co-glycolic acid) based implants seeded with VEGF-A165 stimulated/activated human CD14+ monocytes on the attraction and migration of human micro vascular endothelial cells (HMVEC-L). Primary HMEC of the capillary bed were cultured on an extracellular matrix generated by bovine corneal endothelial cells (BCEC). The HMEC layer was covered by an agarose gel, upon which a Poly(lactic-co-glycolic acid)/CaP polymer with a Calcium-Phosphate (CaP) nanostructured surface was placed. This scaffold has already been shown to interact with endothelial cells and endothelial progenitor cells respectively in vivo. It was seeded with angiogenically stimulated (VEGF-A165) human CD14+ monocytes, to get a monocyte/macrophage fraction, which can promote angiogenesis, tissue remodelling and tissue repair due to the secretion of growth factors, cytokines, chemokines and enzymes. The study demonstrated that this assay is suitable to test angiogenic effects by stimulated human CD14+ monocytes on human microvascular endothelial cells influenced by Poly(lactic-co-glycolic acid)/CaP scaffolds with a nanostructured CaP surface. The assay can exclude effects on migration caused by gravity and also allows testing in a physiological environment on an extracellular matrix secreted by endothelial cells.

Effectiveness of highly active antiretroviral therapy using non-brand name drugs in Brazil.

In Brazil, HIV-infected individuals receive drugs (including non-brand name drugs which comprise locally produced generics and drugs that have not been tested in bioequivalence trials) free of charge from the government. The objective of the present study was to evaluate the effectiveness of highly active antiretroviral therapy (HAART) in Rio de Janeiro, Brazil, where non-brand drugs are widely used. For this purpose, we estimated the proportion of subjects with virologic failure (plasma HIV viral load greater than 400 copies/mL at 6 months after initiation of treatment). This was a retrospective cohort study of drug-naive HIV-infected subjects who initiated HAART. Subjects were included in the analysis if they were 18 years of age or older, were treatment naive, started HAART with a minimum of 3 drugs, and had available information on blood plasma HIV-1 viral load after 6 months on therapy. All subjects used antiretrovirals in dosing regimens recommended by the Brazilian National Advisory Committee for Antiretroviral Therapy. Chart reviews were conducted in three settings: at two public health outpatient units, at one clinical trial unit and at one private office. No comparisons of the effectiveness of non-brand name with the effectiveness of brand name drugs were made. We present results for 485 patients; of these, 354 (73%), 55 (11%), and 76 (16%) were seen at the public health outpatient units, private office, and clinical trial unit, respectively. Virologic failure was observed in 119 (25%) of the subjects. This study demonstrates the effectiveness of HAART in a setting where non-brand name drugs are widely used.

Evaluation of an ultrasonic method applied to the measurement of blood coagulation time.

Clinical assessment of the blood clotting mechanism is usually made by measuring the time necessary for a sample of plasma to clot. In this work a semi-automatic method for measuring coagulation time is evaluated. It employs ultrasound, at 2.7 MHz, for monitoring variations of the viscosity in a plasma sample undergoing coagulation. The evaluation is performed by comparing measurements obtained by two well-known methods, the manual tilt tube and the fibrometer, with those obtained using the ultrasonic method. A total of 330 plasma samples from individuals with normal and altered homeostatic process were analysed. The experimental protocol follows two standard tests: the prothrombin time (141 samples) and the activated partial thromboplastin time (189 samples). The agreement between the three different methods is estimated statistically and it is shown that all the three can be used interchangeably for clinical purposes.

Fine-needle aspiration cytology of myositis ossificans: a case report.

This report describes the cytological findings of a case of myositis ossificans in a 16-yr-old girl. Clinically and radiologically she was suspected to have a malignant soft tissue tumor. This was not confirmed by fine-needle aspiration cytology and a diagnosis of benign lesion, probably myositis, was given. This diagnosis was confirmed by histological examination.

Fine-needle aspiration cytology as a tool for the early detection of testicular relapse of acute lymphoblastic leukemia in children.

Fine-needle aspiration cytology (FNAC) of the testis was done in 31 children (33 aspirates) with acute lymphoblastic leukemia (ALL) either as part of an end-therapy protocol (Group I, n = 20) or because of clinical suspicion of testicular relapse (Group II, n = 13). In Group I, none of the smears showed evidence of leukemic cells. However, two of these patients developed subsequent testicular relapse within 1 yr and were considered false-negative cases. Blast cells were present in nine patients of Group II; in the remaining four patients no neoplastic cells were observed in the smears and none experienced a relapse after a mean follow-up of 18 mo. Our findings indicate that FNAC can be a valuable method to evaluate clinically suspected testicular infiltration in children with ALL, and can be considered as an alternative procedure to surgical biopsy for screening testicular recurrence of childhood ALL.

Fine-needle aspiration biopsy and imprint cytology of small non-cleaved cell (Burkitt's) lymphoma.

We reviewed 13 cases of small non-cleaved cell (Burkitt's) lymphoma diagnosed by fine-needle aspiration biopsy (FNAB) and four cases where that diagnosis was made from touch imprints from surgical biopsy specimens. The most common site was intraabdominal. Histologic confirmation was present in 14/17 cases. General microscopic features on smears included high cellularity and an individual cell pattern. Extracellular lymphoglandular bodies were abundant and tingible body macrophages were prominent. Nuclei were intermediate in size and round with a finely dispersed chromatin pattern on May-Grünwald-Giemsa stained smears. Cytoplasm was basophilic and scant with prominent vacuoles. Extracellular vacuoles and vacuoles within lymphoglandular bodies occurred in all patients. Immunocytochemistry performed on 16/17 cases demonstrated a B cell phenotype in 15. Nine cases were kappa light chain positive and six were lambda light chain positive. Flow cytometry performed in five cases demonstrated diploid cells with a high S phase. We conclude that Burkitt's lymphoma can be diagnosed using combined FNAB and immunophenotyping.

Malignant melanoma of soft tissue. A report of three cases with diagnosis by fine needle aspiration cytology.

A correlated cytologic and histologic study of three cases of malignant melanoma of soft tissue (MMST) is presented. The patients' ages ranged from 21 to 36 years. Two were females and one, male. In two cases fine needle aspiration cytology was done to document local recurrence or metastatic disease and in one to establish a primary diagnosis. The cytologic findings were similar in all cases. The smears were composed of noncohesive tumor cells with monotonous, uniform nuclei, prominent nucleoli and plentiful, light blue cytoplasm. Immunohistochemical studies performed in all cases demonstrated staining positive for S-100 protein. Electron microscopy from two cases showed premelanosomes and melanosomes. These results demonstrate that a precise diagnosis of MMST can be rendered on material obtained by aspiration cytology.

[Nasofacial zygomycosis. Report of a case of Para state, Brazil]. / Zigomicose nasofacial. Relato de um caso do estado do Pará, Brasil.

A case of nasofacial zygomycosis in a 64-year-old female patient from Barcarena, State of Pará, is reported. This is the second time that the disease is recognized in Northern Brazil. The diagnosis was initially suspected by the direct observation of broad coenocytic hyphae in biopsy specimens of the nasal cavity mucosa. Later, the cause of the disease was confirmed by the mycologial and histopathological findings. Rapid response to the therapy with potassium iodide was achieved, without however a complete resolution of the lesions. The patient still remains under treatment, with itraconazole and iodide.

Bronchial asthma in children: clinical and epidemiologic approach in different Portuguese speaking countries.

BACKGROUND: Geographical differences in asthma prevalence are currently accepted, but evidence is sparse due to the lack of multicentre studies using the same protocol. OBJECTIVES: To compare the prevalence of asthma and atopy among schoolchildren from Portuguese speaking countries (ISAAC and Portuguese Study) and evaluate some environmental variables, such as house dust mite exposure. MATERIAL AND METHODS: Significant random samples of schoolchildren studied with standard validated methods--questionnaires, skin prick tests, methacholine bronchial challenge tests; dust bed sampling for analysis of mite antigens. RESULTS: In the ISAAC study, in the 13-14 year-old age group, statistical significant differences were found, with higher wheezing prevalence in Brazil than in Portugal (two-fold). In the Portuguese Study, atopy prevalence ranged between 6.0 and 11.9% in Sal and S. Vicente (Cape Verde), up to 48.6 and 54.1% in Macau and Madeira. Active asthma had the higher values in Madeira (14.6%), and the lower in Macau (1.3%). Cape Verde had intermediate asthma prevalence (10.6 and 7.0%). The bronchial challenge test was positive in 25, 66 and 70% of asthmatic children from Sal, S. Vicente and Madeira respectively. Significant HDM antigen concentrations (Der p1) were found in Cape Verde and Madeira. CONCLUSIONS: There are significant variations in asthma and atopy prevalence between these pediatric populations. The reasons remain under discussion, but genetics linked to race, seem to play a central role, modulated by environmental and lifestyle variables.

[Nasofacial zygomycosis in the state of Pará: the registration of 2 cases]. / Zigomicose nasofacial no Estado do Pará: registro de dois casos.

Two new cases of nasofacial zygomycosis from the state of Pará, Brazil, are reported. Both cases were treated with ketoconazole and the response to the drug was considered to be good; the patients improved rapidly and the nasal obstruction was the first manifestation to disappear. As five cases have been described in recent years from the state of Pará, this form of zygomycosis can no longer be considered as a rare disease in northern Brazil.

[HIV/tuberculosis co-infection: a request for a better surveillance]. / Co-infecção HIV/tuberculose: necessidade de uma vigilância mais efetiva.

The increasing endemicity of tuberculosis resulting from causes such as immigration, poverty, a declining public health infrastructure and co-infection by HIV/Mycobacterium tuberculosis, is leading to a change in tuberculosis control programmes. One of the main reasons for the resurgence of tuberculosis is HIV infection--the risk of tuberculosis is greater in HIV patients than in the majority of the population as can be seen from numerous research projects. The need for systematic testing for HIV infection in all tuberculosis patients by undertaking confidential HIV tests on admission to a tuberculosis programme is brought out. This measure would increase the number of cases diagnosed and provide data for better surveillance of the co-infection.

Quantitative skin prick tests and specific IgE (CAP System) for D. pteronissynus--correlation of results in a paediatric population.

The CAP System compared with RAST has a greater sensitivity, with the same specificity, as well as an excellent correlation with skin prick tests (SPT), as documented by others. Standardization of SPT is essential for routine and investigational purposes. We used a standardized lancet (DHS), and the methodology of reading the SPT was a computerized digitalized graphics tablet coupled to an IBM-PC AT using CAD software, expressing the result as wheal areas with cut off +/- at 7 mm2. The method is precise and reproducible with a mean coefficient of variation (cv) intratester--T1: 3.1%, T2: 3.5% and a cv intertester: 2.93%. We compare the results of SPT of two different allergen extracts for Dermatophagoides Pteronissynus (DPt) (Bencard; Merck/Allergo-Pharma, standardized in SBU) and correlate them with specific IgE, in 122 patients, 72 males and 50 females, aged 3 to 19 years. The results between the extracts and the results of specific IgE obtained by CAP System with each of the extracts, were correlated. 34 patients were considered to be non atopic. 88 patients showed at least one positive result with one test, being those used to correlate the positive results.... The results showed good correlations for quantitative SPT between Bencard and Merck/Allergo-Pharma, as well as for the capacity of eliciting positive results. When SPT were compared to specific IgE as +/- and as quantitative results, there were good correlation for Bencard/CAP and Merck/CAP. The results obtained suggest that CAP can be used to validate allergen extracts of DPt and that studies with other extract are advisable.

ALATOP:sensitivity, specificity and predictive value of a new "in vitro" screening test of atopy.

UNLABELLED: The limitations of total IgE for the screening of atopy, gave rise to in vitro multispecific IgE tests to common allergens. These should have an increased sensitivity and specificity when compared to total IgE. Previous data showed the interest of such tests in screening procedures. ALATOP is a new in vitro multispecific IgE test including common aero and food allergens, in liquid phase, for paediatric and adult population. The result is expressed only in positive/negative. The aim of the study was to determine the sensitivity, specificity, positive and negative predictive value and test efficiency, by comparing the results obtained in 266 paediatric patients (selected in our Unit based on a good correlation between clinical history and skin prick tests--SPT), between ALATOP and SPT. RESULTS: 1) Sensitivity: 89.57%; 2) Specificity: 98.06%; 3) Positive predictive value: 98.65%; 4) Negative predictive value: 85.59%; 5) Efficiency of the test: 92.86%; 6) Reproducibility of the test--average: 5.63%. Based on this results and when they are compared to single specific IgE determinations, that are assumed to be about 80% of the sensitivity of SPT, ALATOP showed excellent results, allowing its use in the screening of atopic disease.

ALATOP-RIA in the screening of atopy in a non Caucasian population.

UNLABELLED: ALATOP is an "in vitro" radioimmunoassay screening test for atopy, previously validated in a caucasian population. The aim of the study was to assess the usefulness of a screening test of atopy in a non caucasian population. We select a non caucasian population (n = 208), from hospital immunoallergy consultations, Cape Verde Republic (Africa). It was determined the sensitivity, specificity and predictive values comparing with skin prick tests (SPT) results for the 208 patients, and with clinical data (Clin) in 115 patients. It was also determined the levels of total IgE, done by IRMA. RESULTS: Using different corrections factors, 0.85 gives the best results: ALATOP/SPT-Sensitivity-88.5% +/- 4.34; Specificity-73.8% +/- 8.41; Positive predictive value-66.9%; Negative predictive value-91.4%; Efficiency of the test-79.3%. ALATOP/CLIN-Sensitivity-95.2% +/- 3.89; Specificity-71.2% +/- 12.07; Positive predictive value-65.6%; Negative predictive value-96.2%; Efficiency of the test-80.0%. The mean values of total IgE were-406 IU/ml. CONCLUSIONS: The mean value of total IgE was significantly increased even in the ALATOP-/SPT-not saw in caucasian populations. The use of a different correction factor (0.85) for ALATOP, optimize the test, showing a good negative predictive value, but raises the question of adapted compositions of screening tests for different populations.

Atopy and enteroparasites.

UNLABELLED: There are not many studies about the intestinal parasitosis (IP) and atopic asthma (AA) relationship, and these show discordant results, possibly due to different studies design and differences in population selection. On the basis of personal results obtained by an epidemiological inquiry designed to estimate the prevalence of enteroparasitoses in asthmatic children and vice vesa, the aim of this study was to compare the prevalence of IP in AA and in a control group (CG) by a cross sectional study using clinical and laboratorial parameters, applied to 63 children (47 with AA and 16 in CG) aged 6 to 11 years, 37 males and 26 females, Caucasians, with the same socioeconomical conditions, consecutively selected in our Hospital. The results showed: The IP in AA children was 21.3%; the IP in CG was 25%; in the group with AA and IP, 40% of them had symptomology of IP; in the CG with IP, 100% had symptoms. CONCLUSIONS: The IP prevalence in AA was not statistically different from the IP in CG (p > 0.05) More data are needed to clarify the significant differences between the symptomatology rates of IP in asthmatic and non asthmatics; the reduced number of patients with symptoms in AA may reflect modulation of IP in AA and/or different parasite load.

Soluble CD30, dehydroepiandrosterone sulfate and dehydroepiandrosterone in atopic and non atopic children.

Elevated levels of soluble CD30-sCD30 (possibly related to Th2) are seen in atopy and other diseases. Dehydroepiandrosterone (DHEA) may regulate Th1/Th2 balance. The aim was to study the relationship between the levels of sCD30, DHEAS and DHEA in atopic (A) and non atopic (B) children, to assess immune-endocrine interactions. We studied 36 children (8-15 years), 18 (A) monosensitised to Dermatophagoides Pteronyssinus (Dpt.), and 18 (B) with isolate rhinitis (R) or asthma (BA) and R (33.3%) without differences in age and sex. They were all HIV negative and free from any medication. It was determined sCD30, DHEAS and DHEA. There was no statistically significant differences between A and B for the levels of DHEAS, DHEA suggesting that the role of this regulation in Th2 type is not important in patients with allergic disease in this age group. sCD30: A-mean 121.1U/ml; B-mean 53.9U/ml. This difference is statistically significant-p = 0.02. sCD30 in patients only with R showed also significant differences-p = 0.01. These results could reflect the Th2 profile. There is an overlap of the values (for R < 80 U/ml; for BA + R < 140 U/ml). Due to this only values > 80 U/ml for R and > 140 U/ml for BA + R could be considered discriminating for atopy.