First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

First report of grapevine rupestris vein feathering virus in grapevine in Australia.

Grapevine rupestris vein feathering virus (GRVFV; tentative genus Marafivirus; family Tymoviridae ) was first detected from a Greek grapevine (Vitis vinifera), with asteroid mosaic-like symptoms (El Beaino et al. 2001; Ghanem-Sabanadzovic et al. 2003) and was also infected with grapevine fleck virus. GRVFV has been detected in the United States, South Africa, Canada, Spain, China, New Zealand, Brazil, Germany, Korea, Slovakia, Hungary and Pakistan (Cho et al. 2018; Mahmood et al. 2019).Transmission vectors are currently unknown. In 2018, nine grapevine samples were collected between May to July in South Australia (SA) and Western Australia (WA) (Table S1), were analysed by high-throughput sequencing (HTS) to characterise grapevine viruses in Australian vineyards. Total RNA or double stranded RNA was extracted from grapevine canes using RNeasy 96 QIAcube HT kit (Qiagen) with MacKenzie buffer (MacKenzie et al. 1997) or using CF-11 (Balijja et al. 2008). Libraries were prepared using the NEBNext® Ultra II RNA library Prep Kit (NEB) or TruSeq® Stranded mRNA Prep kit (Illumina) with Ribo-Zero®gold plant kit for ribosomal depletion (Illumina, San Diego, CA). Libraries were sequenced using Illumina Miseq (SA) or Hiseq (WA) technology with 2x300 (SA) or 2x100 (WA) paired end reads which were trimmed using Trim Galore! (0.4.0) or BBmap (38.20), respectively. De novo assembly, using the SPAdes (version 3.12.0) genome assembler with default settings, resulted in twelve near full length GRVFV genomes (6713-6737nt), eight sequences from the WA samples and four from the SA samples. WA samples 171 and 178 and SA sample BV each had two distinct GRVFV molecular variants. Variants 171-1 and 171-2 (GenBank accessions MT084811, MT084812) from sample 171 shared 83.39% nucleotide (nt) identity. Variants 178-1 and 178-2 (MT084813, MT084814) from sample 178 shared 83.54% nt identity. Variants BV6799 and BV8822 (MN974274, MN974275) from sample BV shared 82.85% nt identity. Only one GRVFV sequence was obtained from all other samples. The genome of SA isolate LC1 (MN974273) was confirmed by RT-PCR amplification and Sanger sequencing of overlapping genome regions. Tissue from the infected LC1 isolate has been deposited into the Victorian plant pathogen reference collection (VPRI accession No. 43698). When the genomes of all Australian isolates were compared, they had 78.94% to 94.37 % nt identity with each other. The SA isolates LC1, BV8822, BV6799, and SEL-L (MN974276), and the WA isolates 172 (MT084807), 179 (MT084808), 180 (MT084809), and 182 (MT084810) were most closely related to the Swiss isolate CHASS (KY513702; 82.87% to 85.46% nt identity). The WA isolates 171-1, 171-2, 178-1 and 178-2 were most closely related to the New Zealand isolate Ch8021 (MF000325; 83.21% to 93.87%). Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-3, GLRaV-4 (strain 6 and 9), grapevine virus A, grapevine rupestris stem pitting associated virus, grapevine yellow speckle viroid 1 and hop stunt viroid were also identified in the sequencing data. This is the first report of GRVFV in Australia. All WA samples were collected during dormancy and symptoms were not observed. Sample LC1 from SA had Shiraz disease, the other SA samples were asymptomatic, and none had asteroid mosaic-like symptoms. Further research is required to determine its distribution and association with disease in Australia.