Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 1 de 1
Filtrar
Más filtros

Banco de datos
Tipo del documento
País de afiliación
Intervalo de año de publicación
1.
Mol Ther ; 31(4): 1136-1158, 2023 04 05.
Artículo en Inglés | MEDLINE | ID: mdl-36793212

RESUMEN

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.


Asunto(s)
COVID-19 , Vacunas Virales , Humanos , SARS-CoV-2/genética , Transducción de Señal , ARN Mensajero/genética
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA