SARS-CoV-2-specific immunoglobulin Y antibodies are protective in infected mice.

Safe, passive immunization methods are required against severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) and its variants. Immunization of chickens with antigen is known to induce specific IgY antibodies concentrated in the egg yolk and has a good safety profile, high yield of IgY per egg, can be topically applied, not requiring parenteral delivery. Our data provide the first evidence of the prophylactic efficacy of Immunoglobulin Y antibodies against SARS-CoV-2 in mice. Lohmann hens were injected with recombinant SARS-CoV-2 RBD protein; IgY-Abs were extracted from the eggs and characterized using SDS-PAGE. Antiviral activity was evaluated using plaque reduction neutralization tests. In additional experiments, IgY-RBD efficacy was examined in mice sensitized to SARS-CoV-2 infection by transduction with Ad5-hACE2 (mild disease) or by using mouse-adapted virus (severe disease). In both cases, prophylactic intranasal administration of IgY-Abs reduced SARS-CoV-2 replication, and reduced morbidity, inflammatory cell infiltration, hemorrhage, and edema in the lungs and increased survival compared to control groups that received non-specific IgY-Abs. These results indicate that further evaluation of IgY-RBD antibodies in humans is warranted.

2D MXenes Nanosheets for Advanced Energy Conversion and Storage Devices: Recent Advances and Future Prospects.

Since the initial MXenes were discovered in 2011, several MXene compositions constructed using combinations of various transition metals have been developed. MXenes are ideal candidates for different applications in energy conversion and storage, because of their unique and interesting characteristics, which included good electrical conductivity, hydrophilicity, and simplicity of large-scale synthesis. Herein, we study the current developments in two-dimensional (2D) MXene nanosheets for energy storage and conversion technologies. First, we discuss the introduction to energy storage and conversion devices. Later, we emphasized on 2D MXenes and some specific properties of MXenes. Subsequently, research advances in MXene-based electrode materials for energy storage such as supercapacitors and rechargeable batteries is summarized. We provide the relevant energy storage processes, common challenges, and potential approaches to an acceptable solution for 2D MXene-based energy storage. In addition, recent advances for MXenes used in energy conversion devices like solar cells, fuel cells and catalysis is also summarized. Finally, the future prospective of growing MXene-based energy conversion and storage are highlighted.

A potential association between obesity and reduced effectiveness of COVID-19 vaccine-induced neutralizing humoral immunity.

Due to the adverse effects of obesity on host immunity, this study investigated the effectiveness of COVID-19 vaccines (BNT162b2, ChAdOx-nCov-2019, and mRNA-1273) in inducing anti-SARS-CoV-2 Spike (S) neutralizing antibodies among individuals with various obesity classes (class I, II, III, and super obesity). Sera from vaccinated obese individuals (n = 73) and normal BMI controls (n = 46) were subjected to S-based enzyme-linked immunosorbent assay (ELISA) and serum-neutralization test (SNT) to determine the prevalence and titer of anti-SARS-CoV-2 neutralizing antibodies. Nucleocapsid-ELISA was also utilized to distinguish between immunity acquired via vaccination only versus vaccination plus recovery from infection. Data were linked to participant demographics including age, gender, past COVID-19 diagnosis, and COVID-19 vaccination profile. S-based ELISA demonstrated high seroprevalence rates (>97%) in the study and control groups whether samples with evidence of past infection were included or excluded. Interestingly, however, SNT demonstrated a slightly significant reduction in both the rate and titer of anti-SARS-CoV-2 neutralizing antibodies among vaccinated obese individuals (60/73; 82.19%) compared to controls (45/46; 97.83%). The observed reduction in COVID-19 vaccine-induced neutralizing humoral immunity among obese individuals occurs independently of gender, recovery from past infection, and period from last vaccination. Our data suggest that COVID-19 vaccines are highly effective in inducing protective humoral immunity. This effectiveness, however, is potentially reduced among obese individuals which highlight the importance of booster doses to improve their neutralizing immunity. Further investigations on larger sample size remain necessary to comprehensively conclude about the effect of obesity on COVID-19 vaccine effectiveness on humoral immunity induction.

Mouth rinses efficacy on salivary SARS-CoV-2 viral load: A randomized clinical trial.

Considering the global trend to confine the COVID-19 pandemic by applying various preventive health measures, preprocedural mouth rinsing has been proposed to mitigate the transmission risk of SARS-CoV-2 in dental clinics. The study aimed to investigate the effect of different mouth rinses on salivary viral load in COVID-19 patients. This study was a single-center, randomized, double-blind, six-parallel-group, placebo-controlled clinical trial that investigated the effect of four mouth rinses (1% povidone-iodine, 1.5% hydrogen peroxide, 0.075% cetylpyridinium chloride, and 80 ppm hypochlorous acid) on salivary SARS-CoV-2 viral load relative to the distilled water and no-rinse control groups. The viral load was measured by quantitative reverse transcription PCR (RT-qPCR) at baseline and 5, 30, and 60 min post rinsing. The viral load pattern within each mouth rinse group showed a reduction overtime; however, this reduction was only statistically significant in the hydrogen peroxide group. Further, a significant reduction in the viral load was observed between povidone-iodine, hydrogen peroxide, and cetylpyridinium chloride compared to the no-rinse group at 60 min, indicating their late antiviral potential. Interestingly, a similar statistically significant reduction was also observed in the distilled water control group compared to the no-rinse group at 60 min, proposing mechanical washing of the viral particles through the rinsing procedure. Therefore, results suggest using preprocedural mouth rinses, particularly hydrogen peroxide, as a risk-mitigation step before dental procedures, along with strict adherence to other infection control measures.

Fix and pull technique for retrieval of intracoronary unexpanded-stent entrapment.

During left main (LM) bifurcation PCI using T and small protrusion (TAP) technique, after deployment of LM-left anterior descending (LAD) stent, left circumflex (LCx) stent was entangled at LM ostium with balloon and wire slippage. Ping-pong (dual) guide catheters were used to simultaneously fix the LM-LAD stent and snare the trapped stent. This technique proved effective in retrieving the lost stent and minimizing LM stent deformation.

Numerical analysis of magnetohydrodynamics in an Eyring-Powell hybrid nanofluid flow on wall jet heat and mass transfer.

The customization of hybrid nanofluids to achieve a particular and controlled growth rate of thermal transport is done to meet the needs of applications in heating and cooling systems, aerospace and automotive industries, etc. Due to the extensive applications, the aim of the current paper is to derive a numerical solution to a wall jet flow problem through a stretching surface. To study the flow problem, authors have considered a non-Newtonian Eyring-Powell hybrid nanofluid with water and CoFe2O4and TiO2nanoparticles. Furthermore, the impact of a magnetic field and irregular heat sink/source are studied. To comply with the applications of the wall jet flow, the authors have presented the numerical solution for two cases; with and without a magnetic field. The numerical solution is derived with a similarity transformation and MATLAB-based bvp4c solver. The value of skin friction for wall jet flow at the surface decreases by more than 50% when the magnetic fieldMA=0.2is present. The stream function value is higher for the wall jet flow without the magnetic field. The temperature of the flow rises with the dominant strength of the heat source parameters. The results of this investigation will be beneficial to various applications that utilize the applications of a wall jet, such as in car defrosters, spray paint drying for vehicles or houses, cooling structures for the CPU of high-processor laptops, sluice gate flows, and cooling jets over turbo-machinery components, etc.

Sugarcane-bagasse-ash in enhanced mesophilic Co-digestion for biogas and nutrient recovery: A concept of developing rural circular bioeconomy.

Conductive agro-industrial wastes as accelerants in the anaerobic digestion (AD) of organic waste is a good technique for developing a rural circular economy, such as producing bioenergy and biofertilizer. This study disclosed the a role of sugar cane bagasse ash (SCBA) in enhancing the bioenergy (biogas) yield and digestate fertility via anaerobic co-digestion (AcoD) of buffalo dung (BD) and vegetable residue (VR) under mesophilic conditions (37 á´¼C). Firstly, an optimal BD/VR ratio (1:3) was determined based on biogas yield by introducing five different BD/VR ratios (1:0, 3:1, 1:1, 1:3, and 0:1) into AcoD systems. Secondly, the biogas yield was increased further by adding SCBA at five different concentrations (0, 0.5, 1, 1.5, and 2 wt%). Experimental results disclosed that the 1.5 wt% of SCBA gave the highest cumulative biogas yield (153.67 mL/g VS), COD removal rate (31.18%), and fertility (5.08%). Moreover, a framework is suggested to understand the role of SCBA in the enhanced DIET mechanism. This work documents an environmentally friendly and economical technique for developing a rural circular bioeconomy via the AD of organic agro-waste.

Chloroplast Sec14-like 1 (CPSFL1) is essential for normal chloroplast development and affects carotenoid accumulation in Chlamydomonas.

Plastid isoprenoid-derived carotenoids serve essential roles in chloroplast development and photosynthesis. Although nearly all enzymes that participate in the biosynthesis of carotenoids in plants have been identified, the complement of auxiliary proteins that regulate synthesis, transport, sequestration, and degradation of these molecules and their isoprenoid precursors have not been fully described. To identify such proteins that are necessary for the optimal functioning of oxygenic photosynthesis, we screened a large collection of nonphotosynthetic (acetate-requiring) DNA insertional mutants of Chlamydomonas reinhardtii and isolated cpsfl1 The cpsfl1 mutant is extremely light-sensitive and susceptible to photoinhibition and photobleaching. The CPSFL1 gene encodes a CRAL-TRIO hydrophobic ligand-binding (Sec14) domain protein. Proteins containing this domain are limited to eukaryotes, but some may have been retargeted to function in organelles of endosymbiotic origin. The cpsfl1 mutant showed decreased accumulation of plastidial isoprenoid-derived pigments, especially carotenoids, and whole-cell focused ion-beam scanning-electron microscopy revealed a deficiency of carotenoid-rich chloroplast structures (e.g., eyespot and plastoglobules). The low carotenoid content resulted from impaired biosynthesis at a step prior to phytoene, the committed precursor to carotenoids. The CPSFL1 protein bound phytoene and ß-carotene when expressed in Escherichia coli and phosphatidic acid in vitro. We suggest that CPSFL1 is involved in the regulation of phytoene synthesis and carotenoid transport and thereby modulates carotenoid accumulation in the chloroplast.

Segmentation-Less, Automated, Vascular Vectorization.

Recent advances in two-photon fluorescence microscopy (2PM) have allowed large scale imaging and analysis of blood vessel networks in living mice. However, extracting network graphs and vector representations for the dense capillary bed remains a bottleneck in many applications. Vascular vectorization is algorithmically difficult because blood vessels have many shapes and sizes, the samples are often unevenly illuminated, and large image volumes are required to achieve good statistical power. State-of-the-art, three-dimensional, vascular vectorization approaches often require a segmented (binary) image, relying on manual or supervised-machine annotation. Therefore, voxel-by-voxel image segmentation is biased by the human annotator or trainer. Furthermore, segmented images oftentimes require remedial morphological filtering before skeletonization or vectorization. To address these limitations, we present a vectorization method to extract vascular objects directly from unsegmented images without the need for machine learning or training. The Segmentation-Less, Automated, Vascular Vectorization (SLAVV) source code in MATLAB is openly available on GitHub. This novel method uses simple models of vascular anatomy, efficient linear filtering, and vector extraction algorithms to remove the image segmentation requirement, replacing it with manual or automated vector classification. Semi-automated SLAVV is demonstrated on three in vivo 2PM image volumes of microvascular networks (capillaries, arterioles and venules) in the mouse cortex. Vectorization performance is proven robust to the choice of plasma- or endothelial-labeled contrast, and processing costs are shown to scale with input image volume. Fully-automated SLAVV performance is evaluated on simulated 2PM images of varying quality all based on the large (1.4×0.9×0.6 mm3 and 1.6×108 voxel) input image. Vascular statistics of interest (e.g. volume fraction, surface area density) calculated from automatically vectorized images show greater robustness to image quality than those calculated from intensity-thresholded images.

Anhedonia induced by high-fat diet in mice depends on gut microbiota and leptin.

Objectives: Imbalanced nutrition and obesity are risk factors for depression, a relationship that in rodents can be modeled by depression-like behavior in response to high-fat diet (HFD). In this work, we examined the role of the intestinal microbiota and the adipocytokine leptin as potential mediators of the effects of HFD to induce anhedonia-like behavior and reduce self-care in mice.Methods: Male mice were fed a control diet or HFD (60 kJ% from fat) for a period of 4 weeks, after which behavioral tests and molecular analyses (gut microbiome composition, intestinal metabolome, fecal fatty acids, plasma hormone levels) were performed. The role of the intestinal microbiota was addressed by selective depletion of gut bacteria with a combination of non-absorbable antibiotics, while the implication of leptin was examined by the use of leptin-deficient ob/ob mice.Results: Antibiotic treatment reduced the HFD-induced weight gain and adiposity and prevented HFD-induced anhedonia-like behavior and self-care reduction. These effects were associated with a decrease in fecal fatty acids and intestinal microbiota-related metabolites including short-chain fatty acids, glucose and amino acids. Gut microbiota depletion suppressed the HFD-induced rise of plasma leptin, and the circulating leptin levels correlated with the anhedonia-like behavior and reduced self-care caused by HFD. The anhedonic effect of HFD was absent in leptin-deficient ob/ob mice although these animals gained more weight and adiposity in response to HFD than wild-type mice.Discussion: The results indicate that anhedonia-like behavior induced by HFD in mice depends on the intestinal microbiome and involves leptin as a signaling hormone.

Ameliorative effect of selenium yeast supplementation on the physio-pathological impacts of chronic exposure to glyphosate and or malathion in Oreochromis niloticus.

BACKGROUND: Pesticide exposure is thought to be a major contributor to living organism health deterioration, as evidenced by its impact on both cultured fish species and human health. Commercial fish diets are typically deficient in selenium (Se); hence, supplementation may be necessary to meet requirements during stress. Therefore, this study was conducted to investigate the protective role of selenium yeast (SY) supplementation for 60 days against the deleterious effects of glyphosate and or malathion chronic toxicity at sublethal concentrations in Oreochromis niloticus . METHODS: Two hundred and ten fish were divided into seven groups (n = 30/group) as follows: G1 (negative control); G2 (2 mg L- 1 glyphosate); G3 (0.5 mg L- 1 malathion); G4 (glyphosate 1.6 mg L- 1 and malathion 0.3 mg L- 1); G5 (glyphosate 2 mg L- 1 and SY 3.3 mg kg- 1); G6 (malathion 0.5 mg L- 1 and SY 3.3 mg kg- 1); and G7 (glyphosate 1.6 mg L- 1; malathion 0.3 mg L- 1 and SY 3.3 mg kg- 1). RESULTS: Results revealed significant alteration in growth performance parameters including feed intake (FI), body weight (BW), body weight gain (BWG), specific growth rate (SGR), feed conversion ratio (FCR), and protein efficiency ratio (PER). G4 has the highest documented cumulative mortalities (40%), followed by G3 (30%). Additionally, the greatest impact was documented in G4, followed by G3 and then G2 as severe anemia with significant thrombocytopenia; leukocytosis; hypoproteinemia; increased Alanine aminotransferase (ALT) and Aspartate aminotransferase (AST), urea, and creatinine, as well as malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione peroxidase (GPx). Considering the previously mentioned parameters, selenium yeast (Saccharomyces cerevisiae) (3.3 mg kg- 1 available selenium) mitigated the negative impact of both the agrochemicals, whether exposed singly or in combination, in addition to their antioxidative action. CONCLUSIONS: In conclusion, our study found that organophosphorus agrochemicals, single or combined, had negative impacts on Oreochromis niloticus regarding growth performance, biochemical and hematological changes in the serum, as well as induced oxidative damage in liver and kidney tissues. Supplementation of SY at the rate of 3.3 mg kg- 1 diet (2.36 mg kg- 1 selenomethionine and 0.94 mg organic selenium) ameliorated the fish performance and health status adversely affected by organophosphorus agrochemical intoxication.

Longevity of Middle East Respiratory Syndrome Coronavirus Antibody Responses in Humans, Saudi Arabia.

Understanding the immune response to Middle East respiratory syndrome coronavirus (MERS-CoV) is crucial for disease prevention and vaccine development. We studied the antibody responses in 48 human MERS-CoV infection survivors who had variable disease severity in Saudi Arabia. MERS-CoV-specific neutralizing antibodies were detected for 6 years postinfection.

Percutaneous nephrolithotomy versus extracorporeal shock wave lithotripsy for renal insufficiency.

OBJECTIVE: To assess the effect and outcome of percutaneous nephrolithotomy (PNL) versus extracorporeal shock wave lithotripsy (SWL) in patients with renal insufficiency. PATIENTS AND METHODS: A prospective randomized clinical study of 104 renal insufficiency patients with renal stones (serum creatinine 2-4 mg/dl and eGFR < 60 ml/min/1.73 m2 more than 3 months) randomized into two groups: Group A underwent PNL; Group B underwent shock wave lithotripsy (SWL). Treatment effects and outcomes compared between the two groups. RESULTS: Between Group A of 50 patients and Group B of 54 cases, demographic data showed no statistically significant differences. The stone-free rate was 84% in Group A versus 26.6% in Group B after the first SWL session. After completion of all SWL sessions, the rate was 88.9% for Group B. Comparing pre and postoperative results of Group A, there is significant improvement of serum creatinine concentrations by 9.1% (p = 0.001), significant improvement of creatinine clearance (p = 0.000) and eGFR (p = 0.003). Although regarding Group B preoperatively and 3 months after SWL there is significant improvement by 8.7% (p = 0.0001), which is less than that of Group A, there is also, improvement of eGFR by 6.7% (p = 0.001), which is less than the eGFR improvement in Group A (12.3%). But there is no statistically significant difference is noted for creatinine clearance in Group B (p = 0.09). CONCLUSION: The outcomes for PNL and SWL in patients with renal insufficiency and renal stones are encouraging as minimally invasive procedures with no negative effects on kidney function.

Amotosalen and ultraviolet A light treatment efficiently inactivates severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in human plasma.

BACKGROUND AND OBJECTIVES: During the ongoing pandemic of COVID-19, SARS-CoV-2 RNA was detected in plasma and platelet products from asymptomatic blood donors, raising concerns about potential risk of transfusion transmission, also in the context of the current therapeutic approach utilizing plasma from convalescent donors. The objective of this study was to assess the efficacy of amotosalen/UVA light treatment to inactivate SARS-CoV-2 in human plasma to reduce the risk of potential transmission through blood transfusion. METHODS: Pools of three whole-blood-derived human plasma units (630-650 ml) were inoculated with a clinical SARS-CoV-2 isolate. Spiked units were treated with amotosalen/UVA light (INTERCEPT Blood System™) to inactivate SARS-CoV-2. Infectious titres and genomic viral load were assessed by plaque assay and real-time quantitative PCR. Inactivated samples were subject to three successive passages on permissive tissue culture to exclude the presence of replication-competent viral particles. RESULTS: Inactivation of infectious viral particles in spiked plasma units below the limit of detection was achieved by amotosalen/UVA light treatment with a mean log reduction of >3·32 ± 0·2. Passaging of inactivated samples on permissive tissue showed no viral replication even after 9 days of incubation and three passages, confirming complete inactivation. The treatment also inhibited NAT detection by nucleic acid modification with a mean log reduction of 2·92 ± 0·87 PFU genomic equivalents. CONCLUSION: Amotosalen/UVA light treatment of SARS-CoV-2 spiked human plasma units efficiently and completely inactivated >3·32 ± 0·2 log of SARS-CoV-2 infectivity, showing that such treatment could minimize the risk of transfusion-related SARS-CoV-2 transmission.

Laparoscopic Sleeve Gastrectomy has A Positive Impact on Subclinical Hypothyroidism Among Obese Patients: A Prospective Study.

BACKGROUND: The effect of bariatric surgery on postoperative thyroid function remains incompletely understood. In this study, we aimed to evaluate the changes in thyroid functions after gastric sleeve operation for morbidly obese Egyptian patients. METHODS: This was a prospective study that recruited 128 patients who underwent sleeve gastrectomy through the period from December 2016 to April 2020. We measured thyroid-stimulating hormone (TSH), free thyroxin (FT4), and free triiodothyronine. Subclinical hypothyroidism was defined by a TSH level > 4.5 mIU/L but a normal FT4 level. All patients were followed for 12 months after the procedure. RESULTS: Preoperatively, 30 (23.4%) patients had subclinical hypothyroidism. The prevalence of subclinical hypothyroidism decreased significantly to reach 7.8% at the end of follow-up (p < 0.001). None of the patients developed de novo hypothyroidism at the end of follow-up. Patients with subclinical hypothyroidism were more likely to be females (p = 0.037) and had significantly higher waist circumference (p < 0.001), DBP (p = 0.02), serum cholesterol (p < 0.001), and serum triglyceride (p < 0.001). However, patients with subclinical hypothyroidism at the end of follow-up had significantly higher BMI at the end of the sixth month (p = 0.048). Similarly, patients with subclinical hypothyroidism at the end of follow-up had significantly higher serum cholesterol (p = 0.002), LDL, (p = 0.038), and serum triglyceride (p < 0.001) at the end of the sixth months of follow-up. A similar trend was noted at the end of the 12th month. The preoperative value of serum TSH correlated significantly with serum cholesterol and triglyceride levels. CONCLUSION: The positive effect of the LSG procedure on the hypothyroid bariatric population, including enhanced thyroid function, was demonstrated.

Voltammetric-based immunosensor for the detection of SARS-CoV-2 nucleocapsid antigen.

Since the COVID-19 disease caused by the novel severe acute respiratory syndrome coronavirus 2 (SARS- CoV-2) was declared a pandemic, it has spread rapidly, causing one of the most serious outbreaks in the last century. Reliable and rapid diagnostic tests for COVID-19 are crucial to control and manage the outbreak. Here, a label-free square wave voltammetry-based biosensing platform for the detection of SARS-CoV-2 in nasopharyngeal samples is reported. The sensor was constructed on screen-printed carbon electrodes coated with gold nanoparticles. The electrodes were functionalized using 11-mercaptoundecanoic acid (MUA) which was used for the immobilization of an antibody against SARS-CoV-2 nucleocapsid protein (N protein). The binding of the immunosensor with the N protein caused a change in the electrochemical signal. The detection was realised by measuring the change in reduction peak current of a redox couple using square wave voltammetry at 0.04 V versus Ag ref. electrode on the immunosensor upon binding with the N protein. The electrochemical immunosensor showed high sensitivity with a linear range from 1.0 pg.mL-1 to 100 ng.mL-1 and a limit of detection of 0.4 pg.mL-1 for the N protein in PBS buffer pH 7.4. Moreover, the immunosensor did not exhibit significant response with other viruses such as HCoV, MERS-CoV, Flu A and Flu B, indicating the high selectivity of the sensor for SARS-CoV-2. However, cross reactivity of the biosensor with SARS-CoV is indicated, which gives ability of the sensor to detect both SARS-CoV and SARS-CoV-2. The biosensor was successfully applied to detect the SARS-CoV-2 virus in clinical samples showing good correlation between the biosensor response and the RT-PCR cycle threshold values. We believe that the capability of miniaturization, low-cost and fast response of the proposed label-free electrochemical immunosensor will facilitate the point-of-care diagnosis of COVID 19 and help prevent further spread of infection.

Peptide substrate screening for the diagnosis of SARS-CoV-2 using fluorescence resonance energy transfer (FRET) assay.

The novel corona (SARS-CoV-2) virus causes a global pandemic, which motivates researchers to develop reliable and effective methods for screening and detection of SARS-CoV-2. Though there are several methods available for the diagnosis of SARS-CoV-2 such as RT-PCR and ELSIA, nevertheless, these methods are time-consuming and may not apply at the point of care. In this study, we have developed a specific, sensitive, quantitative and fast detection method for SARS-CoV-2 by fluorescence resonance energy transfer (FRET) assay. The total extracellular protease proteolytic activity from the virus has been used as the biomarker. The specific peptide sequences from the library of 115 dipeptides were identified via changes in the fluorescence signal. The fluorogenic dipeptide substrates have the fluorophore and a quencher at the N- and the C- terminals, respectively. When the protease hydrolyzes the peptide bond between the two specific amino acids, it leads to a significant increase in the fluorescence signals. The specific fluorogenic peptide (H-d) produces a high fluorescence signal. A calibration plot was obtained from the changes in the fluorescence intensity against the different concentrations of the viral protease. The lowest limit of detection of this method was 9.7 ± 3 pfu/mL. The cross-reactivity of the SARS-CoV-2-specific peptide was tested against the MERS-CoV which does not affect the fluorescence signal. A significant change in the fluorescence signal with patient samples indicates that this FRET-based assay might be applied for the diagnosis of SARS-CoV-2 patients. Graphical abstract.

In Vitro Inhibitory Analysis of Rationally Designed siRNAs against MERS-CoV Replication in Huh7 Cells.

MERS-CoV was identified for the first time in Jeddah, Saudi Arabia in 2012 in a hospitalized patient. This virus subsequently spread to 27 countries with a total of 939 deaths and 2586 confirmed cases and now has become a serious concern globally. Camels are well known for the transmission of the virus to the human population. In this report, we have discussed the prediction, designing, and evaluation of potential siRNA targeting the ORF1ab gene for the inhibition of MERS-CoV replication. The online software, siDirect 2.0 was used to predict and design the siRNAs, their secondary structure and their target accessibility. ORF1ab gene folding was performed by RNAxs and RNAfold software. A total of twenty-one siRNAs were selected from 462 siRNAs according to their scoring and specificity. siRNAs were evaluated in vitro for their cytotoxicity and antiviral efficacy in Huh7 cell line. No significant cytotoxicity was observed for all siRNAs in Huh7 cells. The in vitro study showed the inhibition of viral replication by three siRNAs. The data generated in this study provide preliminary and encouraging information to evaluate the siRNAs separately as well as in combination against MERS-CoV replication in other cell lines. The prediction of siRNAs using online software resulted in the filtration and selection of potential siRNAs with high accuracy and strength. This computational approach resulted in three effective siRNAs that can be taken further to in vivo animal studies and can be used to develop safe and effective antiviral therapies for other prevalent disease-causing viruses.

Electromagnetic resonance analysis of asymmetric carbon nanotube dimers for sensing applications.

In this work, we study the electromagnetic scattering characteristics of asymmetric carbon nanotube (CNT) dimers with rigorous computational experiments. We show that the configurational asymmetry in the CNT dimer assembly creates a unique field distribution in the vicinity of the dimer, which in turn generates two distinct resonances representing the bonding and anti-bonding modes. The sensitivity of these two modes towards CNT lengths, orientations, and shapes, is studied. We also show the ability of asymmetric CNT dimer for the contactless detection of nanoparticles (NP). The presence of a NP in the vicinity of the CNT dimer perturbs the dimer's field distribution and causes unequal shifts in the bonding and anti-bonding resonances depending on the NP location, material, size and shape. By studying the differences in these resonance shifts, we show that the relative location and orientation of the NP can be reconstructed. The computational experiments performed in this work have the potential to guide the use of asymmetric CNT dimers for novel sensing applications.

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.