Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 805
Filtrar
Más filtros

Intervalo de año de publicación
1.
J Endocrinol Invest ; 2024 Jun 15.
Artículo en Inglés | MEDLINE | ID: mdl-38878126

RESUMEN

PURPOSE: The use of thyroid hormones (TH) to treat obesity is unsupported by evidence as reflected in international guidelines. We explored views about this practice, and associations with respondent characteristics among European thyroid specialists. METHODS: Specialists from 28 countries were invited to a survey via professional organisations. The relevant question was whether "Thyroid hormones may be indicated in biochemically euthyroid patients with obesity resistant to lifestyle interventions". RESULTS: Of 17,232 invitations 5695 responses were received (33% valid response rate; 65% women; 90% endocrinologists). Of these, 290 (5.1%) stated that TH may be indicated as treatment for obesity in euthyroid patients. This view was commoner among non-endocrinologists (8.7% vs. 4.7%, p < 0.01), private practice (6.5% vs. 4.5%, p < 0.01), and varied geographically (Eastern Europe, 7.3%; Southern Europe, 4.8%; Western Europe, 2.7%; and Northern Europe, 2.5%). Respondents from Northern and Western Europe were less likely to use TH than those from Eastern Europe (p < 0.01). Gross national income (GNI) correlated inversely with this view (OR 0.97, CI: 0.96-0.97; p < 0.001). Having national guidelines on hypothyroidism correlated negatively with treating obesity with TH (OR 0.71, CI: 0.55-0.91). CONCLUSIONS: Despite the lack of evidence, and contrary to guidelines' recommendations, about 5% of respondents stated that TH may be indicated as a treatment for obesity in euthyroid patients resistant to life-style interventions. This opinion was associated with (i) respondent characteristics: being non-endocrinologist, working in private practice, treating a small number of hypothyroid patients annually and (ii) national characteristics: prevalence of obesity, Eastern Europe, low GNI and lack of national hypothyroidism guidelines.

2.
J Dairy Sci ; 2024 Jul 03.
Artículo en Inglés | MEDLINE | ID: mdl-38969002

RESUMEN

Adipose tissue (AT) expands through both hyperplasia and hypertrophy. During adipogenesis, adipose stromal and progenitor cells (ASPCs) proliferate and then accumulate lipids, influenced by the local AT microenvironment. Increased adipogenic capacity is desirable as it relates to metabolic health, especially in transition dairy cows where excess free fatty acids in circulation can compromise metabolic and immune health. Our aim was to elucidate the depot-specific adipogenic capacity and ECM properties of subcutaneous (SAT) and visceral (VAT) AT of dairy cows and define how the ECM affects adipogenesis. Flank SAT and omental VAT samples were collected from dairy cows in a local abattoir. Tissue samples were utilized for transcriptome analysis, targeted RT-qPCR for adipogenic markers, adipocyte sizing, assessment of viscoelastic properties and collagen accumulation, and then decellularized for native ECM isolation. For in vitro analyses, SAT and VAT samples were digested via collagenase, and ASPCs cultured for metabolic analysis. Adipogenic capacity was assessed by adipocyte size, quantification of ASPCs in stromal vascular fraction (SVF) via flow cytometry, and gene expression of adipogenic markers. In addition, functional assays including lipolysis and glucose uptake were performed to further characterize SAT and VAT adipocyte metabolic function. Data were analyzed using SAS (version 9.4; SAS institute Inc., Cary, NC) and GraphPad Prism 9. Subcutaneous AT adipogenic capacity was greater than VAT's, as indicated by increased ASPCs abundance, increased magnitude of adipocyte ADIPOQ and FASN expression during differentiation, and higher adipocyte lipid accumulation as shown by an increased proportion of larger adipocytes and abundance of lipid droplets. Rheologic analysis revealed that VAT is stiffer than SAT, which led us to hypothesize that differences between SAT and VAT adipogenic capacity were partly mediated by depot-specific ECM microenvironment. Thus, we studied depot-specific ECM-adipocyte crosstalk using a 3D model with native ECM (decellularized AT). Subcutaneous AT and VAT ASPCs were cultured and differentiated into adipocytes within depot-matched and mis-matched ECM for 14d, followed by ADIPOQ expression analysis. Visceral AT ECM impaired ADIPOQ expression in SAT cells. Our results demonstrate that SAT is more adipogenic than VAT and suggest that divergences between SAT and VAT adipogenesis are partially mediated by the depot-specific ECM microenvironment.

3.
BMC Public Health ; 23(1): 441, 2023 03 07.
Artículo en Inglés | MEDLINE | ID: mdl-36882824

RESUMEN

BACKGROUND: COVID-19 pandemic has changed the way pregnancies have been controlled as well as working conditions. In countries with paid leave of work, leaving earlier has been a relevant measure for controlling the pandemic. No study has been published on factors associated with earlier leaving work in pregnancy and the consequences it could have on pregnancy outcomes. OBJECTIVE: We aimed to identify woman and pregnancy characteristics associated with leaving work earlier and its consequences on pregnancy results. METHOD: A cohort study was carried out in Cantabria, Northern Spain, including 760 women who were pregnant in 2020 and were working at the beginning of their pregnancy. Data on pregnancy characteristics and results were obtained from medical records and gestational age at leaving work was self-reported. In a logistic regression analysis, leaving work before 26th week of pregnancy was the main effect variable. RESULTS: Several factors were associated with lower probability of leaving work before 26th week, including university studies (OR = 0.49, 95% CI: 0.36, 0.68), having presential work (OR = 0.57, 95% CI: 0.40, 0.81), women born in non-European countries (OR = 0.55, 95% CI: 0.30, 1.01) and non-smokers (OR for smokers = 1.79, 95% CI: 1.12, 2.87). Neither type of delivery, gestational age at delivery nor other pregnancy results were associated with the gestational age of leaving work. CONCLUSION: Several pregnancy and women characteristics were associated with leaving work earlier in the COVID-19 pandemic, although it was not associated with any pregnancy outcome.


Asunto(s)
COVID-19 , Humanos , Embarazo , Femenino , COVID-19/epidemiología , Estudios de Cohortes , Pandemias , España/epidemiología , Parto
4.
J Exp Bot ; 73(12): 3898-3912, 2022 06 24.
Artículo en Inglés | MEDLINE | ID: mdl-35312760

RESUMEN

While most plants die below a threshold of water content, desiccation-tolerant species display specific responses that allow them to survive extreme dehydration. Some of these responses are activated at critical stages during water loss and could represent the difference between desiccation tolerance (DT) and death. Here, we report the development of a simple and reproducible system to determine DT in Selaginella species. The system is based on exposure of excised tissue to a dehydration agent inside small containers, and subsequent evaluation for tissue viability. We evaluated several methodologies to determine viability upon desiccation including: triphenyltetrazolium chloride (TTC) staining, the quantum efficiency of PSII, antioxidant potential, and relative electrolyte leakage. Our results show that the TTC test is a simple and accurate assay to identify novel desiccation-tolerant Selaginella species, and can also indicate viability in other desiccation-tolerant models (i.e. ferns and mosses). The system we developed is particularly useful to identify critical points during the dehydration process. We found that a desiccation-sensitive Selaginella species shows a change in viability when dehydrated to 40% relative water content, indicating the onset of a critical condition at this water content. Comparative studies at critical stages could provide a better understanding of DT mechanisms and unravel insights into the key responses to survive desiccation.


Asunto(s)
Helechos , Selaginellaceae , Biomarcadores , Deshidratación , Desecación , Agua/fisiología
5.
BMC Geriatr ; 22(1): 224, 2022 03 18.
Artículo en Inglés | MEDLINE | ID: mdl-35303825

RESUMEN

BACKGROUND: Despite the progressive aging of the population in industrialized countries, few studies have focused on the natural history of cardiovascular disease in the very old, and recommendations on prevention of cardiovascular disease in this population are lacking. We aimed to analyze all-cause mortality and cardiovascular events according to prevalent type 2 diabetes mellitus and established cardiovascular disease in nonagenarians from a Mediterranean population. METHODS: We analyzed the primary health records of all nonagenarians living in the Community of Madrid (N = 59,423) and collected data for 4 groups: Group 1, individuals without T2DM or established CVD (T2DM-, CVD-); Group 2, individuals without T2DM but with established CVD (T2DM-, CVD +); Group 3, individuals with T2DM but without established CVD (T2DM + , CVD-); and Group 4, individuals with both T2DM and established CVD (T2DM + , CVD +), taking into account the influence of sex on the outcomes. Follow-up was 2.5 years. The primary outcomes were cumulative incidence and incidence density rates for all-cause mortality, non-fatal myocardial infarction, non-fatal stroke (the first composite primary outcome [CPO1]), combined with heart failure (CPO2). We evaluated the adjusted effect of each group on all-cause mortality (Cox regression). RESULTS: Mean age was 93.3 ± 2.8 years (74.2% women). Hypertension, dyslipidemia, heart failure, albuminuria, and estimated glomerular filtration rate < 60 mL/min/1.73 m2 were significantly more prevalent in G4 than in the other groups (all p values < 0.001). We observed significantly higher cumulative incidence rates for all-cause mortality, CPO1, and CPO2 in participants belonging to G4 (all p values ≤ 0.001). People in G2 presented higher rates of all-cause mortality, heart failure, CPO1, and CPO2 than people in G3 (all p values ≤ 0.001). In the fully adjusted model, G4 independently predicted all-cause mortality (HR = 1.48 [95% CI, 1.40 to 1.57] vs reference G1 [p < 0.01]). In addition, significant HRs were recorded for cardiovascular disease alone (G2) and type 2 diabetes mellitus alone (G3) (1.13 and 1.14, respectively; both p values < 0.01). CONCLUSIONS: In Spanish nonagenarians, established cardiovascular disease and type 2 diabetes mellitus conferred a modest risk of all-cause mortality. However, the simultaneous presence of both conditions conferred the highest risk of all-cause mortality.


Asunto(s)
Enfermedades Cardiovasculares , Diabetes Mellitus Tipo 2 , Insuficiencia Cardíaca , Anciano de 80 o más Años , Enfermedades Cardiovasculares/diagnóstico , Enfermedades Cardiovasculares/epidemiología , Estudios de Cohortes , Diabetes Mellitus Tipo 2/diagnóstico , Diabetes Mellitus Tipo 2/epidemiología , Femenino , Humanos , Masculino , Nonagenarios
6.
Med Oral Patol Oral Cir Bucal ; 27(1): e18-e24, 2022 Jan 01.
Artículo en Inglés | MEDLINE | ID: mdl-34415000

RESUMEN

BACKGROUND: The pandemic caused by SARS-COV-2 has caused an increase in the need of tracheostomies in patients affected with respiratory distress syndrome. In this article we report our experience during a year of pandemic, we develop our surgical technique to perform percutaneous tracheostomy with the patient in apnea and we compare our results with those of other centers through a bibliographic review. MATERIAL AND METHODS: A one-year retrospective clinical study was carried out on tracheotomies performed on patients admitted to the intensive care unit with severe SARS-CoV-2, with difficulty for ventilation or weaning. The technique performed was percutaneous, with fibroscopic control through the endotracheal tube, keeping the patient under apnea during the opening of the airway, reducing by this method the risk of exposure to the virus. RESULTS: From 35 percutaneous tracheotomies performed, 31% of the patients died from respiratory complications due to SARS-COV-2, but none due to the surgical procedure. The most frequent complication (8.5% of patients) was bleeding around the tracheostoma, resolved with local measures. No healthcare provider involved in the performance of the technique had symptoms or was diagnosed with COVID-19. CONCLUSIONS: Our technique of performing percutaneous tracheostomy maintaining apnea during the procedure, under fibroscopic control, has proven to be safe for all those involved in the procedure, and for the patient.


Asunto(s)
COVID-19 , Traqueostomía , Hospitales , Humanos , Pandemias , Respiración Artificial , Estudios Retrospectivos , SARS-CoV-2
7.
J Neuroradiol ; 47(5): 343-348, 2020 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-30098369

RESUMEN

OBJECTIVE: To study the frequency and management of incidental findings in nonenhanced brain MRI of a middle-aged population of type 2 diabetic patients. METHODS: We retrospectively analyzed the results of 289 brain MRI obtained from subjects between 40-75 years recruited from a previous study. Incidental findings were classified into three categories: (1) Vascular findings; (2) neoplastic findings; and (3) others. On the other side, we made a classification of referral findings. To compare our results, we reviewed the prevalence and evidence about management of both incidental and referral findings in other series. RESULTS: We found an overall prevalence of incidental findings of 10.4% (30/289). Incidental findings raised according to age. The most common incidental findings were: 7 vascular (2.4%), 6 calcifications (2.1%), 6 cystic (2.1%) and 5 neoplastic (1.7%) lesions. A percentage of 1.7% (5/289) were referral findings which required further clinical work-up. CONCLUSION: Incidental findings are relatively common in patients with type 2 diabetes. The most frequent are vascular findings, accordance with previous studies. Referral findings are uncommon. Clinical evidence about how to best manage the majority of incidental findings is lacking.


Asunto(s)
Encefalopatías/diagnóstico por imagen , Complicaciones de la Diabetes/diagnóstico por imagen , Imagen por Resonancia Magnética/métodos , Adulto , Factores de Edad , Anciano , Femenino , Humanos , Hallazgos Incidentales , Masculino , Persona de Mediana Edad , Prevalencia , Estudios Retrospectivos
8.
Rev Clin Esp ; 2020 Jul 06.
Artículo en Inglés, Español | MEDLINE | ID: mdl-32646754

RESUMEN

OBJECTIVE: To analyze the clinical and analytical features, diagnostic tests, therapies, and outcomes of pheochromocytoma (PCC). DESIGN AND METHODS: A multicenter retrospective study in surgically treated patients with PCC followed in 3 Spanish tertiary referral hospitals. RESULTS: A total of 106 patients (61 [57.5%] women, mean age 52.3 ± 14.8 years) were evaluated. At diagnosis, PCC was symptomatic in 62% and sporadic in 83%. Patients with familial PCC were significantly younger than those with sporadic disease (40.8 ± 14.2 years vs. 54.5 ± 13.9 years, p<.001). Familial PCCs were more frequently associated with MEN2A (n=8). Levels of 24-h urinary fractionated metanephrines were positively related to tumor size. The maximum tumor diameter was 4.3cm (3-6cm); 27.7% of the patients had tumors ≥6cm. Incidental PCCs were significantly smaller than symptomatic PCCs (3.4cm [2.4-5.0cm] vs. 5.6cm [4.0-7.0cm], p<.001). Scintigraphy by 123I-metaiodobenzylguanidine showed a high sensitivity (81.9%). Preoperative alpha blockade with phenoxybenzamine was used in 93.6% and doxazosin in the rest. Laparoscopic surgery was used in 2/3 of the patients, with a low conversion (1.9%) to open surgery. Perioperative complications appeared in approximately 20% of patients, mainly hypertensive crisis (9.4%). Recurrent disease appeared in 10%, and malignant PCC was uncommon (6.3%). CONCLUSIONS: PCCs surgically treated in Spain are usually large, symptomatic, and sporadic tumors diagnosed around the sixth decade of life. Hereditary PCC is usually associated with MEN2A. The main type of surgical technique used is laparoscopic surgery, and the prevalence of metastatic PCC is low.

9.
Indian J Microbiol ; 60(1): 107-114, 2020 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-32089580

RESUMEN

Mass catering services have increased in the last years since people need to eat out mainly by work or study reasons. Microbiological quality of foodstuffs (n = 156) was evaluated in 20 food establishment (cafes and canteens) of two universities of northern Portugal. Overall, data revealed a high level of microbiological quality of foods served. No safety risks for consumers were detected since Clostridium spp., Listeria monocytogenes and Salmonella spp. were not detected. Among food types, hot meals displayed better microbiological results than cold foods (p < 0.05) as expected. Regarding hot meals, no differences were observed among different types (p > 0.05). Among cold meals, salads displayed the highest microbiological counts for hygiene indicators as well for food foodborne pathogens such as Staphylococcus aureus, Escherichia coli and Bacillus cereus. Although the risk of foodborne disease is scarce since counts were low. In cafes' meals, higher counts were observed than in canteens' meals which indicates that monitoring measures should be improved to avoid potential foodborne outbreaks related to the ready-to-eat products (salads, sandwiches and pastry). Results could be used as microbiological guidelines for canteens. Results indicated that proper food handling and adequate conservation of fresh foods along the food chain is essential in mass catering services to guarantee the food safety.

10.
J Oncol Pharm Pract ; 25(3): 694-698, 2019 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-29199506

RESUMEN

Imatinib mesylate and the newer BCR-ABL tyrosine kinase inhibitors are the standard therapy for chronic myeloid leukemia. Although these are remarkably effective drugs, some mechanisms of resistance have been identified including drug-to-drug interactions. Here we present the case of a chronic myeloid leukemia patient with an inadequate response to imatinib due to concurrent phenytoin administration. Conspicuously low imatinib plasma trough levels were documented. Imatinib dose was increased from 400 to 800 mg with good response. In conclusion, drug-to-drug interactions should be ruled out in cases of resistance to tyrosine kinase inhibitor treatment. Potent inducers of cytochrome P450 isoenzyme CYP3A4, as phenytoin, could induce inadequate responses due to increased imatinib clearance and low imatinib trough plasma levels. Thus, this interaction should be avoided. When this is not possible, dose escalation of imatinib and measurement of plasma levels, if available, is recommended.


Asunto(s)
Antineoplásicos/administración & dosificación , Mesilato de Imatinib/administración & dosificación , Leucemia Mielógena Crónica BCR-ABL Positiva/tratamiento farmacológico , Fenitoína/administración & dosificación , Anciano de 80 o más Años , Citocromo P-450 CYP3A/metabolismo , Interacciones Farmacológicas , Resistencia a Antineoplásicos , Humanos , Masculino , Inhibidores de Proteínas Quinasas/administración & dosificación
11.
J Microsc ; 269(1): 48-58, 2018 01.
Artículo en Inglés | MEDLINE | ID: mdl-28745429

RESUMEN

We present the first study of cuticles and compressions of fossil leaves by Focused Ion Beam Scanning Electron Microscopy (FIB-SEM). Cavities preserved inside fossil leaf compressions corresponding to substomatal chambers have been observed for the first time and several new features were identified in the cross-section cuts. These results open a new way in the investigation of the three-dimensional structures of both micro- and nanostructural features of fossil plants. Moreover, the application of the FIB-SEM technique to both fossils and extant plant remains represent a new source of taxonomical, palaeoenvironmental and palaeoclimatic information.


Asunto(s)
Fósiles/ultraestructura , Iones , Microscopía Electrónica de Rastreo/métodos , Hojas de la Planta/ultraestructura , Imagenología Tridimensional
12.
Arch Virol ; 163(4): 1009-1018, 2018 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-29353424

RESUMEN

Deep sequencing of small RNAs has proved effective in the diagnosis of mycovirus infections. In this study, the presence of mycoviruses in ten isolates of the phytopathogenic fungus Fusarium circinatum was investigated by high-throughput sequencing (HTS) of small RNAs. The contigs resulting from de novo assembly of the reads were aligned to viral genome sequences. The presence of each mycovirus detected in the isolates was confirmed by RT-PCR analysis with four previously described primer pairs and seven new pairs designed on the basis of sequencing data. The findings demonstrate the potential use of HTS for reconstructing previously identified mitoviruses infecting F. circinatum.


Asunto(s)
Virus Fúngicos/genética , Fusarium/virología , Genoma Viral , ARN Citoplasmático Pequeño/genética , ARN Viral/genética , Tracheophyta/microbiología , Mapeo Contig , Virus Fúngicos/clasificación , Virus Fúngicos/aislamiento & purificación , Secuenciación de Nucleótidos de Alto Rendimiento , Filogenia , Enfermedades de las Plantas/microbiología , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa
13.
J Prev Med Hyg ; 58(4): E302-E307, 2017 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-29707661

RESUMEN

OBJECTIVE: We describe an outbreak of VIM-carbapenemase Klebsiella oxytoca (VIM-Kox) in a NICU. MATERIALS AND METHODS: Prospective Epidemiological Surveillance:Systematically (weekly screening cultures) or on admission, if the patient had a history of previous colonization by VIM-Kox.Clinical cultures, done if infection was suspected.Other possible microorganism sources were investigated: their mothers (rectal microbiota), milk packages and preparation apparata in the lactodietary section, echocardiagram transductors, cribs, the sinks (faucets and drains), washing bowls, etc.Molecular typing was performed using the DiversiLab (bioMérieux) system on all VIM-Kox isolated from environment or patients (one by neonate). RESULTS: We identified 20 VIM-Kox cases, the most only presented colonization, but 4 showed infection. Three of the ten sinks (drains) in our NICU, were positive for VIM-Kox. Another four drains harbored P.aeruginosa, S. maltophilia and/or Enterobacter sp. Nevertheless the VIM-Kox bacteria in the sinks (drains) were not the same as those in the patients, who showed three different strains. CONCLUSIONS: A VIM-Kox colonization or infection outbreak in a NICU is described. Rather than environment, not even drains, the source of the outbreak was other patients. The outbreak was relatively brief, as a result of the rapidness with which appropriate measures were taken and followed.


Asunto(s)
Infección Hospitalaria/epidemiología , Brotes de Enfermedades , Contaminación de Equipos , Equipos y Suministros de Hospitales/microbiología , Control de Infecciones/métodos , Unidades de Cuidado Intensivo Neonatal , Infecciones por Klebsiella/epidemiología , Klebsiella oxytoca/aislamiento & purificación , Saneamiento/instrumentación , Proteínas Bacterianas/metabolismo , Infección Hospitalaria/microbiología , Femenino , Hospitales Pediátricos , Humanos , Recién Nacido , Infecciones por Klebsiella/microbiología , Klebsiella oxytoca/enzimología , Masculino , Estudios Prospectivos , España/epidemiología , beta-Lactamasas/metabolismo
14.
Osteoporos Int ; 27(2): 605-16, 2016 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-26318760

RESUMEN

UNLABELLED: Hip fracture is a serious public health problem. We used Spanish hospital discharge data to examine trends in 2004-2013 in the incidence of hip fracture among elderly patients. We found that hip fracture incidence is higher in subjects with than without diabetes and is much higher among women than men. INTRODUCTION: This study aimed to describe trends in the incidence of hip fracture hospitalizations, use of surgical procedures, and hospital outcomes among elderly patients with and without type 2 diabetes mellitus (T2DM) in Spain, 2004-2013. METHODS: We selected all patients with a discharge primary diagnosis of hip fracture using the Spanish national hospital discharge database. Discharges were grouped by diabetes status: Incidences were calculated overall and stratified by diabetes status and year. We analyzed surgical procedures, length of hospital stay (LOHS), and in-hospital mortality (IHM). Multivariate analysis was adjusted by age, year, comorbidity, and in-hospital complications (IHC). RESULTS: From 2004 to 2013, 432,760 discharges with hip fracture were identified (21.3 % suffered T2DM). Incidence among diabetic men and women increased until year 2010 and then remained stable. Diabetic women have three times higher incidence than diabetic men. Incidences and IHC were higher among patients with diabetes beside sex. The proportion of patients that underwent internal fixation increased for all groups of patients and the arthroplasty repair decreased. After multivariate analysis, IHM has improved over the study period for all patients. Suffering diabetes was associated to higher IHM in women (odds ratio (OR) 1.12; 95 % confidence interval (CI) 1.07-1.17). CONCLUSIONS: Hip fracture incidence is higher in subjects with than without diabetes and is much higher among women than men. In diabetic patients, incidence rates increased initially but have leveled from 2010 onwards. For all groups, the use of internal fixation has increased overtime and IHM and LOHS have decreased from 2004 to 2013.


Asunto(s)
Diabetes Mellitus Tipo 2/epidemiología , Fracturas de Cadera/epidemiología , Anciano , Anciano de 80 o más Años , Artroplastia de Reemplazo de Cadera/estadística & datos numéricos , Artroplastia de Reemplazo de Cadera/tendencias , Bases de Datos Factuales , Diabetes Mellitus Tipo 2/complicaciones , Femenino , Fijación Interna de Fracturas/estadística & datos numéricos , Fijación Interna de Fracturas/tendencias , Fracturas de Cadera/complicaciones , Fracturas de Cadera/cirugía , Mortalidad Hospitalaria/tendencias , Hospitalización/estadística & datos numéricos , Hospitalización/tendencias , Humanos , Incidencia , Masculino , Estudios Retrospectivos , Factores Sexuales , España/epidemiología
15.
Nat Prod Rep ; 32(1): 29-48, 2015 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-25315648

RESUMEN

Covering: up to April 2014. The development of drugs with broad-spectrum antiviral activities is a long pursued goal in drug discovery. It has been shown that blocking co-opted host-factors abrogates the replication of many viruses, yet the development of such host-targeting drugs has been met with scepticism mainly due to toxicity issues and poor translation to in vivo models. With the advent of new and more powerful screening assays and prediction tools, the idea of a drug that can efficiently treat a wide range of viral infections by blocking specific host functions has re-bloomed. Here we critically review the state-of-the-art in broad-spectrum antiviral drug discovery. We discuss putative targets and treatment strategies, with particular focus on natural products as promising starting points for antiviral lead development.


Asunto(s)
Antivirales , Productos Biológicos , Descubrimiento de Drogas , Productos Biológicos/farmacología , Sistemas de Liberación de Medicamentos , Humanos , Estructura Molecular
16.
Ann Oncol ; 26(9): 1987-1993, 2015 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-26063633

RESUMEN

BACKGROUND: The management of advanced neuroendocrine tumors (NETs) has recently changed. We assessed the activity of pazopanib after failure of other systemic treatments in advanced NETs. METHODS: This was a multicenter, open-label, phase II study evaluating pazopanib as a single agent in advanced NETs (PAZONET study). The clinical benefit rate (CBR) at 6 months was the primary end point. Translational correlation of radiological response and progression-free survival (PFS) with circulating and tissue biomarkers was also evaluated. RESULTS: A total of 44 patients were enrolled. Twenty-five patients (59.5%) were progression-free at 6 months (4 partial responses, 21 stable diseases) with a median PFS of 9.5 months [95% confidence interval (CI) 4.8-14.1]. The CBR varied according to prior therapy received, with 73%, 60% and 25% in patients treated with prior multitarget inhibitors, prior mTOR inhibitors and both agents, respectively. A nonsignificant increase in PFS was observed in patients presenting lower baseline circulating tumor cell (CTC) counts (9.1 versus 5.8 months; P = 0.22) and in those with decreased levels of soluble-vascular endothelial growth factor receptor-2 (sVEGFR-2) (12.6 versus 9.1 months; P = 0.067). A trend toward reduced survival was documented in patients with VEGFR3 rs307821 and rs307826 missense polymorphisms [hazard ratio (HR): 12.3; 95% CI 1.09-139.2; P = 0.042 and HR: 6.9; 95% CI 0.96-49.9; P = 0.055, respectively]. CONCLUSIONS: Pazopanib showed clinical activity in patients with advanced NETs regardless of previous treatments. Additionally, CTCs, soluble-s VEFGR-2 and VEGFR3 gene polymorphisms constitute potential biomarkers for selecting patients for pazopanib (NCT01280201). CLINICAL TRIAL NUMBER: NCT01280201.


Asunto(s)
Inhibidores de la Angiogénesis/uso terapéutico , Biomarcadores de Tumor/genética , Tumores Neuroendocrinos/tratamiento farmacológico , Neoplasias Pancreáticas/tratamiento farmacológico , Pirimidinas/uso terapéutico , Sulfonamidas/uso terapéutico , Adulto , Anciano , Anciano de 80 o más Años , Inhibidores de la Angiogénesis/efectos adversos , Antineoplásicos/efectos adversos , Antineoplásicos/uso terapéutico , Supervivencia sin Enfermedad , Femenino , Humanos , Indazoles , Estimación de Kaplan-Meier , Masculino , Persona de Mediana Edad , Células Neoplásicas Circulantes , Tumores Neuroendocrinos/mortalidad , Neoplasias Pancreáticas/mortalidad , Polimorfismo de Nucleótido Simple/genética , Modelos de Riesgos Proporcionales , Pirimidinas/efectos adversos , Sulfonamidas/efectos adversos , Resultado del Tratamiento , Receptor 2 de Factores de Crecimiento Endotelial Vascular/genética , Receptor 3 de Factores de Crecimiento Endotelial Vascular/genética
17.
Nano Lett ; 14(2): 774-82, 2014 Feb 12.
Artículo en Inglés | MEDLINE | ID: mdl-24372258

RESUMEN

A liquid metal filament supported on a dielectric substrate was directed to fragment into an ordered, mesoscale particle ensemble. Imposing an undulated surface perturbation on the filament forced the development of a single unstable mode from the otherwise disperse, multimodal Rayleigh-Plateau instability. The imposed mode paved the way for a hierarchical spatial fragmentation of the filament into particles, previously seen only at much larger scales. Ultimately, nanoparticle radius control is demonstrated using a micrometer scale switch.

18.
Environ Monit Assess ; 187(5): 224, 2015 May.
Artículo en Inglés | MEDLINE | ID: mdl-25838060

RESUMEN

Obtaining information about the spatial distribution of desert plants is considered as a serious challenge for ecologists and environmental modeling due to the required intensive field work and infrastructures in harsh and remote arid environments. A new method was applied for assessing the spatial distribution of the halophytic species (HS) in an arid coastal environment. This method was based on the object-based image analysis for a high-resolution Google Earth satellite image. The integration of the image processing techniques and field work provided accurate information about the spatial distribution of HS. The extracted objects were based on assumptions that explained the plant-pixel relationship. Three different types of digital image processing techniques were implemented and validated to obtain an accurate HS spatial distribution. A total of 2703 individuals of the HS community were found in the case study, and approximately 82% were located above an elevation of 2 m. The micro-topography exhibited a significant negative relationship with pH and EC (r = -0.79 and -0.81, respectively, p < 0.001). The spatial structure was modeled using stochastic point processes, in particular a hybrid family of Gibbs processes. A new model is proposed that uses a hard-core structure at very short distances, together with a cluster structure in short-to-medium distances and a Poisson structure for larger distances. This model was found to fit the data perfectly well.


Asunto(s)
Ambiente , Monitoreo del Ambiente/métodos , Plantas/clasificación , Plantas Tolerantes a la Sal/clasificación , Modelos Teóricos , Tolerancia a la Sal , Análisis Espacial , Procesos Estocásticos
19.
J Endocrinol Invest ; 37(2): 135-41, 2014 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-24497212

RESUMEN

OBJECTIVE: Male hypogonadism is common in the elderly and has been associated with increased risk of mortality. Our objective has been to assess the prevalence of primary and central hypogonadism in elderly male patients admitted to the hospital because of acute illness. We also evaluated the relationships between gonadal dysfunction and in-hospital mortality. PATIENTS AND METHODS: 150 patients, aged ≥65 years, admitted during 2010 and 2011 in our geriatric unit, were studied. Serum concentrations total, bioavailable and free testosterone, as well as of follicle-stimulating hormone and luteinizing hormone were quantified in every patient. Hypogonadism was defined by the presence of serum testosterone levels lower than 200 ng/dl. RESULTS: Hypogonadism was found in 80 patients (53.3 %). Serum gonadotropin concentrations were elevated in 43.7 % of these patients, whereas 41.3 % of hypogonadic patients showed normal and 15 % low gonadotropin concentrations. Respiratory tract infection and congestive heart failure were the main causes of hospitalization in hypogonadal men, whereas acute cerebrovascular disease was the main reason for admission in eugonadal patients. Of the 13 patients who died during hospitalization, 12 were hypogonadic. Patients who died showed significantly lower serum levels of total, free and bioavailable testosterone than those found in patients who survived. CONCLUSION: Our results show that about half of patients admitted for acute illness have hypogonadism, mainly of non-hypergonadotropic type. Gonadal hypofunction is significantly related with in-hospital mortality. A low value of serum testosterone may be a predictor for mortality in elderly male patients.


Asunto(s)
Anciano , Hospitalización/estadística & datos numéricos , Hipogonadismo/diagnóstico , Hipogonadismo/epidemiología , Anciano de 80 o más Años , Envejecimiento/sangre , Estudios Transversales , Gonadotropinas/sangre , Mortalidad Hospitalaria , Humanos , Hipogonadismo/sangre , Hipogonadismo/terapia , Masculino , Prevalencia , Pronóstico , Testosterona/sangre
20.
Plant Dis ; 98(3): 425, 2014 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-30708423

RESUMEN

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 µm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 µm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 µm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA