Alanine synthesized by alanine dehydrogenase enables ammonium-tolerant nitrogen fixation in Paenibacillus sabinae T27.

Most diazotrophs fix nitrogen only under nitrogen-limiting conditions, for example, in the presence of relatively low concentrations of NH4+ (0 to 2 mM). However, Paenibacillus sabinae T27 exhibits an unusual pattern of nitrogen regulation of nitrogen fixation, since although nitrogenase activities are high under nitrogen-limiting conditions (0 to 3 mM NH4+) and are repressed under conditions of nitrogen sufficiency (4 to 30 mM NH4+), nitrogenase activity is reestablished when very high levels of NH4+ (30 to 300 mM) are present in the medium. To further understand this pattern of nitrogen fixation regulation, we carried out transcriptome analyses of P. sabinae T27 in response to increasing ammonium concentrations. As anticipated, the nif genes were highly expressed, either in the absence of fixed nitrogen or in the presence of a high concentration of NH4+ (100 mM), but were subject to negative feedback regulation at an intermediate concentration of NH4+ (10 mM). Among the differentially expressed genes, ald1, encoding alanine dehydrogenase (ADH1), was highly expressed in the presence of a high level of NH4+ (100 mM). Mutation and complementation experiments revealed that ald1 is required for nitrogen fixation at high ammonium concentrations. We demonstrate that alanine, synthesized by ADH1 from pyruvate and NH4+, inhibits GS activity, leading to a low intracellular glutamine concentration that prevents feedback inhibition of GS and mimics nitrogen limitation, enabling activation of nif transcription by the nitrogen-responsive regulator GlnR in the presence of high levels of extracellular ammonium.

Prediction of response to neoadjuvant chemo-immunotherapy in patients with esophageal squamous cell carcinoma by a rapid breath test.

BACKGROUND: Neoadjuvant chemo-immunotherapy combination has shown remarkable advances in the management of esophageal squamous cell carcinoma (ESCC). However, the identification of a reliable biomarker for predicting the response to this chemo-immunotherapy regimen remains elusive. While computed tomography (CT) is widely utilized for response evaluation, its inherent limitations in terms of accuracy are well recognized. Therefore, in this study, we present a novel technique to predict the response of ESCC patients before receiving chemo-immunotherapy by testing volatile organic compounds (VOCs) in exhaled breath. METHODS: This study employed a prospective-specimen-collection, retrospective-blinded-evaluation design. Patients' baseline breath samples were collected and analyzed using high-pressure photon ionization time-of-flight mass spectrometry (HPPI-TOFMS). Subsequently, patients were categorized as responders or non-responders based on the evaluation of therapeutic response using pathology (for patients who underwent surgery) or CT images (for patients who did not receive surgery). RESULTS: A total of 133 patients were included in this study, with 91 responders who achieved either a complete response (CR) or a partial response (PR), and 42 non-responders who had stable disease (SD) or progressive disease (PD). Among 83 participants who underwent both evaluations with CT and pathology, the paired t-test revealed significant differences between the two methods (p < 0.05). For the breath test prediction model using breath test data from all participants, the validation set demonstrated mean area under the curve (AUC) of 0.86 ± 0.06. For 83 patients with pathological reports, the breath test achieved mean AUC of 0.845 ± 0.123. CONCLUSIONS: Since CT has inherent weakness in hollow organ assessment and no other ideal biomarker has been found, our study provided a noninvasive, feasible, and inexpensive tool that could precisely predict ESCC patients' response to neoadjuvant chemo-immunotherapy combination using breath test based on HPPI-TOFMS.

Zinc-Responsive Regulator Zur Regulates Zinc Homeostasis, Secondary Metabolism, and Morphological Differentiation in Streptomyces avermitilis.

Zinc is an essential cofactor for many metal enzymes and transcription regulators. Zn2+ availability has long been known to affect antibiotic production and morphological differentiation of Streptomyces species. However, the molecular mechanism whereby zinc regulates these processes remains unclear. We investigated the regulatory roles of the zinc-sensing regulator Zur in Streptomyces avermitilis. Our findings demonstrate that Zur plays an essential role in maintaining zinc homeostasis by repressing the expression of the zinc uptake system ZnuACB and alternative non-zinc-binding ribosomal proteins and promoting the expression of zinc exporter ZitB. Deletion of the zur gene resulted in decreased production of avermectin and oligomycin and delayed morphological differentiation, and these parameters were restored close to wild-type levels in a zur-complemented strain. Zur bound specifically to Zur box in the promoter regions of avermectin pathway-specific activator gene aveR, oligomycin polyketide synthase gene olmA1, and filipin biosynthetic pathway-specific regulatory genes pteR and pteF. Analyses by reverse transcription quantitative PCR and luciferase reporter systems indicated that Zur directly activates the transcription of these genes, i.e., that Zur directly activates biosynthesis of avermectin and oligomycin. Zur positively regulated morphological development by repressing the transcription of differentiation-related genes ssgB and minD2. Our findings, taken together, demonstrate that Zur in S. avermitilis directly controls zinc homeostasis, biosynthesis of avermectin and oligomycin, and morphological differentiation. IMPORTANCE Biosynthesis of secondary metabolites and morphological differentiation in bacteria are affected by environmental signals. The molecular mechanisms whereby zinc availability affects secondary metabolism and morphological differentiation remain poorly understood. We identified several new target genes of the zinc response regulator Zur in Streptomyces avermitilis, the industrial producer of avermectin. Zur was found to directly and positively control avermectin production, oligomycin production, and morphological differentiation in response to extracellular Zn2+ levels. Our findings clarify the regulatory functions of Zur in Streptomyces, which involve linking environmental Zn2+ status with control of antibiotic biosynthetic pathways and morphological differentiation.

Avermectin B1a production in Streptomyces avermitilis is enhanced by engineering aveC and precursor supply genes.

Avermectins (AVEs) are economically potent anthelmintic agents produced by Streptomyces avermitilis. Among eight AVE components, B1a exhibits the highest insecticidal activity. The purpose of this study was to enhance B1a production, particularly in the high-yielding industrial strain A229, by a combination strategy involving the following steps. (i) aveC gene was engineered to increase B1a:B2a ratio. Three aveC variants (aveC2m, aveC5m, and aveC8m, respectively encoding two, five, and eight amino acid mutations) were synthesized by fusion PCR. B1a:B2a ratio in A229 derivative having kasOp*-controlled aveC8m reached 1.33 (B1a and B2a titers were 8120 and 6124 µg/mL). Corresponding values in A229 were 0.99 and 6447 and 6480 µg/mL. (ii) ß-oxidation pathway genes fadD and fadAB were overexpressed in wild-type (WT) strain and A229 to increase supply of acyl-CoA precursors for AVE production. The resulting strains all showed increased B1a titer. Co-overexpression of pkn5p-driven fadD and fadAB in A229 led to B1a titer of 8537 µg/mL. (iii) Genes bicA and ecaA involved in cyanobacterial CO2-concentrating mechanism (CCM) were introduced into WT and A229 to enhance carboxylation velocity of acetyl-CoA and propionyl-CoA carboxylases, leading to increased supply of malonyl- and methylmalonyl-CoA precursors and increased B1a titer. Co-expression of bicA and ecaA in A229 led to B1a titer of 8083 µg/mL. (iv) aveC8m, fadD-fadAB, and bicA-ecaA were co-overexpressed in A229, resulting in maximal B1a titer (9613 µg/mL; 49.1% increase relative to A229). Our findings demonstrate that the combination strategy we provided here is an efficient approach for improving B1a production in industrial strains.Key points• aveC mutation increased avermectin B1a:B2a ratio and B1a titer.• Higher levels of acyl-CoA precursors contributed to enhanced B1a production.• B1a titer in an industrial strain was increased by 49.1% via a combination strategy.

BldD, a master developmental repressor, activates antibiotic production in two Streptomyces species.

BldD generally functions as a repressor controlling morphological development of Streptomyces. In this work, evidences that BldD also activates antibiotic production are provided. In Streptomyces roseosporus (which produces daptomycin widely used for treatment of human infections), deletion of bldD notably reduced daptomycin production, but enhanced sporulation. BldD stimulated daptomycin production by directly activating transcription of dpt structural genes and dptR3 (which encodes an indirect activator of daptomycin production), and repressed its own gene. BldD-binding sites on promoter regions of dptE, dptR3, and bldD were all found to contain BldD box-like sequences, facilitating prediction of new BldD targets. Two Streptomyces global regulatory genes, adpA and afsR, were confirmed to be directly activated by BldD. The protein AfsR was shown to act as an activator of daptomycin production, but a repressor of development. BldD directly represses nine key developmental genes. In Streptomyces avermitilis (which produces effective anthelmintic agents avermectins), BldD homolog (BldDsav) directly activates avermectin production through ave structural genes and cluster-situated activator gene aveR. This is the first report that BldD activates antibiotic biosynthesis both directly and via a cascade mechanism. BldD homologs are widely distributed among Streptomyces, our findings suggest that BldD may activate antibiotic production in other Streptomyces species.

Heat Shock Repressor HspR Directly Controls Avermectin Production, Morphological Development, and H2O2 Stress Response in Streptomyces avermitilis.

The heat shock response (HSR) is a universal cellular response that promotes survival following temperature increase. In filamentous Streptomyces, which accounts for ∼70% of commercial antibiotic production, HSR is regulated by transcriptional repressors; in particular, the widespread MerR-family regulator HspR has been identified as a key repressor. However, functions of HspR in other biological processes are unknown. The present study demonstrates that HspR pleiotropically controls avermectin production, morphological development, and heat shock and H2O2 stress responses in the industrially important species Streptomyces avermitilis. HspR directly activated ave structural genes (aveA1 and aveA2) and H2O2 stress-related genes (katA1, catR, katA3, oxyR, ahpC, and ahpD), whereas it directly repressed heat shock genes (HSGs) (the dnaK1-grpE1-dnaJ1-hspR operon, clpB1p, clpB2p, and lonAp) and developmental genes (wblB, ssgY, and ftsH). HspR interacted with PhoP (response regulator of the widespread PhoPR two-component system) at dnaK1p to corepress the important dnaK1-grpE1-dnaJ1-hspR operon. PhoP exclusively repressed target HSGs (htpG, hsp18_1, and hsp18_2) different from those of HspR (clpB1p, clpB2p, and lonAp). A consensus HspR-binding site, 5'-TTGANBBNNHNNNDSTSHN-3', was identified within HspR target promoter regions, allowing prediction of the HspR regulon involved in broad cellular functions. Taken together, our findings demonstrate a key role of HspR in the coordination of a variety of important biological processes in Streptomyces species. IMPORTANCE Our findings are significant to clarify the molecular mechanisms underlying HspR function in Streptomyces antibiotic production, development, and H2O2 stress responses through direct control of its target genes associated with these biological processes. HspR homologs described to date function as transcriptional repressors but not as activators. The results of the present study demonstrate that HspR acts as a dual repressor/activator. PhoP cross talks with HspR at dnaK1p to coregulate the heat shock response (HSR), but it also has its own specific target heat shock genes (HSGs). The novel role of PhoP in the HSR further demonstrates the importance of this regulator in Streptomyces. Overexpression of hspR strongly enhanced avermectin production in Streptomyces avermitilis wild-type and industrial strains. These findings provide new insights into the regulatory roles and mechanisms of HspR and PhoP and facilitate methods for antibiotic overproduction in Streptomyces species.

Positive and negative regulation of transferred nif genes mediated by indigenous GlnR in Gram-positive Paenibacillus polymyxa.

Ammonia is a major signal that regulates nitrogen fixation in most diazotrophs. Regulation of nitrogen fixation by ammonia in the Gram-negative diazotrophs is well-characterized. In these bacteria, this regulation occurs mainly at the level of nif (nitrogen fixation) gene transcription, which requires a nif-specific activator, NifA. Although Gram-positive and diazotrophic Paenibacilli have been extensively used as a bacterial fertilizer in agriculture, how nitrogen fixation is regulated in response to nitrogen availability in these bacteria remains unclear. An indigenous GlnR and GlnR/TnrA-binding sites in the promoter region of the nif cluster are conserved in these strains, indicating the role of GlnR as a regulator of nitrogen fixation. In this study, we for the first time reveal that GlnR of Paenibacillus polymyxa WLY78 is essentially required for nif gene transcription under nitrogen limitation, whereas both GlnR and glutamine synthetase (GS) encoded by glnA within glnRA operon are required for repressing nif expression under excess nitrogen. Dimerization of GlnR is necessary for binding of GlnR to DNA. GlnR in P. polymyxa WLY78 exists in a mixture of dimers and monomers. The C-terminal region of GlnR monomer is an autoinhibitory domain that prevents GlnR from binding DNA. Two GlnR-biding sites flank the -35/-10 regions of the nif promoter of the nif operon (nifBHDKENXhesAnifV). The GlnR-binding site Ⅰ (located upstream of -35/-10 regions of the nif promoter) is specially required for activating nif transcription, while GlnR-binding siteⅡ (located downstream of -35/-10 regions of the nif promoter) is for repressing nif expression. Under nitrogen limitation, GlnR dimer binds to GlnR-binding siteⅠ in a weak and transient association way and then activates nif transcription. During excess nitrogen, glutamine binds to and feedback inhibits GS by forming the complex FBI-GS. The FBI-GS interacts with the C-terminal domain of GlnR and stabilizes the binding affinity of GlnR to GlnR-binding site Ⅱ and thus represses nif transcription.

The ROK-family regulator Rok7B7 directly controls carbon catabolite repression, antibiotic biosynthesis, and morphological development in Streptomyces avermitilis.

Carbon catabolite repression (CCR) is a common phenomenon in bacteria that modulates expression of genes involved in uptake of alternative carbon sources. In the filamentous streptomycetes, which produce half of all known antibiotics, the precise mechanism of CCR is yet unknown. We report here that the ROK-family regulator Rok7B7 pleiotropically controls xylose and glucose uptake, CCR, development, as well as production of the macrolide antibiotics avermectin and oligomycin A in Streptomyces avermitilis. Rok7B7 directly repressed structural genes for avermectin biosynthesis, whereas it activated olmRI, the cluster-situated activator gene for oligomycin A biosynthesis. Rok7B7 also directly repressed the xylose uptake operon xylFGH, whose expression was induced by xylose and repressed by glucose. Both xylose and glucose served as Rok7B7 ligands. rok7B7 deletion led to enhancement and reduction of avermectin and oligomycin A production, respectively, relieved CCR of xylFGH, and increased co-uptake efficiency of xylose and glucose. A consensus Rok7B7-binding site, 5'-TTKAMKHSTTSAV-3', was identified within aveA1p, olmRIp, and xylFp, which allowed prediction of the Rok7B7 regulon and confirmation of 11 additional targets involved in development, secondary metabolism, glucose uptake, and primary metabolic processes. Our findings will facilitate methods for strain improvement, antibiotic overproduction, and co-uptake of xylose and glucose in Streptomyces species.

SufR, a [4Fe-4S] Cluster-Containing Transcription Factor, Represses the sufRBDCSU Operon in Streptomyces avermitilis Iron-Sulfur Cluster Assembly.

Iron-sulfur (Fe-S) clusters are ubiquitous and versatile inorganic cofactors that are crucial for many fundamental bioprocesses in nearly all organisms. How cells maintain Fe-S cluster homeostasis is not well understood in Gram-positive bacteria. Genomic analysis showed that the Suf system, which is encoded by the sufRBDCSU operon, is the sole Fe-S cluster assembly system in the genus StreptomycesStreptomyces avermitilis is the industrial producer of avermectins, which are widely used as agricultural pesticides and antiparasitic agents. sufR (SAV6324) encodes a putative ArsR-family transcriptional regulator, which was characterized as a repressor of the sufRBDCSU operon in this investigation. Spectroscopy and mass spectrometry demonstrated that anaerobically isolated SufR contained an oxidation-sensitive [4Fe-4S] cluster and existed as a homodimer. Electrophoretic mobility shift assays (EMSAs) and DNase I footprinting analyses revealed that [4Fe-4S]-SufR bound specifically and tightly to a 14-bp palindromic sequence (CAAC-N6-GTTG) in the promoter region of the sufR operon, repressing expression of the sufRBDCSU operon. The presence of the [4Fe-4S] cluster is critical for the DNA-binding activity of SufR. Cys182, Cys195, and Cys223 in the C-terminal region of SufR are essential for [4Fe-4S] cluster coordination, but Cys178 is not. The fourth non-Cys ligand in coordination of the [4Fe-4S] cluster for SufR remains to be identified. The findings clarify the transcriptional control of the suf operon by [4Fe-4S] SufR to satisfy the various Fe-S cluster demands. SufR senses the intracellular Fe-S cluster status and modulates the expression of the sole Fe-S cluster assembly system via its Fe-S cluster occupancy.IMPORTANCE Fe-S clusters function as cofactors of proteins controlling diverse biological processes, such as respiration, photosynthesis, nitrogen fixation, DNA replication, and gene regulation. The mechanism of how Actinobacteria regulate the expression of the sole Fe-S cluster assembly system in response to the various Fe-S cluster demands remains to be elucidated. In this study, we showed that SufR functions as a transcriptional repressor of the sole Fe-S cluster assembly system in the avermectin producer S. avermitilis [4Fe-4S]-SufR binds to the promoter region of the suf operon and represses its expression. When Fe-S cluster levels are insufficient, SufR loses its [4Fe-4S] cluster and DNA-binding activity. Apo-SufR dissociates from the promoter region of suf operon, and the expression of the suf system is strongly increased by derepression to promote the synthesis of Fe-S clusters. The study clarifies how Streptomyces maintains its Fe-S cluster homeostasis through the activity of SufR to modulate the various Fe-S cluster demands.

AccR, a TetR Family Transcriptional Repressor, Coordinates Short-Chain Acyl Coenzyme A Homeostasis in Streptomyces avermitilis.

Malonyl coenzyme A (malonyl-CoA) and methylmalonyl-CoA are the most common extender units for the biosynthesis of fatty acids and polyketides in Streptomyces, an industrially important producer of polyketides. Carboxylation of acetyl- and propionyl-CoAs is an essential source of malonyl- and methylmalonyl-CoAs; therefore, acyl-CoA carboxylases (ACCases) play key roles in primary and secondary metabolism. The regulation of the expression of ACCases in Streptomyces spp. has not been investigated previously. We characterized a TetR family transcriptional repressor, AccR, that mediates intracellular acetyl-, propionyl-, methylcrotonyl-, malonyl-, and methylmalonyl-CoA levels by controlling the transcription of genes that encode the main ACCase and enzymes associated with branched-chain amino acid metabolism in S. avermitilis AccR bound to a 16-nucleotide palindromic binding motif (GTTAA-N6-TTAAC) in promoter regions and repressed the transcription of the accD1A1-hmgL-fadE4 operon, echA8, echA9, and fadE2, which are involved in the production and assimilation of acetyl- and propionyl-CoAs. Methylcrotonyl-, propionyl-, and acetyl-CoAs acted as effectors to release AccR from its target DNA, resulting in enhanced transcription of target genes by derepression. The affinity of methylcrotonyl- and propionyl-CoAs to AccR was stronger than that of acetyl-CoA. Deletion of accR resulted in increased concentrations of short-chain acyl-CoAs (acetyl-, propionyl-, malonyl-, and methylmalonyl-CoAs), leading to enhanced avermectin production. Avermectin production was increased by 14.5% in an accR deletion mutant of the industrial high-yield strain S. avermitilis A8. Our findings clarify the regulatory mechanisms that maintain the homeostasis of short-chain acyl-CoAs in StreptomycesIMPORTANCE Acyl-CoA carboxylases play key roles in primary and secondary metabolism. However, the regulation of ACCase genes transcription in Streptomyces spp. remains unclear. Here, we demonstrated that AccR responded to intracellular acetyl-, propionyl-, and methylcrotonyl-CoA availability and mediated transcription of the genes related to production and assimilation of these compounds in S. avermitilis When intracellular concentrations of these compounds are low, AccR binds to target genes and represses their transcription, resulting in low production of malonyl- and methylmalonyl-CoAs. When intracellular acetyl-, propionyl-, and methylcrotonyl-CoA concentrations are high, these compounds bind to AccR to dissociate AccR from target DNA, promoting the conversion of these compounds to malonyl- and methylmalonyl-CoAs. This investigation revealed how AccR coordinates short-chain acyl-CoA homeostasis in Streptomyces.

Work Patterns of MamXY Proteins during Magnetosome Formation in Magnetospirillum gryphiswaldense MSR-1.

The bacterium Magnetospirillum gryphiswaldense MSR-1 forms nanosized membrane-enclosed organelles termed magnetosomes. The mamXY operon, part of the magnetosome island (MAI), includes the mamY, mamX, mamZ, and ftsZ-like genes, which initiate gene transcription via the same promoter. We used a combination of molecular biological techniques (targeting of cross-linking reagents) and high-resolution mass spectrometry to investigate the coordinated activity of the four MamXY proteins in magnetite biomineralization. The FtsZ-like protein was shown by confocal laser scanning microscopy to be dispersed in the cytoplasm in the early stage of cell growth and then gradually polymerized along the magnetosome chain. Interactions of various pairs of MamXY proteins were observed using a bacterial two-hybrid system. We constructed a recombinant FtsZ-like-overexpressing strain, examined its growth patterns, and extracted magnetosome membrane proteins using a modified SDS/boiling method with BS2G-d0/d4 reagent, which helped stabilize interactions among MamXY proteins. In liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis, MamY expression was detected first and remained highest among the four proteins throughout all stages of cell growth. MamX and MamZ expression was detected subsequently. The four proteins displayed coordinated expression patterns during the magnetosome maturation process. Unique peptides discovered in the MamXY protein sequences appeared to constitute "hidden" interaction sites involved in the formation of MamXY complex that helped control magnetosome shape and size.IMPORTANCEmamXY operon genes play an essential role in magnetite biomineralization, participate in redox reactions, and control magnetosome shape and size. However, mechanisms whereby the four MamXY proteins function together in iron oxidoreduction and transport are poorly understood. We used a combination of targeted cross-linking techniques and high-resolution mass spectrometry to elucidate the coordinated activity patterns of the MamXY proteins during magnetite biomineralization. Our findings indicate that the FtsZ-like protein undergoes polymerization and then recruits MamY, MamX, and MamZ in turn, and that these interactions depend on unique peptides present in the protein sequences. A hypothetical model of the functionalities of these proteins is proposed that accounts for the findings and provides a basis for further studies of coordination among magnetosome island (MAI) gene clusters during the process of magnetosome formation.

AveI, an AtrA homolog of Streptomyces avermitilis, controls avermectin and oligomycin production, melanogenesis, and morphological differentiation.

Streptomyces avermitilis is well known as the producer of anthelmintic agent avermectins, which are widely used in agriculture, veterinary medicine, and human medicine. aveI encodes a TetR-family regulator, which is the homolog of AtrA. It was reported that deletion of aveI caused enhanced avermectin production. In this study, we investigated the regulatory function of the AveI in S. avermitilis. By binding to the 15-nt palindromic sequence in the promoter regions, AveI directly regulates at least 35 genes. AveI represses avermectin production by directly regulating the transcription of the cluster-situated regulator gene aveR and structural genes aveA1, aveA3, and aveD. AveI represses oligomycin production by repressing the CSR gene olmRII and structural genes olmC. AveI activates melanin biosynthesis by activating the expression of melC1C2 operon. AveI activates morphological differentiation by activating the expression of ssgR and ssgD genes, repressing the expression of wblI gene. Besides, AveI regulates many genes involved in primary metabolism, including substrates transport, the metabolism of amino acids, lipids, and carbohydrates. Therefore, AveI functions as a global regulator in S. avermitilis, controls not only secondary metabolism and morphological differentiation, but also primary metabolism.

IdeR, a DtxR Family Iron Response Regulator, Controls Iron Homeostasis, Morphological Differentiation, Secondary Metabolism, and the Oxidative Stress Response in Streptomyces avermitilis.

Iron, an essential element for microorganisms, functions as a vital cofactor in a wide variety of key metabolic processes. On the other hand, excess iron may have toxic effects on bacteria by catalyzing the formation of reactive oxygen species through the Fenton reaction. The prevention of iron toxicity requires the precise control of intracellular iron levels in bacteria. Mechanisms of iron homeostasis in the genus Streptomyces (the producers of various antibiotics) are poorly understood. Streptomyces avermitilis is the industrial producer of avermectins, which are potent anthelmintic agents widely used in medicine, agriculture, and animal husbandry. We investigated the regulatory role of IdeR, a DtxR family regulator, in S. avermitilis In the presence of iron, IdeR binds to a specific palindromic consensus sequence in promoters and regulates 14 targets involved in iron metabolism (e.g., iron acquisition, iron storage, heme metabolism, and Fe-S assembly). IdeR also directly regulates 12 targets involved in other biological processes, including morphological differentiation, secondary metabolism, carbohydrate metabolism, and the tricarboxylic acid (TCA) cycle. ideR transcription is positively regulated by the peroxide-sensing transcriptional regulator OxyR. A newly constructed ideR deletion mutant (DideR) was found to be less responsive to iron levels and more sensitive to H2O2 treatment than the wild-type strain, indicating that ideR is essential for oxidative stress responses. Our findings, taken together, demonstrate that IdeR plays a pleiotropic role in the overall coordination of metabolism in Streptomyces spp. in response to iron levels.IMPORTANCE Iron is essential to almost all organisms, but in the presence of oxygen, iron is both poorly available and potentially toxic. Streptomyces species are predominantly present in soil where the environment is complex and fluctuating. So far, the mechanism of iron homeostasis in Streptomyces spp. remains to be elucidated. Here, we characterized the regulatory role of IdeR in the avermectin-producing organism S. avermitilis IdeR maintains intracellular iron levels by regulating genes involved in iron absorption and storage. IdeR also directly regulates morphological differentiation, secondary metabolism, and central metabolism. ideR is under the positive control of OxyR and is indispensable for an efficient response to oxidative stress. This investigation uncovered that IdeR acts as a global regulator coordinating iron homeostasis, morphological differentiation, secondary metabolism, and oxidative stress response in Streptomyces species. Elucidation of the pleiotropic regulation function of IdeR provides new insights into the mechanisms of how Streptomyces spp. adapt to the complex environment.

AvaR2, a pseudo γ-butyrolactone receptor homologue from Streptomyces avermitilis, is a pleiotropic repressor of avermectin and avenolide biosynthesis and cell growth.

Avermectins produced by Streptomyces avermitilis are effective anthelmintic agents. The autoregulatory signalling molecule that triggers avermectin biosynthesis is a novel butenolide-type molecule, avenolide, rather than common γ-butyrolactones (GBLs). We identified AvaR2, a pseudo GBL receptor homologue, as an important repressor of avermectin and avenolide biosynthesis and cell growth. AvaR2 directly repressed transcription of aveR (the ave cluster-situated activator gene), aco (a key gene for avenolide biosynthesis), its own gene (avaR2) and two other GBL receptor homologous genes (avaR1 and avaR3) by binding to their promoter regions. The aveR promoter had the highest affinity for AvaR2. A consensus 18 bp ARE (autoregulatory element)-like sequence was found in the AvaR2-binding regions of these five target genes. Eleven novel AvaR2 targets were identified, including genes involved in primary metabolism, ribosomal protein synthesis, and stress responses. AvaR2 bound and responded to endogenous avenolide and exogenous antibiotics jadomycin B (JadB) and aminoglycosides to modulate its DNA-binding activity. Our findings help to clarify the roles of pseudo GBL receptors as pleiotropic regulators and as receptors for new type autoregulator and exogenous antibiotic signal. A pseudo GBL receptor-mediated antibiotic signalling transduction system may be a common strategy that facilitates Streptomyces interspecies communication and survival in complex environments.

Comparative genomic analysis of N2-fixing and non-N2-fixing Paenibacillus spp.: organization, evolution and expression of the nitrogen fixation genes.

We provide here a comparative genome analysis of 31 strains within the genus Paenibacillus including 11 new genomic sequences of N2-fixing strains. The heterogeneity of the 31 genomes (15 N2-fixing and 16 non-N2-fixing Paenibacillus strains) was reflected in the large size of the shell genome, which makes up approximately 65.2% of the genes in pan genome. Large numbers of transposable elements might be related to the heterogeneity. We discovered that a minimal and compact nif cluster comprising nine genes nifB, nifH, nifD, nifK, nifE, nifN, nifX, hesA and nifV encoding Mo-nitrogenase is conserved in the 15 N2-fixing strains. The nif cluster is under control of a σ(70)-depedent promoter and possesses a GlnR/TnrA-binding site in the promoter. Suf system encoding [Fe-S] cluster is highly conserved in N2-fixing and non-N2-fixing strains. Furthermore, we demonstrate that the nif cluster enabled Escherichia coli JM109 to fix nitrogen. Phylogeny of the concatenated NifHDK sequences indicates that Paenibacillus and Frankia are sister groups. Phylogeny of the concatenated 275 single-copy core genes suggests that the ancestral Paenibacillus did not fix nitrogen. The N2-fixing Paenibacillus strains were generated by acquiring the nif cluster via horizontal gene transfer (HGT) from a source related to Frankia. During the history of evolution, the nif cluster was lost, producing some non-N2-fixing strains, and vnf encoding V-nitrogenase or anf encoding Fe-nitrogenase was acquired, causing further diversification of some strains. In addition, some N2-fixing strains have additional nif and nif-like genes which may result from gene duplications. The evolution of nitrogen fixation in Paenibacillus involves a mix of gain, loss, HGT and duplication of nif/anf/vnf genes. This study not only reveals the organization and distribution of nitrogen fixation genes in Paenibacillus, but also provides insight into the complex evolutionary history of nitrogen fixation.

OxyR is a key regulator in response to oxidative stress in Streptomyces avermitilis.

The role of the H2O2-sensing transcriptional regulator OxyR in oxidative stress responses in Streptomyces avermitilis was investigated. An oxyR deletion mutant was more sensitive to H2O2 and tert-butyl hydroperoxide than was the WT strain, indicating that OxyR mediates the defensive system against H2O2 and organic peroxide. Evidence presented herein suggests that in cells treated with exogenous H2O2, the oxidized form of OxyR activated expression of ahpCD by binding to a palindromic sequence of the promoter region. Oxidized OxyR also induced expression of other antioxidant enzymes (KatA1, KatA2, KatA3 and OhrB1) and oxidative stress regulators (CatR, OhrR and σR). The thiol-oxidative stress regulator gene sigR was regulated at the transcription level by OxyR. We conclude that OxyR is necessary to activate transcription of sigR from the σR-dependent promoter to express an unstable larger isoform of σR during oxidative stress. In response to oxidative stress, OxyR facilitates rapid production of H2O2-scavenging enzymes to repair oxidative damage through direct regulation and cascaded regulation of CatR, OhrR and σR.

A minimal nitrogen fixation gene cluster from Paenibacillus sp. WLY78 enables expression of active nitrogenase in Escherichia coli.

Most biological nitrogen fixation is catalyzed by molybdenum-dependent nitrogenase, an enzyme complex comprising two component proteins that contains three different metalloclusters. Diazotrophs contain a common core of nitrogen fixation nif genes that encode the structural subunits of the enzyme and components required to synthesize the metalloclusters. However, the complement of nif genes required to enable diazotrophic growth varies significantly amongst nitrogen fixing bacteria and archaea. In this study, we identified a minimal nif gene cluster consisting of nine nif genes in the genome of Paenibacillus sp. WLY78, a gram-positive, facultative anaerobe isolated from the rhizosphere of bamboo. We demonstrate that the nif genes in this organism are organized as an operon comprising nifB, nifH, nifD, nifK, nifE, nifN, nifX, hesA and nifV and that the nif cluster is under the control of a σ(70) (σ(A))-dependent promoter located upstream of nifB. To investigate genetic requirements for diazotrophy, we transferred the Paenibacillus nif cluster to Escherichia coli. The minimal nif gene cluster enables synthesis of catalytically active nitrogenase in this host, when expressed either from the native nifB promoter or from the T7 promoter. Deletion analysis indicates that in addition to the core nif genes, hesA plays an important role in nitrogen fixation and is responsive to the availability of molybdenum. Whereas nif transcription in Paenibacillus is regulated in response to nitrogen availability and by the external oxygen concentration, transcription from the nifB promoter is constitutive in E. coli, indicating that negative regulation of nif transcription is bypassed in the heterologous host. This study demonstrates the potential for engineering nitrogen fixation in a non-nitrogen fixing organism with a minimum set of nine nif genes.

Increasing Avermectin Production in Streptomyces avermitilis by Manipulating the Expression of a Novel TetR-Family Regulator and Its Target Gene Product.

Avermectins produced by Streptomyces avermitilis are commercially important anthelmintic agents. The detailed regulatory mechanisms of avermectin biosynthesis remain unclear. Here, we identified SAV3619, a TetR-family transcriptional regulator designated AveT, to be an activator for both avermectin production and morphological differentiation in S. avermitilis. AveT was shown to indirectly stimulate avermectin production by affecting transcription of the cluster-situated activator gene aveR. AveT directly repressed transcription of its own gene (aveT), adjacent gene pepD2 (sav_3620), sav_7490 (designated aveM), and sav_7491 by binding to an 18-bp perfect palindromic sequence (CGAAACGKTKYCGTTTCG, where K is T or G and Y is T or C and where the underlining indicates inverted repeats) within their promoter regions. aveM (which encodes a putative transmembrane efflux protein belonging to the major facilitator superfamily [MFS]), the important target gene of AveT, had a striking negative effect on avermectin production and morphological differentiation. Overexpression of aveT and deletion of aveM in wild-type and industrial strains of S. avermitilis led to clear increases in the levels of avermectin production. In vitro gel-shift assays suggested that C-5-O-B1, the late pathway precursor of avermectin B1, acts as an AveT ligand. Taken together, our findings indicate positive-feedback regulation of aveT expression and avermectin production by a late pathway intermediate and provide the basis for an efficient strategy to increase avermectin production in S. avermitilis by manipulation of AveT and its target gene product, AveM.

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

Iron response regulator protein IrrB in Magnetospirillum gryphiswaldense MSR-1 helps control the iron/oxygen balance, oxidative stress tolerance, and magnetosome formation.

Magnetotactic bacteria are capable of forming nanosized, membrane-enclosed magnetosomes under iron-rich and oxygen-limited conditions. The complete genomic sequence of Magnetospirillum gryphiswaldense strain MSR-1 has been analyzed and found to contain five fur homologue genes whose protein products are predicted to be involved in iron homeostasis and the response to oxidative stress. Of these, only the MGMSRv2_3149 gene (irrB) was significantly downregulated under high-iron and low-oxygen conditions, during the transition of cell growth from the logarithmic to the stationary phase. The encoded protein, IrrB, containing the conserved HHH motif, was identified as an iron response regulator (Irr) protein belonging to the Fur superfamily. To investigate the function of IrrB, we constructed an irrB deletion mutant (ΔirrB). The levels of cell growth and magnetosome formation were lower in the ΔirrB strain than in the wild type (WT) under both high-iron and low-iron conditions. The ΔirrB strain also showed lower levels of iron uptake and H2O2 tolerance than the WT. Quantitative real-time reverse transcription-PCR analysis indicated that the irrB mutation reduced the expression of numerous genes involved in iron transport, iron storage, heme biosynthesis, and Fe-S cluster assembly. Transcription studies of the other fur homologue genes in the ΔirrB strain indicated complementary functions of the Fur proteins in MSR-1. IrrB appears to be directly responsible for iron metabolism and homeostasis and to be indirectly involved in magnetosome formation. We propose two IrrB-regulated networks (under high- and low-iron conditions) in MSR-1 cells that control the balance of iron and oxygen metabolism and account for the coexistence of five Fur homologues.