Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 58
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Mymensingh Med J ; 26(3): 684-688, 2017 07.
Artículo en Inglés | MEDLINE | ID: mdl-28919629

RESUMEN

Acinar cell carcinoma (ACC) of the pancreas is a very rare neoplasm. We report a case of pancreatic acinar cell carcinoma involving the uncinate process of the pancreas. A 45 year old man presented with a painful upper abdominal mass without any jaundice or weight loss. Computed Tomography (CT) and Magnetic Resonance Cholangio-Pancreatography (MRCP) indicated a mass lesion in the uncinate process of the pancreas. He underwent Whipple's procedure (Pancreaticoduodenectomy). Histological slides revealed features of Acinar cell carcinoma (ACC) in the uncinate process of the pancreas and a lymph node.


Asunto(s)
Carcinoma de Células Acinares , Neoplasias Pancreáticas , Carcinoma de Células Acinares/cirugía , Humanos , Ganglios Linfáticos , Masculino , Persona de Mediana Edad , Neoplasias Pancreáticas/cirugía , Pancreaticoduodenectomía , Tomografía Computarizada por Rayos X
2.
Mymensingh Med J ; 26(3): 490-497, 2017 07.
Artículo en Inglés | MEDLINE | ID: mdl-28919600

RESUMEN

Upper gastrointestinal hemorrhage (UGIH) is one of the most common and life-threatening gastrointestinal emergency. There are several risk scores for risk stratification in UGIB patients. The Modified Blatchford score, which relies only on clinical and laboratory parameters, is practical in the emergency setting The Modified Blatchford scoring system also known as Glasgow Blatchford Scoring (GBS) have been developed to stratify risk of non variceal upper gastrointestinal hemorrhage or need of medical or surgical intervention, endoscopic therapy. Objective of this study is to see risk stratification by The Modified Blatchford score and short term hospital outcome in non variceal upper GI hemorrhage patients. The observational study was carried out over a period of 6 months from October, 2014 to March, 2015 in Department of Department of Medicine, Gastroenterology and Surgery Mymensingh Medical College Hospital, Mymensingh. A total of 120 patients with non variceal UGIH were taken for the study during study period. Categorical variables were reported as percentage and Means and proportions were carried out using the Chi-square test (X2-test) of different variables by SPSS software version-18.0. Patients related variables age, sex; and main outcome variables the Modified Blatchford scoring system, Risk stratification, and short term hospital outcome were observed. Age frequency among total cases were 66(55%) <60 years, 50(41.67%) from 60-79 years and 4(3.3%) 80 years or above and sex distribution were 84(70%) were male and 36(30%) were female patients. Blatchford score of patients 1(0.83%) had score 0, 1(0.83%) had score 1, 2(1.67%) had score 2, 2(1.67%) had score 3, 2(1.67%) had score 4, 3(2.5%) had score 5, 12(10%) had score 6; 15(12.5%) had score 7, 16(13.33%) had score 8, 17(14.17%) had score 9, 16(13.33%) had score 10, 15(12.5%) had score 11, 10(8.33%) had score 12, 4(3.33% ) had score 13, 1(0.83%) had score 14, 2(1.67%) had score 15 and 1(0.83%) had score 16. Risk stratification showed 54(45%) had low risk (Mean GBS score 6.19±1.79), 66(55%) had high risk (Mean GBS score 11.03±1.83) Outcome of the patients were observed that 1(0.83%) died, 54(45%) was discharged without any medical or surgical intervention, and 65(54.17%) patients' needs medical or surgical intervention such as blood transfusion and endoscopy. Among total 120 patients with upper GI hemorrhage I have found that GBS score of three or less than three is predictive of low risk of adverse outcomes and can be discharged without any intervention.


Asunto(s)
Hemorragia Gastrointestinal , Adulto , Transfusión Sanguínea , Femenino , Hemorragia Gastrointestinal/diagnóstico , Hemorragia Gastrointestinal/terapia , Hospitales , Humanos , Masculino , Estudios Retrospectivos , Medición de Riesgo , Índice de Severidad de la Enfermedad
3.
Gen Comp Endocrinol ; 238: 4-12, 2016 11 01.
Artículo en Inglés | MEDLINE | ID: mdl-27080547

RESUMEN

Previous studies examining the reproductive health of alligators in Florida lakes indicate that a variety of developmental and health impacts can be attributed to a combination of environmental quality and exposures to environmental contaminants. The majority of these environmental contaminants have been shown to disrupt normal endocrine signaling. The potential that these environmental conditions and contaminants may influence epigenetic status and correlate to the health abnormalities was investigated in the current study. The red blood cell (RBC) (erythrocyte) in the alligator is nucleated so was used as an easily purified marker cell to investigate epigenetic programming. RBCs were collected from adult male alligators captured at three sites in Florida, each characterized by varying degrees of contamination. While Lake Woodruff (WO) has remained relatively pristine, Lake Apopka (AP) and Merritt Island (MI) convey exposures to different suites of contaminants. DNA was isolated and methylated DNA immunoprecipitation (MeDIP) was used to isolate methylated DNA that was then analyzed in a competitive hybridization using a genome-wide alligator tiling array for a MeDIP-Chip analysis. Pairwise comparisons of alligators from AP and MI to WO revealed alterations in the DNA methylome. The AP vs. WO comparison identified 85 differential DNA methylation regions (DMRs) with ⩾3 adjacent oligonucleotide tiling array probes and 15,451 DMRs with a single oligo probe analysis. The MI vs. WO comparison identified 75 DMRs with the ⩾3 oligo probe and 17,411 DMRs with the single oligo probe analysis. There was negligible overlap between the DMRs identified in AP vs. WO and MI vs. WO comparisons. In both comparisons DMRs were primarily associated with CpG deserts which are regions of low CpG density (1-2CpG/100bp). Although the alligator genome is not fully annotated, gene associations were identified and correlated to major gene class functional categories and pathways of endocrine relevance. Observations demonstrate that environmental quality may be associated with epigenetic programming and health status in the alligator. The epigenetic alterations may provide biomarkers to assess the environmental exposures and health impacts on these populations of alligators.


Asunto(s)
Caimanes y Cocodrilos/genética , Epigénesis Genética , Lagos/química , Contaminación del Agua , Animales , Animales Salvajes , Islas de CpG/genética , Metilación de ADN/genética , Florida , Geografía , Masculino , Transducción de Señal/genética
4.
ScientificWorldJournal ; 2016: 2796720, 2016.
Artículo en Inglés | MEDLINE | ID: mdl-27127800

RESUMEN

The study was conducted to investigate genetic variability among 113 aromatic and fine local rice genotypes of which five were exotic in origin. The test genotypes were evaluated for 19 growth traits, yield components, and yield. All the quantitative traits varied significantly among the test genotypes. High heritability along with high genetic advance was observed for flag leaf area, secondary branches per panicle, filled grains per panicle, grain length, grain breadth, grain length breadth ratio, and 1000 grain weight. Such findings suggested preponderance of additive gene action in gene expression for these characters. Grain yield was significantly and positively correlated with days to flowering, days to maturity, panicle length, filled grains per panicle, and 1000 grain weight. According to D (2) cluster analysis, 113 test genotypes formed 10 clusters. Selection of parents from the clusters V and X followed by hybridization would possibly result in desirable heterosis for the development of heterotic rice hybrids. Finally, molecular characterizations of the studied germplasm are required for high resolution QTL mapping and validating the presence of candidate genes responsible for valuable characters.


Asunto(s)
Oryza/genética , Carácter Cuantitativo Heredable , Semillas/genética , Análisis de Varianza , Bangladesh , Análisis por Conglomerados , Ecotipo , Genotipo , Análisis de Componente Principal
5.
Mymensingh Med J ; 24(2): 326-33, 2015 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-26007261

RESUMEN

The present study was undertaken to find the role of dietary intervention and physical exercise on serum bilirubin level in IGT subjects. Thirty three newly detected otherwise healthy subjects with IGT, aged 35-63 years, were randomly selected to participate in a 12 weeks diet and exercise program. Nine participants were within 35-40 years while majority fifteen participants aged 41-50 years and rest six participants were above 50 (51-63) years. A male preponderance was observed among the study participants where 53.3% of the total participants were male (n=16) and 46.7% were female (n=14). Mean bilirubin (mg/dl) level was recorded 0.68 ± 0.29 at base line and with follow-up, the value was 0.66 ± 0.26 mg/dl. For men (n=16), serum bilirubin were 0.77 ± 0.39 and 0.75 ± 0.36 mg/dl at base line and follow-up while for women (n=14), the values were 0.67 ± 0.33 and 0.59 ± 0.28 mg respectively. The 35-40 years group (n=9) showed bilirubin from 0.66 ± 0.23 at base line to 0.73 ± 0.19 mg/dl at follow-up while 41-50 years group (n=15) had 0.70 ± 0.34 and 0.58 ± 0.26 mg/dl and for 51-63 years group (n=6), the values were 0.65 ± 0.29 and 0.73 ± 0.33 mg/dl respectively. Participants with BMI 20-25 had bilirubin 0.62 ± 0.29 mg/dl at base line and 0.71 ± 0.21 mg/dl at follow-up while with BMI >25 (n=20) had 0.71 ± 0.30 and 0.63 ± 0.2 8 mg/dl respectively. No significant changes in serum bilirubin were observed among the groups and therefore, the dietary intervention and physical exercise during the period did not have a significant role in this respect.


Asunto(s)
Intolerancia a la Glucosa , Adulto , Bilirrubina , Ejercicio Físico , Femenino , Humanos , Masculino , Persona de Mediana Edad
6.
Mymensingh Med J ; 24(2): 341-5, 2015 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-26007263

RESUMEN

DeQuervain's disease of the first dorsal compartment of the wrist, is a common wrist pathology, pain results from resisted gliding of the abductor pollicis longus and the extensor pollicis brevis tendon in the fibroosseous canal. Management of resistant cases of DeQuervain's disease with failed conservative treatment treated by surgical decompression yield satisfactory outcomes. A large number of patients being dissatisfied with the medical treatment, still present with persistent pain and positive clinical finding. Surgical decompression is an effective method for the treatment of resistant cases of DeQuervain's disease. Outcome variables were measured by Scheller, Forget and Macey evaluation criteria. Most of our patients were female 28(93.3%), housewife 17(56.7%) with mean age of 41.57 years, ranging from 25-60 years. Right sided involvement was 20(66.7%) and Left sided involvement was 10(33.3%). Restricted movement of thumb in 30(100%) were the predominant symptoms. One (3.3%) patient develop chronic tenosynovitis, 1(3.3%) patient develop hypertrophic scar. There was no wound infection in the follow-up period of 3-18 months. Satisfactory results were found in 29(96.7%).


Asunto(s)
Descompresión Quirúrgica , Adulto , Femenino , Humanos , Masculino , Persona de Mediana Edad , Tendones , Tenosinovitis , Pulgar
7.
Plant Dis ; 98(3): 425, 2014 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-30708423

RESUMEN

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 µm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 µm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 µm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

8.
Environ Technol ; 35(1-4): 407-15, 2014.
Artículo en Inglés | MEDLINE | ID: mdl-24600881

RESUMEN

Semiconductor-mediated hydrogen peroxide-assisted photocatalytic degradation of a selected herbicide, Bentazone (1) has been investigated in aqueous suspensions of TiO2 under a variety of conditions. The degradation was studied by monitoring the depletion in total organic carbon content as a function of irradiation time. The degradation kinetics was investigated under different conditions such as type of TiO2 (Anatase/Anatase-Rutile mixture), reaction pH, catalyst dosage and hydrogen peroxide (H202) concentration. The degradation rates were found to be strongly influenced by all the above parameters. Titanium dioxide Degussa P25 was found to be more efficient as compared with other two commercially available TiO2 powders like Hombikat UV100 and PC500 from Millennium Inorganic Chemicals. Gas Chromatography-Mass Spectrometry (GC-MS) analysis of the irradiated mixture of Bentazone (1) indicates the formation of several intermediate products which have been characterized on the basis of molecular ion/mass fragmentation pattern and also on comparison with the National Institute of Standards and Technology (NIST) library. Plausible mechanism for the formation of different products during photocatalytic treatment of Bentazone in the presence of TiO2 has been proposed. The use of H202 substantially increased the efficiency of TiO2 photocatalytic degradation.


Asunto(s)
Benzotiadiazinas/química , Herbicidas/química , Minerales/química , Titanio/química , Contaminantes Químicos del Agua/química , Purificación del Agua/métodos , Agua/química , Benzotiadiazinas/aislamiento & purificación , Benzotiadiazinas/efectos de la radiación , Herbicidas/aislamiento & purificación , Herbicidas/efectos de la radiación , Luz , Fotoquímica/instrumentación , Fotoquímica/métodos , Semiconductores , Suspensiones , Titanio/efectos de la radiación , Contaminantes Químicos del Agua/aislamiento & purificación , Contaminantes Químicos del Agua/efectos de la radiación , Purificación del Agua/instrumentación
9.
Mymensingh Med J ; 33(2): 533-539, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38557537

RESUMEN

In biliary-pancreatic malignancy, the serum CA 19-9 is considered as a tumor marker. Its high level may indicate the presence of a malignant disorder, but it can also be raised in benign conditions and also in malignancies from other organs. The value may be normal even in malignant condition. This comparative study was conducted in the Department of Surgery of Bangabandhu Sheikh Mujib Medical University (BSMMU), Bangladesh from 1st June 2016 to 31st May 2017 to determine the sensitivity and specificity of CA 19-9 as a tumor marker in pancreatic malignancy in our perspective and to establish a cut-off value of CA 19-9 which might prove as a definitive indication of pancreatic malignancy. We found that when the cut off value of CA 19-9 is 38 U/ml (according to ROC curve), the sensitivity, specificity, PPV and NPV were 77.8%, 77.8%, 77.8%, 77.8% respectively. And if the serum CA 19-9 threshold was raised to 100 and 120 to diagnose pancreatic cancer, sensitivity became 72.2% and 66.7% and NPV 76.2% and 73.9% respectively. However, the specificity increased to 88.9% and 94.4% and the PPV increased to 86.7% and 92.3% respectively.


Asunto(s)
Biomarcadores de Tumor , Neoplasias Pancreáticas , Humanos , Sensibilidad y Especificidad , Curva ROC , Neoplasias Pancreáticas/diagnóstico , Bangladesh
10.
Mymensingh Med J ; 22(2): 410-2, 2013 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-23715372

RESUMEN

Metastatic squamous cell carcinoma of spleen is a very rare occurrence and a very small number of cases have been reported so far, mostly in autopsy series. More commonly observed metastasis to the spleen are from breast, lungs, colorectal organs and ovaries. Interestingly enough the spleen is very unusual site of metastasis from an esophageal malignancy, only very few cases (four cases up to 2005) being reported in the literature. A case of splenic metastasis from carcinoma of the esophagus in a 60 years old woman is presented in this report. Extraordinary merit of this case is that carcinoma of the esophagus was diagnosed after the patient had been operated for splenic abscess and was histologically diagnosed as metastatic squamous cell carcinoma of spleen. The patient underwent splenectomy and recovered well. Only during post operative period endoscopic examination of upper GIT with biopsy revealed carcinoma of the esophagus. Further investigations failed to delineate any other organ involvement. So, this case is being reported as metastatic squamous cell carcinoma of spleen from carcinoma of esophagus.


Asunto(s)
Carcinoma de Células Escamosas/secundario , Neoplasias Esofágicas/patología , Neoplasias del Bazo/secundario , Diagnóstico Diferencial , Resultado Fatal , Femenino , Humanos , Persona de Mediana Edad
11.
Mymensingh Med J ; 22(2): 281-8, 2013 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-23715349

RESUMEN

Carcinoma rectum is a challenging problem both for the developed and underdeveloped countries. Colorectal cancer accounts for 9% of all cancer deaths (49,920) in 2009 in USA. Carcinoma involving the lower part of the rectum is now successfully managed by sphincter saving surgery with less morbidity and uneventful recovery. To observe the objective, subjective and functional outcome of the patients suffering from cancer of the lower third of the rectum managed by surgical intervention with preservation of sphincter. A comparative study was carried out on 54 patients with low rectal cancer who underwent ultra-low anterior resection in the department of surgery, Bangabandhu Sheikh Mujib Medical University, Dhaka from January 2009 to December 2010. Patients were divided into two groups depending on the tumor distance from anal verge. Thirty one (57%) patients were in Group A (Experimental) where tumor distance was 5cm from anal verge and upper 1cm of anal sphincter was sacrificed during surgical intervention. Twenty three (43%) patients were in Group B (Control) where tumor distance was 6cm from anal verge and whole length (4cm) of anal sphincter was preserved during surgical intervention. Functional integrity of anal sphincter was assessed between these two groups of patients following surgery. The mean age of the patients was 45.96±14.41 years. During surgery, ultra low anterior resection was performed to remove the tumor in all patients and for anastomosis double stapling technique was performed in 52(96%) patients and hand sewn technique was performed in 2(4%) patients irrespective of tumor distance from anal verge. Covering ileostomy was fashioned in all but one patient. During post-operative follow up anal sphincter muscle tone, anal sphincter function (Anal continence, p = 0.54), Quality of life (Social life, p = 0.54; Professional life, p = 0.23; House work and Need a diaper, p = 0.54) were not significantly impaired in both groups. Functional outcome of anal sphincter muscle and quality of life was not impaired in comparison to general population after low rectal cancer surgery.


Asunto(s)
Canal Anal/cirugía , Neoplasias del Recto/cirugía , Adolescente , Adulto , Anciano , Distribución de Chi-Cuadrado , Femenino , Humanos , Masculino , Persona de Mediana Edad , Estadificación de Neoplasias , Recuperación de la Función , Neoplasias del Recto/patología , Resultado del Tratamiento
12.
Mymensingh Med J ; 22(2): 413-6, 2013 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-23715373

RESUMEN

Infection with Burkholderia pseudomallei has been described, albeit rarely, patients in Bangladesh. Infection usually follows percutaneous inoculation or inhalation of the causative bacterium, which is present in soil and surface water in the endemic region. A 35-year-young male farmer presented with prolonged fever and significant weight loss. Patient gradually deteriorated despite getting different antibiotics including intravenous ceftriaxone and metronidazole. Panels of investigations were done which revealed no diagnostic confirmation except uncontrolled diabetes and multiple abscesses in different organs. Melioidosis was suspected and serum samples were positive for Burkholderia pseudomallei antibody. The case illustrates the importance of non-specific nature of the clinical presentation and high index of suspicion of uncommon diseases like melioidosis where the disease has not been considered as an endemic.


Asunto(s)
Melioidosis/diagnóstico , Adulto , Antibacterianos/uso terapéutico , Diagnóstico Diferencial , Quimioterapia Combinada , Humanos , Masculino , Melioidosis/tratamiento farmacológico
13.
Mymensingh Med J ; 32(3): 787-793, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-37391975

RESUMEN

A hospital-acquired infection (HAI) is acquired in a hospital or other health care facilities. This is an extra burden in every unit of hospital as it increases the morbidity, mortality, cost of treatment and also duration of the hospital stays for the patients. This study aimed to find out the causative bacterial agents of HAI from different clinical samples and their antimicrobial susceptibility patterns. This was a cross-sectional descriptive study conducted in the Department of Microbiology and Virology, Sylhet MAG Osmani Medical College, in collaboration with in-patient departments of Sylhet MAG Osmani Medical College Hospital from January 2019 to December 2019. A total of 123 patients of different ages, sex were enrolled in this study. Samples were collected from postoperative wounds, post catheterized urinary tract infections, diabetic wounds and intravenous cannula from Surgery ward, Medicine ward and Obstetrics & Gynecology ward. Standard laboratory procedures were applied to isolate and identify the bacteria. The identified organisms were then tested for anti biogram. Among 123 patients 46 (37.4%) were affected by hospital acquired infections. Higher prevalence (n=28, 60.87%) of HAI was found in Surgery ward and the lower prevalence (n=9, 19.56%) was found in Medicine ward and Obstetrics & Gynecology ward. The most common type of infection was surgical wound infection (20, 43.48%). Out of all the HAIs irrespective of source and site, highest number were done by Staphylococcus aureus (15, 30.61%) followed by Pseudomonas aeruginosa (08, 16.33%), Escherichia coli (07, 14.29%), Serratia spp. (05, 6.12%), Aeromonas spp. (05, 6.12%), Acinetobacter spp. (02, 4.08%), Proteus spp. (02, 4.08%), Citrobacter spp. (02, 4.08%), Klebsiella spp. (02, 4.08%), CoNS (02, 4.08%), Enterobacter spp. (01, 2.04%) and Morganella morganii (01, 2.04%). The antimicrobial susceptibility data suggested that Gram positive bacteria are more susceptible to doxycycline, vancomycin and linezolid; while Gram negative bacteria were more susceptible to imipenem, levofloxacin and meropenem.


Asunto(s)
Antiinfecciosos , Infecciones Estafilocócicas , Femenino , Embarazo , Humanos , Estudios Transversales , Centros de Atención Terciaria , Bangladesh , Escherichia coli
14.
Mymensingh Med J ; 32(3): 833-840, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-37391982

RESUMEN

When performing infra-umbilical procedures, caudal epidural analgesia with bupivacaine is frequently used to provide both intra- and post-operative analgesia. Dexmedetomidine, an alpha 2 agonistsare extensively used in neuraxial blocks and peripheral nerve blocks to prolong the action of bupivacaine. To find out the effects of dexmedetomidine as an adjuvant to bupivacaine for caudal analgesia in children undergoing infra-umbilical surgery. This was a randomized, controlled double-blinded prospective observational study and was performed from July 2019 to December 2019. A total of 60 (Sixty) patients with different infra-umbilical surgical problems underwent different procedure under caudal anaesthesia in different operation theatre in Bangabandhu Sheikh Mujib Medical University, Dhaka were enrolled in this study. Elaborate personal history, meticulous clinical examinations and relevant laboratory investigations was done. Post-operative adverse effects also were monitored. All information from history of illness, clinical, laboratory findings, duration of analgesia and post-operative adverse effects were recorded in a preformed data sheet (Appendix-I) and statistical analysis was done by SPSS 22.0. Mean age of the children in Group A (dexmedetomidine + bupivacaine) was 5.50±2.61 years and in Group B (bupivacaine) was 5.66±2.75. Mean weight of the children in Group A was 19.22±8.58 kg and in Group B was 19.70±8.94 kg in this study. Mean duration of anaesthesia was 27.5±6.5 minute in Group A and 28.5±5.5 minute in Group B. The mean duration of analgesia was 4.32±0.54 hours for Group A and 2.12±0.32 hours in Group B. In Group A, 46.7% patients required 1 and 3.3% required 2 rescue analgesic but in Group B, 43.3% patients required single rescue analgesic and 33.3% required two rescue analgesics (p<0.05). In Group A, 6.7% patients had nausea/ vomiting and in Group B, 16.7% patients had nausea/ vomiting (p>0.05). It can be concluded that dexmedetomidine with bupivacaine for caudal analgesia in infra-umbilical surgery significantly prolongs the duration of postoperative analgesia when compared to bupivacaine alone without any side-effects.


Asunto(s)
Analgesia , Dexmedetomidina , Efectos Colaterales y Reacciones Adversas Relacionados con Medicamentos , Humanos , Niño , Preescolar , Bupivacaína/uso terapéutico , Dexmedetomidina/uso terapéutico , Bangladesh , Náusea
15.
Mymensingh Med J ; 32(4): 1140-1148, 2023 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-37777913

RESUMEN

When healthy women undergo caesarean section (CS) under sub arachnoid anaesthesia, transient electrocardiographic changes, such as ST-segment depression and T-wave abnormalities, are observed. During an elective caesarean section under sub arachnoid anaesthesia, about one-third of healthy parturient experience chest pain and ECG changes suggestive of myocardial ischemia. To assess the ST-segment and Rate Pressure Product changes with chest pain in patients with elective caesarean section under subarachnoid block. The Department of Anesthesia, Analgesia and Intensive Care Medicine at Bangabandhu Sheikh Mujib Medical University (BSMMU), Bangladesh was the site of this prospective observational study. The study included 86 healthy women between the ages of 20 and 35 who needed an elective caesarean section under a single shot sub arachnoid block and who visited the Department of Anesthesia, Analgesia, and Intensive Care Medicine at BSMMU in Shahbagh, Dhaka from January 2019 to June 2019. In comparison to the no chest pain group, ST-segment changes among the chest pain group at delivery, 5 minute, 10 minute after delivery and at the end of the surgery were highly significant (p=0.001). Comparatively, Rate Pressure Product changes were found to be significantly higher in the group with chest pain than in the group without chest pain (p=0.001). It is concluded that there is a substantial association of chest pain with rate pressure product and ST-segment changes after subarachroid block in caesarean section.


Asunto(s)
Anestesia Raquidea , Isquemia Miocárdica , Humanos , Femenino , Embarazo , Adulto Joven , Adulto , Cesárea/efectos adversos , Bangladesh , Dolor en el Pecho/diagnóstico , Dolor en el Pecho/etiología
16.
Mymensingh Med J ; 32(2): 534-541, 2023 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-37002768

RESUMEN

Failed Tracheal Intubation with Subsequent inability to maintain an open airway and adequate oxygenation is the most frequent cause of brain damage or death during anesthesia. Recognizing before anesthesia the potential for difficult intubation allows time for optimal preparation. Proper Selection of equipment and techniques is needed to avoid unwanted situation. To find out difficulties associated with endotracheal intubation using Modified Mallampati Test (MMT) combined with Thyromental Height Test (TMHT) and MMT without TMHT. This prospective observational study was conducted at the Department of Anesthesia in Bangabandhu Sheikh Mujib Medical University (BSMMU), Dhaka, Bangladesh from April 2018 to September 2018. Two hundred two patients with different surgical procedures under general anaesthesia in different operation theaters of BSMMU, Dhaka were selected as study population. After taking written consents from each patient or his/her attendant elaborate history of illness, meticulous clinical examinations were performed and relevant laboratory investigations were done. All information was recorded in a preformed data sheet and statistical analysis was done by SPSS-22.0. Mean age ±SD of the study subjects was 42.49±14.29 years in MMT with TMHT group and 43.40±15.39 years in MMT without TMHT group. Females were enrolled more than males in both the groups. BMI was 28.75±3.59kg/m² in MMT with TMHT group and 29.44±8.64kg/m² in MMT without TMHT group. There were no significant differences in age, gender and BMI between the groups. Sensitivity, specificity, PPV, NPV and accuracy were 100.0%, 96.0%, 96.2%, 100.0% and 98.0% respectively of MMT with TMHT in predicting intubation difficulty. Sensitivity, specificity, PPV, NPV and accuracy were 100.0%, 96.0%, 96.2%, 100.0% and 98.0% respectively of MMT only in predicting intubation difficulty. MMT combined with TMHT is a better predictor of intubation difficulty than MMT alone.


Asunto(s)
Intubación Intratraqueal , Laringoscopía , Humanos , Masculino , Femenino , Laringoscopía/métodos , Bangladesh , Intubación Intratraqueal/métodos , Tráquea , Anestesia General
17.
Mymensingh Med J ; 21(2): 251-8, 2012 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-22561767

RESUMEN

The aim of this study was to investigate mental illnesses among the substance abuse dependent populations. A total of 1076 substance abusers were recruited from the Outpatient Department of the Central Drug Addiction Treatment Center, Tejgaon, Dhaka from July 2008 to June 2009. They sought detoxification therapy voluntarily at this centre. The research participants were selected consecutively following the defined selection criteria. Research instruments were interviewer-administered questionnaire and standard mental state examination scales. Of the 1076 substance abusers, 82.6% had been using heroin currently and rest of them used phensedyl followed by injection drugs and cannabis with a period ranged 2-30 years. Results showed that 91.3% of the substance abusers had been suffering from insomnia and 75.0% had altered food habit. About 49.0% showed disturbed behaviors and 45.2% had been suffering from sexual dysfunctions. Around 32.0% of the substance abusers had been suffering from nonspecific generalized anxieties and 72.7% were found in abnormal mood/affects. A striking finding was that 7.3% of the substance abusers had been suffering from perceptual and/or thought disturbances. In conclusion, 7.3%-92.5% of the substance abusers had been suffering from mental illnesses. Insomnias, decreased intake of food and taste preference, irritable mood/affects, loss of interest in sex and non-specific anxieties were highly prevalent among them. Medical management and altering lifestyle are still the only applicable way to control this human catastrophe.


Asunto(s)
Trastornos Mentales/epidemiología , Trastornos Relacionados con Sustancias/epidemiología , Adolescente , Adulto , Bangladesh/epidemiología , Comorbilidad , Diagnóstico Dual (Psiquiatría) , Humanos , Masculino , Persona de Mediana Edad , Adulto Joven
18.
Mymensingh Med J ; 21(2): 207-12, 2012 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-22561760

RESUMEN

Lifestyle is composed of cultural and behavioural patterns and lifelong personal habits that developed through processes of socialization. Lifestyle may be health promotive or detrimental to health. Health requires the promotion of healthy lifestyle. Many current day health problems are associated with lifestyle changes. Because of rising urban population, the number of slum dwellers is rising. The mobility of people from rural to urban areas is the main reason of the growing slum population in cities. This Descriptive, cross-sectional study was directed to assess lifestyle pattern in four purposively selected slums in Mymensingh Municipal area. Non-Probability purposive type of sampling technique was used for selecting the study unit. Sample size was one hundred and twenty-three (123) families. Data were collected by interview with one of the adult family members, preferably with the head of the family, with mixed type of interviewer administered questionnaire. There were 494 family members with an average family size of 4.02, while mean age was 24.58 years with a standard deviation (SD) of 17.79 years. Male-female ratio was 103:100. Of 409 members over 5 years, 174(42.54%) did not have schooling and were illiterate. At least 105(33.02%) members were house-wives, and 99(81.15%) members were smokers. An overwhelming majority (79, 64.23%) families had monthly income between 2000 to 4999 taka. As many as 55(44.72%) families lived in kaccha house, while 40(32.52%) had to live in "Jhupree". In cent per cent families, tube well was the source of water for drinking and other household purposes. A highest majority 121(98.37%) of the families had latrine, while the remaining 2(1.63%) did not have any latrine, and defecate in open air. Of 121 families, 78(64.46%) families had sanitary latrine, while 43(37.54%) did not have sanitary latrine. It was revealed that 86(69.92%) families had cell-phone, while 65(52.85%) families had television, 10(8.13%) families had radio, and 5(4.06%) families had DVD/VCR for recreational facilities. As many as 75(60.98%) respondents had correct knowledge, while the rest 48(39.02%) had incorrect knowledge on hand washing. Of 75, at least 66(88.00%) respondents practiced hand washing, while 9(12.00%) respondents did not practice it. As many as 110(89.43%) members sought medical help for major and minor illness of their family members, whereas the rest 13(10.57%) families did not. Of 110, 62(56.36%) families paid visit to government Hospital, while 22(20.00%) visited to private clinic, 12(10.90%) to pharmacy, 10(9.10%) to qualified doctors and 4(3.64%) to the traditional healers. As many as 58(52.71%) respondents mentioned that they preferred as the facilities cater service free of cost, while 32(29.10%) preferred for better and effective treatment, 16(14.55%) for close to their residence and 4(7.27%) for their belief. Living condition of slum dwellers is considerably low due to low income and inadequate education. Moreover, poor physical environment with unsanitary excreta disposal method is commonplace in slum areas. Existing lifestyle of slum dwellers is unacceptable, and should be improved so that they can contribute to the national development.


Asunto(s)
Estilo de Vida , Áreas de Pobreza , Población Urbana , Adolescente , Adulto , Bangladesh , Niño , Composición Familiar , Femenino , Desinfección de las Manos , Conocimientos, Actitudes y Práctica en Salud , Vivienda , Humanos , Masculino , Factores Socioeconómicos , Adulto Joven
19.
Mymensingh Med J ; 21(2): 265-9, 2012 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-22561769

RESUMEN

Evaluating short-term (03 months) efficacy and safety of transurethral intraprostatic injection of absolute ethanol to treat benign prostatic hyperplasia (BPH). This intervention study was conducted to evaluate 30 patients with benign prostatic hyperplasia treated by transurethral injection of dehydrated ethanol. Mean age was 69.96 years. Endoscopic injection of 6-13.5 ml ethanol was carried out at 4-8 sites in the prostate. International Prostate Symptom Score (IPSS), maximum flow rate, prostate volume, postvoid residual and side effects or complications were measured postoperatively. Mean IPSS (SD) improved significantly from 18.43 ± 2.38 preoperatively to 6.80 ± 1.34 at 03 months of follow-up, mean peak urinary flow rate increased from 7.33 ± 1.19 ml/s to 16.31 ± 1.69 ml/s after 3 months, mean residual urine volume had decreased from 54.16 ± 30.93 ml to 17.01 ± 9.59 ml after 3 months (p<0.05). The prostate volume decreased from 44.66 ± 9.52 gm preoperatively to 32.46 ± 7.78 gm after 3 months (statistically significant at 5% level). There were no intra-operative complications but post-operative haematuria occurred in two patients, urinary retention occurred in two patients after removal of the catheter. Urinary tract infection developed in one patient. Transurethral ethanol ablation of prostate appears to be safe and cost effective. No occurrence of retrograde ejaculation was detected. The short-term effects of ethanol injection at prostate were satisfactory and acceptable as a minimally invasive therapeutic modality in selected patients.


Asunto(s)
Técnicas de Ablación , Etanol/administración & dosificación , Próstata/patología , Hiperplasia Prostática/tratamiento farmacológico , Solventes/administración & dosificación , Anciano , Humanos , Inyecciones Intralesiones/efectos adversos , Masculino , Persona de Mediana Edad , Tamaño de los Órganos/efectos de los fármacos , Próstata/efectos de los fármacos , Hiperplasia Prostática/patología , Urodinámica
20.
Mymensingh Med J ; 31(1): 112-116, 2022 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-34999689

RESUMEN

Rotavirus is responsible for acute severe watery diarrhoea in young children. Early and rapid detection of Rotavirus infection can help to reduce inappropriate administration of antibiotics and has future positive impact on prevention of drug resistance. This cross-sectional study was designed to determine the role of Rotaviral antigen detection by ICT from stool sample of acute diarrhoeal children below five years admitted in Sylhet MAG Osmani Medical College Hospital, Sylhet and was carried out in the Department of Microbiology in collaboration with the Department of Paediatrics during the period from 1st January 2018 to 31st December 2018. Total 184 children of under five years of age with acute watery diarrhoea were enrolled in this study. Rotaviral antigen was detected by ELISA (Enzyme Linked Immunosorbent Assay) and ICT (Immunochromatographic test) from stool samples. Out of 184 stool samples, Rotaviral antigen was found positive in 84 and 86 cases by ICT and ELISA methods, respectively. ICT showed sensitivity of 90.70% and specificity of 93.88% when compared with ELISA. The Rotavirus infection was found highest in male children (61.90%) and in age group of 7 to 12 months (51.89%). Considering the importance of Rotaviral diarrhoea, rapid detection of Rotavirus infection by ICT is essentially needed and might be practiced routinely as it is relatively reliable, easy to perform and cost-effective. It is particularly important in Bangladesh, where diarrhoea is still contributing a significant proportion of morbidity and mortality in under five children.


Asunto(s)
Infecciones por Rotavirus , Rotavirus , Bangladesh/epidemiología , Niño , Preescolar , Estudios Transversales , Diarrea/diagnóstico , Heces , Humanos , Lactante , Masculino , Infecciones por Rotavirus/diagnóstico , Centros de Atención Terciaria
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA