The novel MFS efflux pump SxtP, regulated by the LysR-type transcriptional activator SxtR, is involved in the susceptibility to sulfamethoxazole/trimethoprim (SXT) and the pathogenesis of Acinetobacter baumannii.

Acinetobacter baumannii is a notorious opportunistic pathogen responsible for healthcare-associated infections worldwide. Efflux pumps play crucial roles in mediating antimicrobial resistance, motility, and virulence. In this study, we present the identification and characterization of the new A. baumannii efflux pump SxtP belonging to the MFS superfamily (major facilitator superfamily), along with its associated activator LysR-type transcriptional regulator (LTTR) SxtR, demonstrating their roles in sulfamethoxazole/trimethoprim (also known as co-trimoxazole or SXT) resistance, surface-associated motility and virulence.

Non-canonical LexA proteins regulate the SOS response in the Bacteroidetes.

Lesions to DNA compromise chromosome integrity, posing a direct threat to cell survival. The bacterial SOS response is a widespread transcriptional regulatory mechanism to address DNA damage. This response is coordinated by the LexA transcriptional repressor, which controls genes involved in DNA repair, mutagenesis and cell-cycle control. To date, the SOS response has been characterized in most major bacterial groups, with the notable exception of the Bacteroidetes. No LexA homologs had been identified in this large, diverse and ecologically important phylum, suggesting that it lacked an inducible mechanism to address DNA damage. Here, we report the identification of a novel family of transcriptional repressors in the Bacteroidetes that orchestrate a canonical response to DNA damage in this phylum. These proteins belong to the S24 peptidase family, but are structurally different from LexA. Their N-terminal domain is most closely related to CI-type bacteriophage repressors, suggesting that they may have originated from phage lytic phase repressors. Given their role as SOS regulators, however, we propose to designate them as non-canonical LexA proteins. The identification of a new class of repressors orchestrating the SOS response illuminates long-standing questions regarding the origin and plasticity of this transcriptional network.

Flexible comparative genomics of prokaryotic transcriptional regulatory networks.

BACKGROUND: Comparative genomics methods enable the reconstruction of bacterial regulatory networks using available experimental data. In spite of their potential for accelerating research into the composition and evolution of bacterial regulons, few comparative genomics suites have been developed for the automated analysis of these regulatory systems. Available solutions typically rely on precomputed databases for operon and ortholog predictions, limiting the scope of analyses to processed complete genomes, and several key issues such as the transfer of experimental information or the integration of regulatory information in a probabilistic setting remain largely unaddressed. RESULTS: Here we introduce CGB, a flexible platform for comparative genomics of prokaryotic regulons. CGB has few external dependencies and enables fully customized analyses of newly available genome data. The platform automates the merging of experimental information and uses a gene-centered, Bayesian framework to generate and integrate easily interpretable results. We demonstrate its flexibility and power by analyzing the evolution of type III secretion system regulation in pathogenic Proteobacteria and by characterizing the SOS regulon of a new bacterial phylum, the Balneolaeota. CONCLUSIONS: Our results demonstrate the applicability of the CGB pipeline in multiple settings. CGB's ability to automatically integrate experimental information from multiple sources and use complete and draft genomic data, coupled with its non-reliance on precomputed databases and its easily interpretable display of gene-centered posterior probabilities of regulation provide users with an unprecedented level of flexibility in launching comparative genomics analyses of prokaryotic transcriptional regulatory networks. The analyses of type III secretion and SOS response regulatory networks illustrate instances of convergent and divergent evolution of these regulatory systems, showcasing the power of formal ancestral state reconstruction at inferring the evolutionary history of regulatory networks.

Roles of Efflux Pumps from Different Superfamilies in the Surface-Associated Motility and Virulence of Acinetobacter baumannii ATCC 17978.

Although the relationship between Acinetobacter baumannii efflux pumps and antimicrobial resistance is well documented, less is known about the involvement of these proteins in the pathogenicity of this nosocomial pathogen. In previous work, we identified the AbaQ major facilitator superfamily (MFS) efflux pump and demonstrated its participation in the motility and virulence of A. baumannii In the present study, we examined the role in these processes of A. baumannii transporters belonging to different superfamilies of efflux pumps. Genes encoding known or putative permeases belonging to efflux pump superfamilies other than the MFS were selected, and the corresponding knockouts were constructed. The antimicrobial susceptibilities of these mutants were consistent with previously reported data. In mutants of A. baumannii strain ATCC 17978 carrying inactivated genes encoding the efflux pumps A1S_2736 (resistance nodulation division [RND]), A1S_3371 (multidrug and toxic compound extrusion [MATE]), and A1S_0710 (small multidrug resistance [SMR]), as well as the newly described ATP-binding cassette (ABC) permeases A1S_1242 and A1S_2622, both surface-associated motility and virulence were reduced compared to the parental strain. However, inactivation of the genes encoding the known ABC permeases A1S_0536 and A1S_1535, the newly identified putative ABC permeases A1S_0027 and A1S_1057, or the proteobacterial antimicrobial compound efflux (PACE) transporters A1S_1503 and A1S_2063 had no effects on bacterial motility or virulence. Our results demonstrate the involvement of antimicrobial transporters belonging at least to five of the six known efflux pump superfamilies in both surface-associated motility and virulence in A. baumannii ATCC 17978.

Functional Characterization of AbaQ, a Novel Efflux Pump Mediating Quinolone Resistance in Acinetobacter baumannii.

Acinetobacter baumannii has emerged as an important multidrug-resistant nosocomial pathogen. In previous work, we identified a putative MFS transporter, AU097_RS17040, involved in the pathogenicity of A. baumannii (M. Pérez-Varela, J. Corral, J. A. Vallejo, S. Rumbo-Feal, G. Bou, J. Aranda, and J. Barbé, Infect Immun 85:e00327-17, 2017, https://doi.org/10.1128/IAI.00327-17). In this study, we analyzed the susceptibility to diverse antimicrobial agents of A. baumannii cells defective in this transporter, referred to as AbaQ. Our results showed that AbaQ is mainly involved in the extrusion of quinolone-type drugs in A. baumannii.

Mutations in the ß-Subunit of the RNA Polymerase Impair the Surface-Associated Motility and Virulence of Acinetobacter baumannii.

Acinetobacter baumannii is a major cause of antibiotic-resistant nosocomial infections worldwide. In this study, several rifampin-resistant spontaneous mutants obtained from the A. baumannii ATCC 17978 strain that differed in their point mutations in the rpoB gene, encoding the ß-subunit of the RNA polymerase, were isolated. All the mutants harboring amino acid substitutions in position 522 or 540 of the RpoB protein were impaired in surface-associated motility and had attenuated virulence in the fertility model of Caenorhabditis elegans The transcriptional profile of these mutants included six downregulated genes encoding proteins homologous to transporters and metabolic enzymes widespread among A. baumannii clinical isolates. The construction of knockout mutants in each of the six downregulated genes revealed a significant reduction in the surface-associated motility and virulence of four of them in the A. baumannii ATCC 17978 strain, as well as in the virulent clinical isolate MAR002. Taken together, our results provide strong evidence of the connection between motility and virulence in this multiresistant nosocomial pathogen.

Comparative genomics of the DNA damage-inducible network in the Patescibacteria.

Metagenomics provide unprecedented insights into the genetic diversity of uncultivated bacteria inhabiting natural environments. Recent surveys have uncovered a major radiation of candidate phyla encompassing the Patescibacteria superphylum. Patescibacteria have small genomes and a presumed symbiotic or parasitic lifestyle, but the difficulty in culturing representative members constrains the characterization of behavioural and adaptive traits. Here we combine in silico and in vitro approaches to characterize the SOS transcriptional response to DNA damage in the Patescibacteria superphylum. Leveraging comparative genomics methods, we identify and experimentally define a novel binding motif for the SOS transcriptional repressor LexA, and we use this motif to characterize the conserved elements of the SOS regulatory network in Patescibacteria. The Patescibacteria LexA-binding motif has unusual direct-repeat structure, and comparative analyses reveal sequence and structural similarities with the distant Acidobacteria LexA protein. Our results reveal a shared core SOS network, complemented by varying degrees of LexA regulation of other core SOS functions. This work illustrates how the combination of computational and experimental methods can leverage metagenomic data to characterize transcriptional responses in uncultivated bacteria. The report of an operational SOS response in presumed symbiotic and parasitic bacteria hints at an intermediate step in the process of genome reduction.

Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii.

Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis.

Moonlighting bacteriophage proteins derepress staphylococcal pathogenicity islands.

Staphylococcal superantigen-carrying pathogenicity islands (SaPIs) are discrete, chromosomally integrated units of approximately 15 kilobases that are induced by helper phages to excise and replicate. SaPI DNA is then efficiently encapsidated in phage-like infectious particles, leading to extremely high frequencies of intra- as well as intergeneric transfer. In the absence of helper phage lytic growth, the island is maintained in a quiescent prophage-like state by a global repressor, Stl, which controls expression of most of the SaPI genes. Here we show that SaPI derepression is effected by a specific, non-essential phage protein that binds to Stl, disrupting the Stl-DNA complex and thereby initiating the excision-replication-packaging cycle of the island. Because SaPIs require phage proteins to be packaged, this strategy assures that SaPIs will be transferred once induced. Several different SaPIs are induced by helper phage 80alpha and, in each case, the SaPI commandeers a different non-essential phage protein for its derepression. The highly specific interactions between different SaPI repressors and helper-phage-encoded antirepressors represent a remarkable evolutionary adaptation involved in pathogenicity island mobilization.

An SOS Regulon under Control of a Noncanonical LexA-Binding Motif in the Betaproteobacteria.

UNLABELLED: The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria, LexA is known to target a palindromic sequence with the consensus sequence CTGT-N8-ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus. In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales. Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria. However, their lexA gene is unrelated to the standard Betaproteobacteria lexA, and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria, suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis-type motif an optimal interface for multiple LexA sequences. IMPORTANCE: Understanding the evolution of transcriptional systems enables us to address important questions in microbiology, such as the emergence and transfer potential of different regulatory systems to regulate virulence or mediate responses to stress. The results reported here constitute the first characterization of a noncanonical LexA protein regulating a standard SOS regulon. This is significant because it illustrates how a complex transcriptional program can be put under the control of a novel transcriptional regulator. Our results also reveal a substantial degree of plasticity in the LexA recognition domain, raising intriguing questions about the space of protein-DNA interfaces and the specific evolutionary constrains faced by these elements.

Differential roles of antimicrobials in the acquisition of drug resistance through activation of the SOS response in Acinetobacter baumannii.

The effect of antimicrobials on SOS-mediated mutagenesis induction depends on the bacterial species and the antimicrobial group. In this work, we studied the effect of different families of antimicrobial agents used in clinical therapy against Acinetobacter baumannii in the induction of mutagenesis in this multiresistant Gram-negative pathogen. The data showed that ciprofloxacin and tetracycline induce SOS-mediated mutagenesis, whereas colistin and meropenem, which are extensively used in clinical therapy, do not.

Role of Acinetobacter baumannii UmuD homologs in antibiotic resistance acquired through DNA damage-induced mutagenesis.

The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from that of the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene, the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

Phagomagnetic separation and electrochemical magneto-genosensing of pathogenic bacteria.

This paper addresses the use of bacteriophages immobilized on magnetic particles for the biorecognition of the pathogenic bacteria, followed by electrochemical magneto-genosensing of the bacteria. The P22 bacteriophage specific to Salmonella (serotypes A, B, and D1) is used as a model. The bacteria are captured and preconcentrated by the bacteriophage-modified magnetic particles through the host interaction with high specificity and efficiency. DNA amplification of the captured bacteria is then performed by double-tagging polymerase chain reaction (PCR). Further detection of the double-tagged amplicon is achieved by electrochemical magneto-genosensing. The strategy is able to detect in 4 h as low as 3 CFU mL(-1) of Salmonella in Luria-Bertani (LB) media. This approach is compared with conventional culture methods and PCR-based assay, as well as with immunological screening assays for bacteria detection, highlighting the outstanding stability and cost-efficient and animal-free production of bacteriophages as biorecognition element in biosensing devices.

RinA controls phage-mediated packaging and transfer of virulence genes in Gram-positive bacteria.

Phage-mediated transfer of microbial genetic elements plays a crucial role in bacterial life style and evolution. In this study, we identify the RinA family of phage-encoded proteins as activators required for transcription of the late operon in a large group of temperate staphylococcal phages. RinA binds to a tightly regulated promoter region, situated upstream of the terS gene, that controls expression of the morphogenetic and lysis modules of the phage, activating their transcription. As expected, rinA deletion eliminated formation of functional phage particles and significantly decreased the transfer of phage and pathogenicity island encoded virulence factors. A genetic analysis of the late promoter region showed that a fragment of 272 bp contains both the promoter and the region necessary for activation by RinA. In addition, we demonstrated that RinA is the only phage-encoded protein required for the activation of this promoter region. This region was shown to be divergent among different phages. Consequently, phages with divergent promoter regions carried allelic variants of the RinA protein, which specifically recognize its own promoter sequence. Finally, most Gram-postive bacteria carry bacteriophages encoding RinA homologue proteins. Characterization of several of these proteins demonstrated that control by RinA of the phage-mediated packaging and transfer of virulence factor is a conserved mechanism regulating horizontal gene transfer.

Systematic In Silico Assessment of Antimicrobial Resistance Dissemination across the Global Plasmidome.

The emergence of pathogenic strains resistant to multiple antimicrobials is a pressing problem in modern healthcare. Antimicrobial resistance is mediated primarily by dissemination of resistance determinants via horizontal gene transfer. The dissemination of some resistance genes has been well documented, but few studies have analyzed the patterns underpinning the dissemination of antimicrobial resistance genes. Analyzing the %GC content of plasmid-borne antimicrobial resistance genes relative to their host genome %GC content provides a means to efficiently detect and quantify dissemination of antimicrobial resistance genes. In this work we automate %GC content analysis to perform a comprehensive analysis of known antimicrobial resistance genes in publicly available plasmid sequences. We find that the degree to which antimicrobial resistance genes are disseminated depends primarily on the resistance mechanism. Our analysis identifies conjugative plasmids as primary dissemination vectors and indicates that most broadly disseminated genes have spread from single genomic backgrounds. We show that resistance dissemination profiles vary greatly among antimicrobials, oftentimes reflecting stewardship measures. Our findings establish %GC content analysis as a powerful, intuitive and scalable method to monitor the dissemination of resistance determinants using publicly available sequence data.

Analysis of the SOS response of Vibrio and other bacteria with multiple chromosomes.

BACKGROUND: The SOS response is a well-known regulatory network present in most bacteria and aimed at addressing DNA damage. It has also been linked extensively to stress-induced mutagenesis, virulence and the emergence and dissemination of antibiotic resistance determinants. Recently, the SOS response has been shown to regulate the activity of integrases in the chromosomal superintegrons of the Vibrionaceae, which encompasses a wide range of pathogenic species harboring multiple chromosomes. Here we combine in silico and in vitro techniques to perform a comparative genomics analysis of the SOS regulon in the Vibrionaceae, and we extend the methodology to map this transcriptional network in other bacterial species harboring multiple chromosomes. RESULTS: Our analysis provides the first comprehensive description of the SOS response in a family (Vibrionaceae) that includes major human pathogens. It also identifies several previously unreported members of the SOS transcriptional network, including two proteins of unknown function. The analysis of the SOS response in other bacterial species with multiple chromosomes uncovers additional regulon members and reveals that there is a conserved core of SOS genes, and that specialized additions to this basic network take place in different phylogenetic groups. Our results also indicate that across all groups the main elements of the SOS response are always found in the large chromosome, whereas specialized additions are found in the smaller chromosomes and plasmids. CONCLUSIONS: Our findings confirm that the SOS response of the Vibrionaceae is strongly linked with pathogenicity and dissemination of antibiotic resistance, and suggest that the characterization of the newly identified members of this regulon could provide key insights into the pathogenesis of Vibrio. The persistent location of key SOS genes in the large chromosome across several bacterial groups confirms that the SOS response plays an essential role in these organisms and sheds light into the mechanisms of evolution of global transcriptional networks involved in adaptability and rapid response to environmental changes, suggesting that small chromosomes may act as evolutionary test beds for the rewiring of transcriptional networks.

Acinetobacter baumannii RecA protein in repair of DNA damage, antimicrobial resistance, general stress response, and virulence.

RecA is the major enzyme involved in homologous recombination and plays a central role in SOS mutagenesis. In Acinetobacter spp., including Acinetobacter baumannii , a multidrug-resistant bacterium responsible for nosocomial infections worldwide, DNA repair responses differ in many ways from those of other bacterial species. In this work, the function of A. baumannii RecA was examined by constructing a recA mutant. Alteration of this single gene had a pleiotropic effect, showing the involvement of RecA in DNA damage repair and consequently in cellular protection against stresses induced by DNA damaging agents, several classes of antibiotics, and oxidative agents. In addition, the absence of RecA decreased survival in response to both heat shock and desiccation. Virulence assays in vitro (with macrophages) and in vivo (using a mouse model) similarly implicated RecA in the pathogenicity of A. baumannii . Thus, the data strongly suggest a protective role for RecA in the bacterium and indicate that inactivation of the protein can contribute to a combined therapeutic approach to controlling A. baumannii infections.

Importance of twitching and surface-associated motility in the virulence of Acinetobacter baumannii.

Acinetobacter baumannii is a pathogen of increasing clinical importance worldwide, especially given its ability to readily acquire resistance determinants. Motile strains of this bacterium can move by either or both of two types of motility: (i) twitching, driven by type IV pili, and (ii) surface-associated motility, an appendage-independent form of movement. A. baumannii strain MAR002 possesses both twitching and surface-associated motility. In this study, we isolated spontaneous rifampin-resistant mutants of strain MAR002 in which point mutations in the rpoB gene were identified that resulted in an altered motility pattern. Transcriptomic analysis of mutants lacking twitching, surface-associated motility, or both led to the identification of deregulated genes within each motility phenotype, based on their level of expression and their biological function. Investigations of the corresponding knockout mutants revealed several genes involved in the motility of A. baumannii strain MAR002, including two involved in twitching (encoding a minor pilin subunit and an RND [resistance nodulation division] component), one in surface-associated motility (encoding an amino acid permease), and eight in both (encoding RND and ABC components, the energy transducer TonB, the porin OprD, the T6SS component TagF, an IclR transcriptional regulator, a PQQ-dependent sugar dehydrogenase, and a putative pectate lyase). Virulence assays showed the reduced pathogenicity of mutants with impairments in both types of motility or in surface-associated motility alone. By contrast, the virulence of twitching-affected mutants was not affected. These results shed light on the key role of surface-associated motility and the limited role of twitching in the pathogenicity of A. baumannii.

Relevance of DNA alkylation damage repair systems in Salmonella enterica virulence.

Systematic inactivation of pathways involved in DNA alkylation damage repair demonstrated that inactivation of the ada, ogt, tag, uvrA, and mfd genes is required to detect a Salmonella enterica virulence decrease. Furthermore, the fitness of S. enterica, defective in these genes, is lowered only when the bacterium is orally, but not intraperitoneally, inoculated.