A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Transformation performance and subsystem coupling of resource-based cities in China: An analysis based on the support-pressure framework.

The sustainable development of resource-based cities is vital to China's high-quality development. Based on the support-pressure framework, this study simplifies the city system into an economy-society subsystem (ESS) and a resource-environment subsystem (RES), and measures the economy social developmental level (ESDL) and resource environmental carrying capacity (RECC) of China's 116 resource-based cities using the improved entropy-TOPSIS model. Then, it applies the coupling coordination degree (CCD) and relative development models to explore their coupling coordination relationships and relative developmental types. The results are as follows. (1) The ESDL and RECC of China's resource-based cities have improved significantly, and there is a large divergence between cities in different regions, development stages, and dominant resource types. (2) The CCD between the ESDL and RECC of China's resource-based cities is still not ideal, and no city qualifies for the high coordination category. (3) Overall, the RECC lags behind the ESDL, and the cities with a lagging ESDL are concentrated in the western and northeastern regions. Based on these conclusions, three specific suggestions are put forth. This study may provide a scientific reference for the Chinese government to formulate a sustainable development plan for resource-based cities. Integr Environ Assess Manag 2022;18:770-783. © 2021 SETAC.

A novel variant of GLI3, p.Asp1514Thrfs*5, is identified in a Chinese family affected by polydactyly.

BACKGROUND: Polydactyly is a common congenital malformation characterized by the presence of supernumerary fingers or toes. In this case study, we sought to identify the causative pathogenic factor in a family from a northern region of China affected by non-syndromic postaxial polydactyly (PAP). METHODS: After recruiting a three-generation family with PAP, whole-exome sequencing was performed to identify the causative variant. In silico analysis and Sanger sequencing were used to validate the variant. RESULTS: We identified a novel heterozygous frameshift variant (NM_000168.6:c.4540delG, p.Asp1514Thrfs*5) in the transcriptional activator (TA1) domain of the GLI3 gene. CONCLUSION: The novel frameshift variant identified in this study further confirms the relationship between non-syndromic PAP and GLI3 and extends the previously established mutational and phenotypic spectra of GLI3.

Perceived Subgroups, TMS, and Team Performance: The Moderating Role of Guanxi Perception.

As teams become increasingly common for organizations to accomplish key objectives, improving team performance is a critical challenge for both practitioners and researchers. As researchers have converged on the notion that team performance is strongly influenced by subgroups, scholars have begun to explore how perception of subgroups influence team performance. Thus, in this study, we examined how perceived subgroups influenced the team transactive memory system (TMS), and hence team performance. We also proposed the moderating role of guanxi perception on the relationship between perceived subgroups and TMS. Utilizing two-wave multi-source data from 87 working teams in a Chinese central government-owned corporation, and based on multiple (moderator) hierarchical regression analyses, our results demonstrated that perceived subgroups were a negative predictor of TMS and team performance, and TMS mediated the negative relationship between perceived subgroups and team performance. That is, perceived subgroups inhibited team performance by blocking the development of a robust TMS. In addition, guanxi perception acted as a positive moderator, mitigating the negative relationship between perceived subgroups and TMS. Furthermore, the moderated mediation analysis of the integrative model revealed that the indirect effect of perceived subgroups on team performance via TMS was contingent on guanxi perception. Overall, our findings identified the pivotal role of perceived subgroups, TMS, and guanxi perception in working teams in the Chinese context.

Effects of local delivery of BMP2, zoledronate and their combination on bone microarchitecture, biomechanics and bone turnover in osteoporotic rabbits.

The hip fracture is one major clinical challenge associated with osteoporosis, resulting in heavy socioeconomic burdens and high mortality. Systemic therapies of anti-osteoporosis drugs are expensive, time-consuming and also evoke substantial side effects, which fails to provide early protection from fractures. Accumulating evidence demonstrates the high bioavailability and therapeutic efficacy of local drug delivery in accelerating facture healing and bone defect repair. This study aims at investigating the effects of local delivery of BMP2 and zoledronate (two promising anabolic/anti-catobolic reagents) encapsulated by fibrin sealants into femoral necks on regulating bone quality and remodeling in osteoporotic rabbits subjected to combined ovariectomy and glucocorticoid injection. We show that 6-week BMP2 delivery exhibited more prominent effect on mitigating trabecular bone microarchitecture deterioration and mechanical strength reduction of femoral necks than local zoledronate treatment. BMP2 plus zoledronate showed more significant improvement of bone microstructure, mechanical strength and bone formation rate at 12 weeks post injection than single BMP2 or zoledronate delivery via µCT, biomechanical, histomorphometric and serum biochemical analyses. This study enriches our knowledge for understanding the availability of local drug delivery for improving bone quantity and quality, which may lead to earlier, safer and more efficient protection from osteoporosis-induced fractures in clinics.